ID: 1071527419

View in Genome Browser
Species Human (GRCh38)
Location 10:86366525-86366547
Sequence AGGGCGCAGGGGCGGGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 972
Summary {0: 1, 1: 0, 2: 7, 3: 110, 4: 854}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071527419_1071527437 19 Left 1071527419 10:86366525-86366547 CCGCGCGCCCGCCCCTGCGCCCT 0: 1
1: 0
2: 7
3: 110
4: 854
Right 1071527437 10:86366567-86366589 CCAGCCCAGCCCAGCGCGGTCGG 0: 1
1: 0
2: 4
3: 52
4: 264
1071527419_1071527434 15 Left 1071527419 10:86366525-86366547 CCGCGCGCCCGCCCCTGCGCCCT 0: 1
1: 0
2: 7
3: 110
4: 854
Right 1071527434 10:86366563-86366585 CAGCCCAGCCCAGCCCAGCGCGG 0: 3
1: 11
2: 36
3: 148
4: 797
1071527419_1071527438 20 Left 1071527419 10:86366525-86366547 CCGCGCGCCCGCCCCTGCGCCCT 0: 1
1: 0
2: 7
3: 110
4: 854
Right 1071527438 10:86366568-86366590 CAGCCCAGCCCAGCGCGGTCGGG 0: 1
1: 0
2: 1
3: 57
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071527419 Original CRISPR AGGGCGCAGGGGCGGGCGCG CGG (reversed) Intergenic
900003595 1:29430-29452 AGGGCGCAGTGGAGGGCGAGCGG - Intergenic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
900146272 1:1160223-1160245 AGAGCGCAGGGACGGTCGGGGGG + Intergenic
900151438 1:1180877-1180899 CGGGCGCAGGGACGGGGGCAGGG - Intronic
900151444 1:1180889-1180911 CAGGCGTAGGGGCGGGCGCAGGG - Intronic
900151463 1:1180936-1180958 CGGGCGCAGGGGCAGGGGTGGGG - Intronic
900182120 1:1315737-1315759 AGGGGGCGGGGGCGGGAGCGAGG + Intronic
900243892 1:1629081-1629103 CGGGCGCCGGGGCAGGCCCGAGG - Intronic
900366955 1:2315269-2315291 TGGGGGCGGGGGCGGGGGCGGGG + Intergenic
900368162 1:2319939-2319961 GGGGCAGAGGGGCGGGCGGGGGG - Intergenic
900435523 1:2628979-2629001 TGGGCGGAGGGGCGGGCGACGGG + Intronic
900467017 1:2830855-2830877 AGGCGGCGGGGGCGGGGGCGGGG - Intergenic
900626659 1:3611605-3611627 AGGGGGAAGGGGCGGGGCCGAGG - Intergenic
900631771 1:3640273-3640295 AGGGCGCTGGGGCCTGAGCGAGG + Intronic
900658763 1:3772722-3772744 AGGGGGCGAGGGCGGGGGCGGGG - Intergenic
900988541 1:6087041-6087063 AGGGGGCAGGGGCGGGCTCTGGG - Intronic
901433930 1:9234849-9234871 CGGCCGCAGGGGAAGGCGCGAGG - Exonic
901443492 1:9293188-9293210 GTGGCGCGGGGCCGGGCGCGGGG + Intronic
901506214 1:9687579-9687601 AGGGCGTGGGGGCGGGGCCGGGG + Intronic
901628969 1:10639014-10639036 AGGCGGCGGGCGCGGGCGCGCGG - Exonic
901631731 1:10651330-10651352 AGGGGGCTGGGGTGGGGGCGGGG + Intronic
901791344 1:11654976-11654998 GGGGCGCTGGGGAGGGGGCGCGG + Intronic
901874560 1:12159906-12159928 GGGGCGGGGGGGCGGGGGCGGGG + Intergenic
901930786 1:12595383-12595405 TGGGCCCAGGGGCGGGCGCGGGG + Intronic
902286121 1:15409809-15409831 CGGGCCCGGGGGCGGGGGCGGGG + Intergenic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
902490288 1:16776350-16776372 AGTGGGCAGGGGCGGGGGCAGGG - Intronic
902877542 1:19349848-19349870 AGTGAGCAGGGGCGGGCAAGGGG - Intronic
903132991 1:21291137-21291159 AGGGCTCAGGGGCTGGGGAGGGG - Intronic
903504759 1:23825486-23825508 ACGGCGGAGGGGCGGGGGCGGGG - Intronic
903514726 1:23902790-23902812 CGGGCGCGGGCGCGGGGGCGCGG + Intronic
903555103 1:24187366-24187388 AGGCGGCAGGGACGGGCCCGCGG - Intronic
903635146 1:24808504-24808526 AGGGCGGCAGGGCGGGGGCGGGG - Intronic
903652395 1:24929999-24930021 AGGGCGCAGGGGGCGGCGCCCGG + Intronic
903693012 1:25187429-25187451 AGGGTGCTGGGGGGGGAGCGGGG - Intergenic
904181364 1:28668883-28668905 GGGGCGGGGGGGCGGGCGCGGGG + Intronic
904445439 1:30570081-30570103 AGGGCGGGGGAGGGGGCGCGTGG + Intergenic
904528845 1:31155124-31155146 CGGGCGCGGGCGCGGGCGCGGGG + Intergenic
904533022 1:31181674-31181696 GAGGCGCCGGGGTGGGCGCGGGG + Exonic
904583409 1:31564662-31564684 GGAGCGCAGGGGAGGGAGCGGGG - Intergenic
904619031 1:31764391-31764413 CGCGCGCCGGGCCGGGCGCGAGG + Intronic
904677188 1:32205721-32205743 CAGGTGCGGGGGCGGGCGCGGGG + Exonic
904941376 1:34166542-34166564 AGGGGGCAGTGGCCGGCGGGCGG + Intergenic
905308524 1:37034556-37034578 AGGGCGCAGGGGAGGGGGCTGGG - Intergenic
905408648 1:37753711-37753733 TGGGAGCAGGGGCGAGCGGGAGG + Intronic
905518368 1:38578662-38578684 AGCGCGCAGCCGAGGGCGCGGGG - Intergenic
905639105 1:39576472-39576494 GGTGCGCCGGGGCAGGCGCGGGG + Intronic
905775507 1:40665258-40665280 AGTGTGCAGGGGCGGGGGTGGGG - Intronic
905847196 1:41242460-41242482 AGGGCGCGAGGGCGGGGACGAGG + Intergenic
906044506 1:42817339-42817361 GGGGCGCAGGGCCGAGCGCCAGG + Intronic
906140361 1:43530830-43530852 GGGGCGCGGGCGCGAGCGCGAGG + Intronic
906204332 1:43979170-43979192 GGGCCGCGGGGGCGCGCGCGCGG + Intronic
906204335 1:43979178-43979200 GGGGCGCGCGCGCGGGCGCGCGG + Intronic
906667374 1:47631496-47631518 AGGACAGAGGGGCGGGCTCGGGG - Intergenic
907011596 1:50968584-50968606 AGGGCGCGGGACCGGGCGGGCGG + Exonic
907689145 1:56645252-56645274 AGGGGCGCGGGGCGGGCGCGGGG - Intronic
908703854 1:66930135-66930157 CCGGAGCAGGGGCGCGCGCGCGG - Intronic
909793056 1:79700339-79700361 AGGGTGGAGGGGCGGAGGCGAGG + Intergenic
910759116 1:90718046-90718068 GGGGCGCGGGGCCGGACGCGCGG - Intergenic
910909554 1:92218716-92218738 AGAGGGGAGGGGCAGGCGCGGGG - Intronic
911667675 1:100572305-100572327 TGGGCGTAGTGGCGGGCGCCTGG + Intergenic
912185508 1:107270698-107270720 GGGGGGCGGGGGCGGGGGCGGGG - Intronic
912559338 1:110538880-110538902 AGGACTCAGGGGCGGGAGGGAGG - Intergenic
914386157 1:147172225-147172247 GAGGCGCAGGGGCGGGGCCGGGG - Intronic
914694709 1:150067020-150067042 AGAGCGCCGAGGCGGGGGCGGGG + Intergenic
914702948 1:150150386-150150408 GGGCCGCCGGGGCGGGGGCGCGG - Intronic
914869078 1:151458682-151458704 AAGGGGCGGGGGCGGGGGCGCGG - Intronic
914993096 1:152515461-152515483 CGGGCGCCGGGGTGGGCGCCGGG - Exonic
915219346 1:154361756-154361778 AGGGTGCAGGGCCGGGGGTGGGG + Intergenic
915519836 1:156435731-156435753 AGGGCGAGGGCGAGGGCGCGAGG - Intergenic
915552245 1:156642032-156642054 AGGGGGCGGGGGCGGCCCCGGGG + Exonic
915598555 1:156908631-156908653 TGGGGGCAGAGGCGGGGGCGTGG - Intronic
915601284 1:156924565-156924587 AGGGAGCTGGGGCGGGTGGGGGG - Intronic
917438369 1:175044091-175044113 AGTGCGCAGGGGCCACCGCGTGG - Intergenic
918023608 1:180720104-180720126 AGGGAGCAGGGCCGGGGGCGTGG + Intronic
919712070 1:200738829-200738851 AGGGGGCGGGGGCGGGGGCGGGG + Intergenic
919727135 1:200891658-200891680 AGGGCGCAGGGGCAGGCGGGCGG + Intronic
919977999 1:202625470-202625492 AGGGGGCAGGGGCAGGAGCCCGG + Intronic
919981086 1:202643316-202643338 AGAGGGCGGGGGCGGGGGCGGGG + Exonic
919981090 1:202643322-202643344 CGGGGGCGGGGGCGGGGGCGGGG + Exonic
920080306 1:203368265-203368287 AAGGCGCGGGGGTGGGGGCGGGG + Intergenic
920114047 1:203607346-203607368 AGGACACCGGGGCGGGAGCGTGG + Intergenic
920278837 1:204828586-204828608 AGCGCGAAGGGAGGGGCGCGGGG + Intergenic
920367783 1:205457122-205457144 AGCCCGCAGGGGCGGGGGAGGGG + Intergenic
920912703 1:210233108-210233130 AGGGCGCGCGGGAGGCCGCGTGG - Intronic
922116317 1:222617944-222617966 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
922502887 1:226110059-226110081 CGGGGGCGGGGGCGTGCGCGTGG + Intergenic
922741531 1:228016814-228016836 AGGGGGCAGGGGAGGGTGCCAGG + Intronic
922851160 1:228735321-228735343 CGGGCGCGGGTGCAGGCGCGCGG + Exonic
922937315 1:229432499-229432521 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
923146627 1:231203001-231203023 AGGGCCCAGGGGATGGAGCGAGG + Intronic
923505318 1:234600276-234600298 CGTGCGCAGAGCCGGGCGCGCGG + Intergenic
923530152 1:234806180-234806202 AGTGGGCAGGGGCGGGGGCAGGG + Intergenic
923647481 1:235838971-235838993 AGGGCGCAGGGGTGGGGGATAGG - Intronic
924436707 1:244049000-244049022 AGGGGCCAGGGGCCGGCGCCGGG - Intronic
1063121303 10:3106885-3106907 GGGGCGAAGGGGCAGGGGCGAGG - Intronic
1063417655 10:5887679-5887701 AGGGGGTGGGGGCGGGGGCGCGG - Intronic
1063429636 10:5977470-5977492 ATGGCCCCGCGGCGGGCGCGCGG - Exonic
1063657773 10:8009156-8009178 TGGGGCCGGGGGCGGGCGCGGGG - Exonic
1064408845 10:15088388-15088410 CGAGCGAAGGGGCGGGAGCGGGG + Intronic
1065025066 10:21534018-21534040 CGGGCGCGGGGGCGCGCACGCGG - Intergenic
1065025239 10:21534553-21534575 GGGGCGCCGGGGCGGGCTCGGGG + Intronic
1065025397 10:21535121-21535143 TGGGGGCGGGGGCGGGGGCGGGG + Intronic
1065186523 10:23174605-23174627 AGGCCGGCGGGGCGGGGGCGGGG - Intergenic
1065204394 10:23343860-23343882 AGGGCTCCGGGGCGGGCCGGCGG + Intronic
1065590366 10:27256783-27256805 AGGGGGGCGGGGCGGGAGCGGGG - Intergenic
1066080804 10:31928844-31928866 AGCGCGCCGGCGCGGGGGCGGGG + Intronic
1066180604 10:32958003-32958025 TGGGGGCGGGGGCGGGGGCGGGG - Intronic
1066457654 10:35585862-35585884 ATGGGGCAGGGGTGGGCGCTGGG - Intergenic
1066963650 10:42242482-42242504 AGGGCGCGAGGCGGGGCGCGCGG - Intergenic
1067096534 10:43305050-43305072 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1067096538 10:43305056-43305078 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1067336947 10:45374101-45374123 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1067336951 10:45374107-45374129 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1067336955 10:45374113-45374135 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1067453766 10:46398357-46398379 GGCGCGCGGGGGCGGGCGCGCGG + Intergenic
1067583461 10:47461389-47461411 GGCGCGCGGGGGCGGGCGCGCGG - Intronic
1067596998 10:47565928-47565950 ATGGTGGAGGGGCGCGCGCGCGG + Intergenic
1067633465 10:47986737-47986759 GGCGCGCGGGGGCGGGCGCGCGG - Intergenic
1067713805 10:48671684-48671706 AGGCCGCAGGGGCTCGGGCGAGG + Intergenic
1068776370 10:60872555-60872577 AGGTGGCAGGGGAGGGCGGGAGG - Intronic
1069557798 10:69408898-69408920 TGGGCGCGGGGGCGGGGGCCTGG - Intronic
1069661408 10:70126026-70126048 AGGGCCCAGGGGCTGGCCTGGGG + Intronic
1070592898 10:77812944-77812966 AGGGCGCCGGGGCAGGGGCTCGG + Intronic
1070767944 10:79067290-79067312 AGGCTGCAGGGTCGGGGGCGCGG - Intergenic
1071434584 10:85635407-85635429 AGGGGGCAGGGGAGGGCAGGGGG - Intronic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1072591614 10:96832703-96832725 CGGGAGCAGGGGCGGGAGCGGGG - Intronic
1072757635 10:98031073-98031095 TGCGCGCAGGGGTGGCCGCGGGG - Intergenic
1073049191 10:100656698-100656720 GGGGCGCAGCGGCGGGCGAAGGG + Intergenic
1073121133 10:101123218-101123240 AGGGGCGAGGGGCGGGTGCGGGG - Intronic
1073251031 10:102120429-102120451 AGGGCGGAGAGGGGGGCGCTCGG - Exonic
1074165692 10:110872103-110872125 AGGGGGCGGGGGCGGAGGCGTGG + Intronic
1074377437 10:112951441-112951463 AGGGGACAGCGGCGGCCGCGCGG - Intronic
1074503341 10:114044972-114044994 CGGGCGGCGGCGCGGGCGCGGGG - Exonic
1075032050 10:119030081-119030103 GGGGCGCTGGGGCCGGCGCTGGG + Exonic
1075320508 10:121487947-121487969 AGTGGGCAGGGGCGGGGGTGAGG - Intronic
1075375287 10:121974167-121974189 AGAGCGCAGGGGCCGGGGCTTGG - Intronic
1075616087 10:123891719-123891741 CGGGCGCAGAAGCTGGCGCGGGG + Exonic
1076306171 10:129467097-129467119 AGCGCGCGGGGGCGGGGCCGGGG - Intergenic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076670374 10:132117654-132117676 AGGGTGCAGGCGTGGGCTCGGGG + Intronic
1076682632 10:132181846-132181868 TGGGCTGAGGGGCGGGAGCGAGG - Intronic
1077018477 11:407185-407207 GCGGCGCAGGGGCGGGGGCGGGG + Intronic
1077027630 11:448307-448329 AGGGTGCAGAGGCCGGGGCGGGG - Intronic
1077052973 11:576024-576046 GGGGCGGAGCTGCGGGCGCGAGG + Intergenic
1077065535 11:639558-639580 GGGGCGCCGGGGCGCGGGCGGGG - Intronic
1077065544 11:639578-639600 AGGGCGGCGGGCGGGGCGCGGGG - Intronic
1077107886 11:849796-849818 AGGGCGCGGGGCGGGGCGCGCGG + Intronic
1077204710 11:1336783-1336805 GGGGCGTGGGGGCGGGGGCGGGG + Intergenic
1077211032 11:1371041-1371063 AGGGCGCAGGGCCGGGGATGTGG - Intergenic
1077235841 11:1481697-1481719 AGGGAGCAGGGGCAGGAGCAGGG + Intronic
1077249923 11:1556588-1556610 ATGGTGGAGGGGCGCGCGCGCGG - Exonic
1077320639 11:1939440-1939462 AAGACTCAGGGGCGGGCGGGCGG + Intergenic
1077535571 11:3122457-3122479 AGGGCACAGGGGCCGGCCCAGGG + Intronic
1077923093 11:6655863-6655885 CGGGCGGAGGGGCGGGGGCTCGG - Intergenic
1078210318 11:9265125-9265147 AGGGCGGACGGGCGGGCGCCCGG - Exonic
1079035133 11:17014255-17014277 GGGGCGCGGGGGCGGGGGCCGGG - Intronic
1079250148 11:18781146-18781168 AGGGGGCCGGGGCGGGGCCGGGG - Intronic
1080551506 11:33376708-33376730 GGGGCGCGGGGGCCGGCCCGTGG + Intergenic
1080888324 11:36387000-36387022 CTGGCGCAGGGGCAGGCGTGGGG + Intronic
1081207562 11:40293197-40293219 GGGGGGCGGGGGCGGGGGCGGGG + Exonic
1081969070 11:47186038-47186060 GGGGCCTCGGGGCGGGCGCGAGG + Intronic
1081981442 11:47269655-47269677 CGGGGGCAGAGGGGGGCGCGCGG - Exonic
1083595571 11:63917068-63917090 AGCGCGCCGGGGAGGGTGCGAGG - Intergenic
1083747714 11:64744869-64744891 CTGGCGCGGGGGCGGGGGCGGGG - Intronic
1083757773 11:64800821-64800843 AGGGCCCTGTGGAGGGCGCGAGG + Exonic
1083764720 11:64836300-64836322 AGGAGGCAGGGGAGGGAGCGGGG + Intronic
1083883438 11:65559132-65559154 AGGGCCCAGGGGCTGGAGAGGGG + Intergenic
1083894113 11:65611634-65611656 AGGGAGCAGGGGCTGGAGCAGGG + Intronic
1084086176 11:66856411-66856433 AGGGCGGGGCGGCGGGGGCGGGG + Intronic
1084165306 11:67372619-67372641 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1084165310 11:67372625-67372647 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1084295930 11:68213437-68213459 GGGGCGCGGGGGCGGGCGCCGGG - Intronic
1084329593 11:68422849-68422871 AGGGTGCAGGGGCGGGTGAGTGG - Intronic
1084416387 11:69035353-69035375 GGGGCGCAGGGGCCGGCAAGGGG - Intergenic
1084516583 11:69641030-69641052 GGGGGGCGGGGGCGGGCGCAGGG - Intergenic
1084538898 11:69774706-69774728 GGCGCGAAGGGGCGGGGGCGGGG - Intronic
1085043928 11:73342805-73342827 TGGGGGAAGGGGCGGGTGCGAGG + Intronic
1085321556 11:75577327-75577349 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1087795677 11:102452839-102452861 GTGGCGCGGGGGCGGGCTCGGGG + Exonic
1089098510 11:115939831-115939853 AGGTGGCAGGGGCGGGCAGGAGG + Intergenic
1089494984 11:118903297-118903319 TGGGGGCGGGGGCGGGGGCGGGG - Exonic
1089729636 11:120512038-120512060 AGGGCGCGGGGGCGGGGGCCGGG - Intronic
1090238451 11:125165722-125165744 CGGGCGTAGGGGCCCGCGCGAGG + Intronic
1090388758 11:126373594-126373616 AGGCTGCAGGGGCGGACGGGAGG + Intronic
1090788365 11:130069625-130069647 CAGGCGCGGGGGCGTGCGCGCGG - Intergenic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1091381832 12:66859-66881 AGGGCGCAGGCGGCGGCGGGCGG + Exonic
1091449460 12:563327-563349 AGGGCGCAGGGGTGTGGGCAGGG - Exonic
1091718098 12:2794449-2794471 AGAGGGCAAGGGCGTGCGCGGGG - Intergenic
1091797445 12:3305413-3305435 AGGGAGCAGGGGAGGGGGGGAGG - Intergenic
1091825218 12:3507261-3507283 CGGGCGCAGTGGCGGGCACCTGG - Intronic
1092204517 12:6607035-6607057 AGGGCGAGGGGGTGGGCGCCGGG + Intronic
1092219110 12:6700727-6700749 AGGGCGCTGGAGCGGGTGGGGGG + Intronic
1092861846 12:12725327-12725349 AGGGGGTGGGGGCGGGCGCTCGG - Intergenic
1092861901 12:12725648-12725670 AGGGGCCCCGGGCGGGCGCGGGG - Intergenic
1093464842 12:19439370-19439392 CAGGCGCCGGGGCGGGGGCGGGG + Intronic
1093493171 12:19726832-19726854 AGGGCCCAGGAGCAGGCGGGAGG - Intergenic
1094486020 12:30926635-30926657 TGGGCGCAGGGGCGCGGGCCGGG + Intronic
1094703995 12:32896960-32896982 CGGGCCCGGGGGCGGGGGCGGGG + Intergenic
1096302031 12:50438206-50438228 AGGAGGCAGGGCTGGGCGCGGGG + Intronic
1096336943 12:50764056-50764078 TGGGGGCGGGGGCGGGGGCGGGG - Intronic
1096647587 12:53047176-53047198 CGGGCGCGGGCGCGGGCGCGGGG + Intronic
1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG + Intronic
1097190476 12:57217044-57217066 GGGGCGCTAGCGCGGGCGCGGGG + Intronic
1097218190 12:57430635-57430657 CGGCCGCACGGGCGGGCGCGAGG - Intronic
1097247463 12:57614411-57614433 AGGGGGCAGGGCCTGGGGCGGGG + Intronic
1097281246 12:57846467-57846489 CGGGAGGACGGGCGGGCGCGCGG + Exonic
1100839132 12:98594085-98594107 AGGGCGGCGGGGCTGGCCCGTGG - Exonic
1101750843 12:107581306-107581328 TAGGCGCGGGGGCGGGCGGGGGG + Intronic
1101878406 12:108610223-108610245 AGGGCGTAGGGGCTGAGGCGAGG - Intergenic
1102471397 12:113161795-113161817 TGGGGGCGGGGGCGGGGGCGGGG - Intronic
1103410779 12:120710350-120710372 CGGGGGCGGGGGCGGGCGCCCGG - Intergenic
1103433106 12:120904353-120904375 GGGGAGGAGGGGCGGGGGCGGGG + Exonic
1103713339 12:122929143-122929165 AGAGCACAGGGGCGGGTGTGGGG + Exonic
1103764674 12:123271707-123271729 CGGGCGCTCGGACGGGCGCGGGG - Exonic
1103856006 12:123972225-123972247 ACCCCGCGGGGGCGGGCGCGGGG + Intronic
1103909412 12:124344161-124344183 AGGGCCCAGGGGCTGGGGCTGGG + Intronic
1103994023 12:124817565-124817587 AAGCCGCAGGTGCGGGAGCGCGG - Exonic
1104670124 12:130674770-130674792 AGGGTGCAGGGGCGGGGGTGGGG - Intronic
1104854299 12:131894889-131894911 GGGGCGCGGGGCCGGGGGCGCGG - Exonic
1104980575 12:132571547-132571569 AGGGGGCGGGGGCGGGCGTGGGG + Intronic
1106241618 13:27917952-27917974 AGGGAGCAGGGGAGGGAGAGTGG + Intergenic
1106340101 13:28819767-28819789 CGGGAGCTGGGGCGGGGGCGGGG + Intergenic
1106340131 13:28819843-28819865 CGCGCGCAGGAGCGGGCGCAGGG + Intergenic
1106995835 13:35478728-35478750 AGGGCGCAGGGGCCCGCGGCTGG - Intronic
1107043647 13:35973817-35973839 AGGGAGCAGGGGCTGGCTCATGG + Intronic
1107123391 13:36819368-36819390 AGGGTGTAGCGGAGGGCGCGGGG + Exonic
1107931553 13:45311680-45311702 CGGACGCCGGGGCGGGCTCGTGG - Intergenic
1107931592 13:45311822-45311844 AGGGCGCAGGGGCGAGTCCTGGG + Intergenic
1108292709 13:48976577-48976599 AGGGCTCGGGGGCGGGGGCGGGG + Intronic
1108292713 13:48976583-48976605 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1111199958 13:84922603-84922625 GGGGGGCCGGGGCGGGGGCGGGG - Intergenic
1112344295 13:98577165-98577187 GGGCCGTGGGGGCGGGCGCGGGG - Intronic
1112752557 13:102597219-102597241 AGGGCCCGGGCGCGGGGGCGCGG + Intronic
1113473281 13:110561767-110561789 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1113473287 13:110561773-110561795 AGGGCCCGGGGGCGGGGGCGGGG - Intergenic
1113660464 13:112103840-112103862 GGGGGGCGGGGGCGGGGGCGCGG + Intergenic
1113768303 13:112894251-112894273 GGGGCCCGGGGGCGGGGGCGGGG - Intergenic
1113820393 13:113209132-113209154 AGGGCTCAGGGGTGCGCGCCGGG - Intronic
1113834752 13:113321495-113321517 TGGGCGCGCGGGCGGGGGCGGGG - Intronic
1113888668 13:113725166-113725188 GGGGCGCGTGGGAGGGCGCGAGG - Intronic
1113904563 13:113813163-113813185 AGGGCGGGAGGGCGGGCGAGAGG + Exonic
1113917811 13:113884550-113884572 AGGGGCCAGGGGCGGGTGGGTGG - Intergenic
1114270593 14:21098170-21098192 AGGGGGCGGGGGCGGGGGAGGGG - Intronic
1114487541 14:23071781-23071803 AGGGGGCAGGGGAGGGGGCTGGG + Intronic
1114650985 14:24284522-24284544 AGGGCCCAGGGGAGTGCGCTTGG + Intergenic
1115728139 14:36239303-36239325 GGGGCGGTGGGGGGGGCGCGGGG + Intergenic
1116658229 14:47676011-47676033 AGGGCGAAGCGGCAAGCGCGGGG + Intergenic
1116861795 14:50001338-50001360 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1117763850 14:59059721-59059743 AGGGGGCAGGGGCAGGGGCAGGG + Intergenic
1117962597 14:61178036-61178058 AAGGCACAGGGGTAGGCGCGTGG - Intergenic
1117978668 14:61321551-61321573 AAGGCGCGGGAGCGGACGCGGGG + Intronic
1118270614 14:64339006-64339028 GGGGCGCAGGCGCGGTAGCGCGG + Intergenic
1120190557 14:81436227-81436249 GGGGGGCGGGGGCGGGGGCGGGG - Intronic
1122082409 14:99274690-99274712 AGGGCGAAGGGGCCGGCTCAAGG - Intergenic
1122232477 14:100313645-100313667 AGGGGGCAGGAGTGGGGGCGGGG + Intergenic
1122284426 14:100642280-100642302 AGGGGGCAGGGGCCGGCTCAAGG + Intergenic
1122620718 14:103056566-103056588 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1122885141 14:104707538-104707560 AGGGAGCAGGGGTGGGGGTGGGG - Exonic
1122917395 14:104865392-104865414 CGGGCGGGCGGGCGGGCGCGAGG + Exonic
1122947839 14:105021290-105021312 CGGGCGCAGGGGCGGGGGCGGGG - Intergenic
1123180274 14:106463135-106463157 AGGTCCCAGGGGCGGGTGCAGGG - Intergenic
1123441437 15:20294917-20294939 AGGGCCCGAGGCCGGGCGCGCGG + Intergenic
1123898075 15:24848249-24848271 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1124142288 15:27088250-27088272 CGGGCGCGGGGGCGGGCGCGGGG + Intronic
1124493605 15:30173394-30173416 AGGGAGCAGGGGCAGGAGCCCGG + Intergenic
1124640024 15:31391599-31391621 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1124640358 15:31392815-31392837 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1124749963 15:32365255-32365277 AGGGAGCAGGGGCAGGAGCCCGG - Intergenic
1124942711 15:34232957-34232979 AAGGCGCGGGGGTGGGGGCGGGG + Intronic
1125597123 15:40894325-40894347 AGGGCTGAGGGCTGGGCGCGTGG - Intergenic
1127893725 15:63277321-63277343 CGGGCGCAGGGGCGGGCTCAAGG - Intronic
1128269128 15:66293517-66293539 AGGGCCGAGGGGCGGGTCCGAGG + Intronic
1128344142 15:66842852-66842874 AGGGCGCGGCTCCGGGCGCGGGG + Intergenic
1129082347 15:73052299-73052321 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1129424617 15:75454681-75454703 ATGGGGCGGGGGCGGGGGCGCGG - Intronic
1129468496 15:75737683-75737705 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1129676557 15:77634904-77634926 GGGGGGCGGGGGCGGGGGCGAGG + Intronic
1129862398 15:78872801-78872823 CGGGCGCAGGGGCGCGTGCGCGG + Exonic
1130020737 15:80229203-80229225 AGGGTGCGGGGCCGGGCGGGAGG - Intergenic
1130224356 15:82046080-82046102 AGGGCGGGCGGGCGGGCGGGAGG - Exonic
1131055400 15:89371738-89371760 AGGGCCCAGGCGAGGCCGCGCGG + Intergenic
1131212544 15:90510371-90510393 AGGGCACAGGGGAGGGTGAGGGG - Intergenic
1131256614 15:90867063-90867085 AGGGGGCAGGGAGGGGCGGGAGG - Intergenic
1131272271 15:90954712-90954734 AGGGCGCTGGGGCGGGGGTTGGG + Intergenic
1131701560 15:94942660-94942682 AGGGCGGCAGGGCGGGGGCGGGG - Intergenic
1132079487 15:98852343-98852365 ACGGCGGCGGCGCGGGCGCGGGG - Intronic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1132552776 16:560249-560271 AGGGGGCGGCGGGGGGCGCGCGG + Intergenic
1132553548 16:563323-563345 TGGGCACAGGGGCGAGGGCGCGG + Exonic
1132671083 16:1102601-1102623 AGGGCGCAAGGGTGGGCGGTGGG - Intergenic
1132828892 16:1918131-1918153 AGGGCGCGGGGGCCGGCGCGGGG + Exonic
1132844291 16:1992802-1992824 GGGGCGAAGGGGCGGGCGCTCGG + Intronic
1132897833 16:2237311-2237333 GGGCCGCAGGGAGGGGCGCGCGG + Intronic
1132943554 16:2520243-2520265 TGGGGGCGGGGGCGGGCGGGCGG + Intronic
1133040609 16:3058354-3058376 GGCGCGCTGGGGCCGGCGCGGGG + Intronic
1133053866 16:3135099-3135121 CGGGGGCGGGGGCGGGGGCGGGG + Exonic
1133072251 16:3254412-3254434 AGGCTGCAGGGGCTGGCGGGGGG - Exonic
1133076160 16:3282868-3282890 AGGGCGCACGCGCAGTCGCGAGG + Intronic
1133223127 16:4327760-4327782 AGCGCGCGGGGGCGGCCGCGGGG - Intronic
1133223172 16:4327905-4327927 AGGGCCCAGGGGTTGGGGCGAGG - Intronic
1133235348 16:4384964-4384986 AGGGGGCAGTGGCGGGGGGGTGG + Intronic
1133272356 16:4616425-4616447 AGGCGGCGGGGGCGGGCGCTGGG + Intergenic
1134531973 16:14990181-14990203 AGGGCGCGAGGGCGGCCGCCGGG + Intronic
1134587908 16:15428041-15428063 AGGGCTCGGGGGCGGTGGCGGGG + Intronic
1134849751 16:17470501-17470523 GGGCCCCAGGCGCGGGCGCGGGG - Exonic
1135135817 16:19884915-19884937 CGGGGGCGGGGGCGGGGGCGGGG - Exonic
1135435024 16:22420922-22420944 AGGACGCGGGGGTGGGCGCAGGG + Intronic
1136287908 16:29254851-29254873 AGGGAGAAGGGGCGGGGGCCAGG - Intergenic
1136391080 16:29964658-29964680 AGGGTGGTGGGGGGGGCGCGGGG - Intronic
1136709967 16:32228925-32228947 GGGGGGCAGGGGCGGGCGCAGGG + Intergenic
1136757942 16:32700486-32700508 GGGGGGCAGGGGCGGGCGCAGGG - Intergenic
1136810164 16:33169889-33169911 GGGGGGCAGGGGCGGGCGCAGGG + Intergenic
1136816640 16:33279969-33279991 GGGGGGCAGGGGCGGGCGCAGGG + Intronic
1136843138 16:33555046-33555068 AGGGCGCGAGGCGGGGCGCGCGG - Intergenic
1137288794 16:47037781-47037803 AGGGCGCCGGGGAGGCCGCGAGG + Intergenic
1137530830 16:49277836-49277858 AGGGCGAAGGGCCGGGAGCTGGG - Intergenic
1137665278 16:50246050-50246072 GGGGCGCGGGGGCGGGAGCCGGG - Intergenic
1137686669 16:50391406-50391428 GGTGCGCGGGGGCGGGCGGGCGG + Intergenic
1137712154 16:50573857-50573879 GGGGAGCAGGGGCGGGGGTGAGG + Intronic
1138178596 16:54928375-54928397 ACGGGGCGGGGGCGGGGGCGGGG + Intergenic
1138178600 16:54928381-54928403 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1138651839 16:58465079-58465101 AGGGAGCAGGGACGGGGGGGAGG + Intronic
1139615355 16:68085346-68085368 AGGGGGCGGGGCCGGGCGCGCGG + Intronic
1141682948 16:85554792-85554814 AGGACGGACGGGCGGGCGGGCGG + Intergenic
1141698973 16:85633796-85633818 AGGGAGCAGGGGCAGCCCCGGGG - Intronic
1141972316 16:87492390-87492412 CGGGCGCCGGGGCGGGGGCGGGG + Intergenic
1141989558 16:87602413-87602435 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1141989562 16:87602419-87602441 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1142008645 16:87702352-87702374 AGGGTGCAGGGGCAGGGGGGCGG + Intronic
1142044210 16:87914697-87914719 AGGACGTGGGGGCGGGCGCAGGG + Intronic
1142120222 16:88383352-88383374 AGGGCGCAGGAGCGGGAGCCGGG - Intergenic
1142156329 16:88534292-88534314 AGCGCGCAGGGGCGAGGCCGGGG - Exonic
1142228703 16:88889394-88889416 AGGAGGCAGGGGCGGGAGGGAGG + Intronic
1142252711 16:88999843-88999865 AGGGCGGAGGGCGGGGGGCGGGG + Intergenic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142352732 16:89587331-89587353 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1142395280 16:89828388-89828410 AGGGCGCGGGGGGCGGGGCGCGG - Intronic
1142430284 16:90022724-90022746 GGTGAGCAGGGGCGGGAGCGGGG + Exonic
1203060093 16_KI270728v1_random:960835-960857 GGGGGGCAGGGGCGGGCGCAGGG - Intergenic
1203153303 16_KI270728v1_random:1855344-1855366 AGGGCGCGAGGCGGGGCGCGCGG - Intergenic
1142509641 17:385756-385778 TGCGCGCCGGGGCGGGCGCTGGG + Intronic
1142659675 17:1419233-1419255 GGGGCGCAGGGTGGGGGGCGGGG - Intergenic
1142863320 17:2776536-2776558 GGGGCGGAGGGGCGGGCACCGGG - Intergenic
1142876087 17:2853000-2853022 AGGGCGGAGTGGGGGGCGCCCGG + Intronic
1143181675 17:4987557-4987579 GGGGCGGAGAGGCGGGCGAGAGG + Intronic
1143223743 17:5282641-5282663 CGGGCGGAGGCGGGGGCGCGCGG + Intronic
1143471129 17:7176955-7176977 AGGGCGCTGGGGCGGGGCTGGGG - Intronic
1143480753 17:7226251-7226273 AGGGCGCACGGGGAGGCCCGAGG - Exonic
1143571829 17:7764057-7764079 AGGGGGCAGGGGCAGGCACTGGG + Intronic
1143714231 17:8755676-8755698 AGGGAACAGGGGCTGGGGCGCGG + Intronic
1144586779 17:16492055-16492077 AGCGCGCACGGGCGGCCGAGGGG - Intronic
1144724721 17:17496191-17496213 GGGCCGCGAGGGCGGGCGCGGGG + Exonic
1144948383 17:18981348-18981370 AGCGAGCAGGGGCGGGCTCCTGG + Intronic
1145244294 17:21258171-21258193 AGGGGGCAGGGGCGTGCTCCTGG + Intergenic
1145321526 17:21769983-21770005 AGGGTACAGGGGAGGGCGCCCGG + Intergenic
1147249597 17:39145145-39145167 AGGGTGCAGGGGCAGCCCCGGGG + Intronic
1147253150 17:39165564-39165586 CGGGGGCAGGGGAGGCCGCGGGG + Intronic
1147440227 17:40443359-40443381 GGGGAGCCGGGGCGGGCGAGGGG - Intergenic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1148122644 17:45221950-45221972 GGCGCGCAGGGGCCGGAGCGCGG - Exonic
1148553504 17:48564425-48564447 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1148558652 17:48593433-48593455 GGGGCTCCTGGGCGGGCGCGGGG + Exonic
1148760434 17:49997029-49997051 TGGGGGCGGGGGCGGGCGAGGGG + Intergenic
1148845056 17:50525030-50525052 AGGGGGCAGGGGCTGGCGCTGGG - Intronic
1148936223 17:51166386-51166408 GGGGCGCAGGGCGGAGCGCGGGG - Intronic
1149293333 17:55238333-55238355 GGCGCGCAGGGGCGGGTCCGCGG - Intergenic
1149356583 17:55845684-55845706 AGGCCGCAGGGCCCGCCGCGCGG - Intergenic
1149512560 17:57256035-57256057 AGGGCACAGCGGAGGGCGGGCGG + Intronic
1149994768 17:61400593-61400615 AAGGCGCGCGGGCGGGCGGGCGG + Intronic
1150217119 17:63476996-63477018 AGCGCGGCGGGGCGGGGGCGGGG + Intergenic
1150747202 17:67825670-67825692 AAGGGGGAGGGGCGGGCGCAGGG - Exonic
1151296907 17:73192828-73192850 CGGGGGCGGGCGCGGGCGCGGGG - Intronic
1151296921 17:73192854-73192876 GGCGCGAGGGGGCGGGCGCGAGG - Intronic
1151296927 17:73192868-73192890 GGCGCGAGGGGGCGGGCGCGAGG - Intronic
1151296933 17:73192882-73192904 GGCGCGAGGGGGCGGGCGCGAGG - Intronic
1151296939 17:73192896-73192918 GGCGCGAGGGGGCGGGCGCGAGG - Intronic
1151296945 17:73192910-73192932 GGCGCGAGGGGGCGGGCGCGAGG - Intronic
1151296951 17:73192924-73192946 GGCGCGAGGGGGCGGGCGCGAGG - Intronic
1151438476 17:74113404-74113426 CGGGGGCGGGGGCGGGGGCGAGG + Intergenic
1151438689 17:74114475-74114497 TGGGGGCAGGGGCAGGCGGGAGG + Intergenic
1151608142 17:75153585-75153607 GGGGGGCGGGGGCGGGCGCGGGG - Intronic
1151673880 17:75588357-75588379 CGGGCCCAGGGGCGGCCGCGGGG + Intergenic
1151711416 17:75809087-75809109 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1152110228 17:78353610-78353632 AGGGCACAGGGCTGGGAGCGGGG + Intergenic
1152175158 17:78782342-78782364 CAGGCGCAGGCGCGGGCGGGCGG - Intergenic
1152349757 17:79778063-79778085 AGCGCGCGGGGGCGGGCGGCGGG + Intergenic
1152357251 17:79813294-79813316 AGCGGGCGGGGGCGGCCGCGGGG - Intergenic
1152541915 17:80981136-80981158 GGGGCGCGGGGGCGGGGGCACGG - Intergenic
1152705725 17:81842707-81842729 TGGGCGCAGGGACGCGCGCCTGG - Intergenic
1152742055 17:82022719-82022741 AAGGCACAGGGGGCGGCGCGGGG + Intronic
1152744168 17:82031571-82031593 CGGGGGCGGGGGCGGGCGGGGGG - Intergenic
1152924482 17:83080860-83080882 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1153031000 18:712657-712679 AGGGCGGGAGGGCGGGAGCGCGG + Intronic
1153386954 18:4509710-4509732 ATGGCGCGGGGGCGGGGGGGGGG + Intergenic
1155284100 18:24271454-24271476 GGGGTGCAGCCGCGGGCGCGTGG - Intronic
1155519599 18:26656103-26656125 GGGGCGCAGAGGTGGGCGGGAGG - Intronic
1155954219 18:31943302-31943324 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1155954223 18:31943308-31943330 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1156350734 18:36298647-36298669 TGGGAGGAGGGGCGGGGGCGCGG + Intronic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1157384227 18:47248071-47248093 CGGGCGCGGGGGCGGGTGCCGGG - Intronic
1157384232 18:47248083-47248105 TGGGCGTGGGCGCGGGCGCGGGG - Intronic
1157473691 18:48008322-48008344 GGGGCGCTGGGCCGGGGGCGGGG + Intergenic
1157665927 18:49487009-49487031 AGGGCGGAGGAGCGCGCTCGCGG + Intronic
1158952489 18:62507062-62507084 TGGGGGCAGGGGCGGGGGTGGGG + Intergenic
1158976575 18:62715953-62715975 CGGGCGCAGGAGGCGGCGCGGGG + Exonic
1160025355 18:75211558-75211580 CGGGCGCAGCAGCGGGCGCTCGG - Intronic
1160499602 18:79395528-79395550 GGGGCGTAGGGGCGGGAACGGGG - Intergenic
1160631174 18:80247249-80247271 GGGCCGCCGGGGCGGGCGGGGGG + Intronic
1160631261 18:80247577-80247599 GGGGCGCGGGCGCGGGCGCCGGG - Intergenic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1160734977 19:658297-658319 AGGGCCCAGGGCCAGGCGCATGG + Intronic
1160771197 19:831945-831967 CGGGGGCAGGGGCGGGGCCGTGG - Exonic
1160775469 19:853220-853242 GGGGCTCAGGGGCGGCCCCGGGG - Intronic
1160807870 19:1000576-1000598 CGGGCGCGGGCGCGGGCGAGAGG - Exonic
1160896939 19:1407551-1407573 CGTGCGCAGGGGCGGCGGCGCGG + Intronic
1160966660 19:1749702-1749724 ACGGAGCCCGGGCGGGCGCGGGG + Intergenic
1160969718 19:1762220-1762242 CGGGCGCAGCTGGGGGCGCGCGG - Intronic
1160991770 19:1863137-1863159 AGGGCGCGGCGCCGGGGGCGCGG + Exonic
1161041586 19:2113347-2113369 CGGGGGCGGGGGCGGGGGCGGGG + Exonic
1161048457 19:2149786-2149808 AGGGAGCAGGGACGGGCGCTGGG + Intronic
1161203684 19:3029342-3029364 GGTGCGCGGGGGTGGGCGCGGGG - Intronic
1161283212 19:3456674-3456696 AGGGCAGAGGGGCCGGCCCGGGG + Intronic
1161315087 19:3614019-3614041 AGGGCGCAGGCCTGGGCGCAAGG + Intronic
1161560374 19:4969475-4969497 CGCGCCCAGGGGCGGGAGCGGGG + Intronic
1161800717 19:6415621-6415643 GGGCCGCAGGGGCCGGTGCGGGG + Exonic
1161956596 19:7499371-7499393 AGGGGGGAGGGGCGGGGGAGGGG + Intronic
1162345405 19:10115444-10115466 AGGGAGCAGGGGCTGGGGCAGGG + Intronic
1162392198 19:10396329-10396351 TGGGCGCAGGGGCGGAAGCTGGG - Intronic
1162398404 19:10430948-10430970 CGGGCGGCGGGGCGCGCGCGGGG - Intronic
1162406676 19:10479032-10479054 AGGGCTAAGGGGCGGGGGGGCGG + Intergenic
1162751705 19:12833718-12833740 GGGGGGAAGGGGCGGGCGGGGGG - Intronic
1162778713 19:12995812-12995834 TGGGCGCCCGGGCGGGAGCGCGG - Exonic
1162940355 19:14005806-14005828 AGCGCGAAGGGGCGGGCCTGGGG - Intronic
1162975875 19:14206740-14206762 GGGGCGCCGGGCCGGGCCCGTGG + Intergenic
1163025063 19:14506050-14506072 AGGGCGCAGGGAGGGGCTCCTGG - Intergenic
1163270878 19:16252658-16252680 AGGGCGCCAGGGCGGGAGCAGGG + Intergenic
1163377934 19:16945135-16945157 AGGGGGCAGAGGCAGGCGCCAGG - Intronic
1163597074 19:18226382-18226404 CGGGGACCGGGGCGGGCGCGGGG + Intronic
1163635570 19:18435728-18435750 GGGGCGCGGGCGCGGGCGCGGGG - Intronic
1163655762 19:18543762-18543784 CGGGGGCTGGGGCGGGGGCGGGG + Intronic
1163722742 19:18905977-18905999 CAGGTGCAGGGGCGGGTGCGTGG - Intronic
1163729476 19:18940976-18940998 AGGGCCAAGGGGAGGGCGTGGGG - Intronic
1163832604 19:19554282-19554304 CGTCCGCAGGGGCGGGCGCCTGG - Intergenic
1164051314 19:21587291-21587313 CTGGCGTAGGGGCGGGGGCGGGG - Intergenic
1164594770 19:29525865-29525887 AGCGCTCTGGGGCGGGGGCGGGG + Intergenic
1164866718 19:31610491-31610513 AGGGCGTGGTGGCGGGCGCCTGG + Intergenic
1164952161 19:32345792-32345814 CGGGCGGAGGGGCGGCCCCGGGG - Intronic
1165049397 19:33132093-33132115 CGGGCGCGGGCGCGGGCGCGCGG + Exonic
1165154506 19:33778971-33778993 AGGGCGCAGGTGCGCGCGGGAGG - Intergenic
1165349827 19:35269380-35269402 TGGGCGCGGGGGCGGGGGCGCGG + Intronic
1165349922 19:35269717-35269739 AGGGCGAACGGGCGGGCGGGCGG + Intronic
1165816803 19:38647620-38647642 AGTGCGCAGGCGCGGGCGGAGGG + Intergenic
1165939885 19:39409766-39409788 AGCGAGCGGGGGCGGGCGCGGGG + Intergenic
1166105709 19:40597155-40597177 CGGGGGCAGGGGCGGGGCCGGGG + Intronic
1166333592 19:42092196-42092218 AGGGGGTGGGGGCGGGGGCGGGG - Exonic
1166529376 19:43533525-43533547 AGGGCGCAGGGGTTCGGGCGCGG + Intronic
1166754035 19:45179593-45179615 AGCGCGCGGGGGCGGGCGCCGGG - Exonic
1166765771 19:45251552-45251574 GGGGGGCAGGGGCGGCCGGGTGG - Exonic
1166873148 19:45882830-45882852 AGGCCGCAGGGGTGGGGGCTGGG + Intergenic
1166948704 19:46412601-46412623 GGGGGGCTGGGGCGGGTGCGGGG + Exonic
1167003199 19:46757782-46757804 CGGGTGCTGGGCCGGGCGCGGGG + Exonic
1167050058 19:47072510-47072532 AGGGGGAGGGGGCGGGGGCGGGG + Exonic
1167104484 19:47422057-47422079 CGGGCGGAGGGGCGGGCGCAGGG - Intergenic
1167148249 19:47695046-47695068 TGGGTGCCGGGGCGGGGGCGTGG - Exonic
1167231994 19:48290686-48290708 AGGGGGCCGGGGCGGGAGGGGGG + Intergenic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167454527 19:49591456-49591478 AGGGGGCAGGGGCGGAGGGGCGG - Intergenic
1167466269 19:49652375-49652397 AGGGCGGCGGGGCGGGCGCCGGG - Exonic
1167501515 19:49851236-49851258 GGGGCGCGGGCGCGGGCGCGCGG - Exonic
1167622436 19:50567469-50567491 AGGGGGGAGAGGCGGGCACGGGG - Intronic
1167689211 19:50975135-50975157 AGGGAGGAGGGGCTGGCGGGGGG + Intergenic
1167862490 19:52297051-52297073 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862494 19:52297057-52297079 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862498 19:52297063-52297085 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862502 19:52297069-52297091 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862506 19:52297075-52297097 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862510 19:52297081-52297103 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862514 19:52297087-52297109 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862518 19:52297093-52297115 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862522 19:52297099-52297121 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862526 19:52297105-52297127 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862530 19:52297111-52297133 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167862534 19:52297117-52297139 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167946732 19:52994104-52994126 AGGGGGCGTGGGAGGGCGCGGGG + Intergenic
1168064042 19:53909383-53909405 CGGGCTCCGGGGCGGGGGCGGGG + Exonic
1168150949 19:54448445-54448467 AGGGCGCAGGGGAGGGGGCACGG - Intergenic
1168276959 19:55284075-55284097 AGGGCGCGTGGGGGGGCGGGGGG + Intronic
1168294157 19:55370494-55370516 AGGGGGCTGGGGCGGGCGGGCGG + Intergenic
1168295382 19:55375221-55375243 AGGGAGAAGGGGCGGGAGCCTGG - Intergenic
1168330135 19:55563349-55563371 AGGCCGCAGAGGAGAGCGCGTGG + Intergenic
1168536087 19:57172046-57172068 AGGGGGCGGGGGCGTGCGAGGGG + Intergenic
1168536095 19:57172064-57172086 AGGGGGCGGGGGCGCGCGAGGGG + Intergenic
925009114 2:468492-468514 AGGACGCAGCGGGGGGCGGGGGG + Intergenic
925068596 2:950058-950080 ACGGGGCTGGGGCGGGAGCGAGG - Intergenic
925824214 2:7831333-7831355 AGGGCGCAGGGGGAGGTGAGAGG + Intergenic
927679257 2:25129319-25129341 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
927679261 2:25129325-25129347 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
927679265 2:25129331-25129353 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
927809237 2:26172813-26172835 CGGGGGCAGGGGCGGGCGGACGG + Intergenic
927966884 2:27275868-27275890 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
927966888 2:27275874-27275896 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
928088102 2:28358311-28358333 AGGGCACTGGGGCGGGGTCGGGG - Intergenic
929061074 2:37925225-37925247 AGGGAGAGGGGGCGGGAGCGGGG + Intronic
929452741 2:42047943-42047965 AGGGGGCGGGGGAGGGGGCGGGG + Intergenic
929452749 2:42047955-42047977 AGGGGGCGGGGGCGGGGGCGGGG + Intergenic
929998816 2:46847308-46847330 AGGGCGCTGGGCTGGGCGCCAGG - Intronic
930046260 2:47175874-47175896 GGGGCGCGCGGGCGGGCGGGCGG - Intronic
930198260 2:48530028-48530050 GGGGAGGAGGGGCGGGGGCGGGG + Intronic
930700946 2:54457101-54457123 GGGGCGGAGGTGGGGGCGCGGGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932036451 2:68251903-68251925 AGAGGCCGGGGGCGGGCGCGGGG + Intronic
932341474 2:70965097-70965119 AGAGCGCAGTGTCAGGCGCGAGG - Exonic
932371064 2:71188381-71188403 AGGGGGATGGGGCGGGCGAGGGG - Exonic
932476472 2:72009362-72009384 TGGGGGCAGGGGCAGGGGCGGGG + Intergenic
932476476 2:72009368-72009390 CAGGGGCAGGGGCGGGGGCGGGG + Intergenic
932702776 2:74002612-74002634 CGGGGGCAGGGCCGGCCGCGGGG + Intronic
934321357 2:91974668-91974690 AGGGCGCGAGGCAGGGCGCGCGG + Intergenic
934539083 2:95159671-95159693 CGGACGCGGGGGCTGGCGCGGGG - Intronic
934539092 2:95159694-95159716 CGGACGCGGGGGCTGGCGCGGGG - Intronic
934539101 2:95159717-95159739 CGGACGCGGGGGCTGGCGCGGGG - Intronic
934655868 2:96116614-96116636 CGGGCGCGGGAGCGGGCGGGAGG + Intergenic
935112289 2:100104734-100104756 CGGGCGCAGGGCCGGGGGCGGGG - Intronic
935112296 2:100104746-100104768 GGGGAGGAGGGGCGGGCGCAGGG - Intronic
935237589 2:101151450-101151472 CGGGGCCAGGGGCGGGTGCGGGG - Intronic
935237601 2:101151473-101151495 AGGGGCCAGGGGCGGGTGCGGGG - Intronic
936122663 2:109760357-109760379 GCGGCGCAGGGCCGGGGGCGGGG + Intergenic
936152722 2:110030524-110030546 ATGGCTCAGGGGAGGGCGGGGGG - Intergenic
936174203 2:110204858-110204880 AGGGCCCTGGGGCGGGCGACAGG - Intronic
936191958 2:110340888-110340910 ATGGCTCAGGGGAGGGCGGGGGG + Intergenic
936222030 2:110611116-110611138 GCGGCGCAGGGCCGGGGGCGGGG - Intergenic
936243277 2:110806293-110806315 GGGGTGCACGGGCGGGCACGAGG - Intronic
936566134 2:113584010-113584032 AGGGCGCAGCGGAGGGTGAGCGG + Intergenic
937301892 2:120847749-120847771 GGGGGGCAGGGGCGGGGGGGCGG + Intronic
937343059 2:121104251-121104273 AGGGTGCAGGAGTGGGCGAGAGG + Intergenic
937951075 2:127388186-127388208 CCGGGGCAGGGGCGGGGGCGGGG - Intronic
938381037 2:130836844-130836866 AGGGCGCGGGGGCGGACCCTAGG + Intergenic
941020935 2:160407557-160407579 CGGGCGCGGGCGCGGGCGCGGGG + Intronic
941808615 2:169734131-169734153 AGCGAGCGGGGCCGGGCGCGGGG + Intronic
941808725 2:169734449-169734471 CGGGCGCGGGGGAGGGGGCGAGG + Intronic
941911754 2:170770977-170770999 AGGTGGCGGGGGCGGGGGCGGGG - Intergenic
942459788 2:176160798-176160820 AGAGCGGACGGGCGGGCGGGTGG + Intronic
944401159 2:199328094-199328116 TGGGCACAGGGGCGGGCTCTAGG - Intronic
945699454 2:213151976-213151998 CGGGCGCGCGGGTGGGCGCGAGG - Intronic
946313983 2:218897620-218897642 GCGGCGCAGGGGCGGGCGAGGGG - Intronic
946327669 2:218993143-218993165 CGGGCGCCGGGCCCGGCGCGGGG + Exonic
946664136 2:222031686-222031708 TGGGCGCGGTGGCGGGCGCCTGG - Intergenic
947632292 2:231662114-231662136 AGGGCGCAGGCGCCGGTGCGCGG - Intergenic
947710169 2:232309007-232309029 AGGGAACAGGGGCAGGCCCGGGG + Intronic
947743868 2:232497654-232497676 AGGGCGCAGGGGGAGGCTGGGGG + Intergenic
948046857 2:234951940-234951962 CGGGGGCGGGGGCGGGGGCGCGG - Intergenic
948046859 2:234951946-234951968 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
948046863 2:234951952-234951974 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
948202860 2:236142372-236142394 ACGGGGCAGGGGCCGGGGCGGGG - Intergenic
948467387 2:238158889-238158911 AGGGGGCGCGGGCGGGCGCGCGG + Intergenic
948518949 2:238523665-238523687 CGGGACCAGGGACGGGCGCGGGG - Intergenic
948923208 2:241076747-241076769 AGAGTCCAGGGCCGGGCGCGGGG + Intronic
948945677 2:241217926-241217948 GGCGCGCAGGGGCGGGGGCGGGG + Intronic
948945694 2:241217960-241217982 GGCGCGCAGGGGCGGGCCGGGGG + Intronic
949040088 2:241844054-241844076 GGGGCGCGGGGGCGCGGGCGTGG + Intergenic
1168802757 20:653534-653556 AGGCCGCGGGGGCGGGGGCGGGG + Intronic
1168804429 20:664166-664188 GGGGCGCCGGGGGGCGCGCGGGG - Exonic
1169164124 20:3407697-3407719 CGGGGGCGGGGGCGGGGGCGTGG + Intergenic
1169294299 20:4379681-4379703 TGGGGGCAGGGGCGGGGTCGTGG - Intergenic
1170612134 20:17923366-17923388 GGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1170972063 20:21125837-21125859 ACGTCGGAGGGGCGGGCGCTCGG - Intergenic
1170972179 20:21126208-21126230 AGGGCACTGGGGCGGGGGTGGGG + Intronic
1170999380 20:21397234-21397256 AGGGCCCAGGTGGCGGCGCGCGG + Exonic
1171012973 20:21518492-21518514 AGGCGGCTGGAGCGGGCGCGGGG + Intergenic
1171361680 20:24590476-24590498 AGGGCGGAGGGGGAGGCGCAGGG + Intronic
1171421963 20:25023588-25023610 AGGACTCCGGGGTGGGCGCGTGG - Exonic
1172037002 20:32018173-32018195 AGGGGGCGGGGGCGGGGGAGGGG + Intronic
1172083199 20:32358615-32358637 GGGGAGAAGGGGCGGGCACGCGG - Exonic
1172109406 20:32536481-32536503 GGGGGGCAGGGGCGGGGGCGAGG + Intronic
1172245635 20:33443555-33443577 TGCGCGCCGGGGCGGGCTCGGGG - Exonic
1172409085 20:34709258-34709280 CGGGGGCAGGGGCGGCCCCGGGG - Exonic
1172526344 20:35602270-35602292 AGGGCGAAGGGGCGAGCCAGGGG + Intergenic
1172618739 20:36306504-36306526 CCGGCGCAGGTGAGGGCGCGGGG + Exonic
1172702890 20:36863582-36863604 AGGCCGAGGGGGCGGGCGCCGGG - Exonic
1172819466 20:37718566-37718588 AGGGCGGATGGCCGGGCGGGGGG + Intronic
1172883727 20:38217831-38217853 GGGGAGCGGGGGCGGGGGCGGGG - Intronic
1173185552 20:40837216-40837238 AGGGAGCAGGGGTGGGGGCCAGG - Intergenic
1173607969 20:44345403-44345425 AGGGCCCTGGGGCCGGCGGGTGG + Intronic
1174804657 20:53594387-53594409 TGGGCGCTGGGGCGGGGCCGGGG - Intronic
1174843218 20:53919209-53919231 AGGGCGAAGGGGAGGGGTCGCGG - Intergenic
1175142797 20:56873295-56873317 TGGGCGCAGGGTTGGGCGAGTGG + Intergenic
1175927051 20:62476072-62476094 GGGAAGAAGGGGCGGGCGCGGGG - Intergenic
1175975210 20:62707565-62707587 AGGGAGCAGGGGAGGGGGCGGGG + Intergenic
1175975633 20:62709093-62709115 GGAGCCCAGGGGAGGGCGCGTGG - Exonic
1175992536 20:62796814-62796836 AGGGCGCGTGGGAGGGGGCGGGG - Intronic
1176007637 20:62875202-62875224 AGGGTGCAGGTGAGGGTGCGGGG - Intergenic
1176016790 20:62938099-62938121 CGGGGGCGGGGGCGGGGGCGGGG - Exonic
1176022847 20:62970928-62970950 GGGGCGCAGGGGCCGGGACGTGG + Intergenic
1176131642 20:63498942-63498964 CGCGCGCGGGGGCGGGTGCGGGG + Intronic
1176148046 20:63574144-63574166 AGGGCGGAGGGGCGGGGGCGCGG - Intronic
1176159679 20:63641891-63641913 AGCGGGCAGGGGCCGGGGCGGGG - Intronic
1176159697 20:63641930-63641952 AGCGGGCAGGGGCCGGGGCGGGG - Intronic
1176159733 20:63642016-63642038 AGCGGGCAGGGGCCGGGGCGGGG - Intronic
1176159750 20:63642055-63642077 AGCGGGCAGGGGCCGGGGCGGGG - Intronic
1176161845 20:63652496-63652518 CGGGCGCAGGCCCGGGCGGGGGG - Intronic
1176162161 20:63653452-63653474 AGGGAGCGAGGGCGGGCGGGAGG + Intergenic
1176179447 20:63742539-63742561 AGGGGGCGGGGGCAGGGGCGGGG - Exonic
1176221214 20:63970027-63970049 AGGGGGCGGGGGCGGGGGCGGGG + Intronic
1176283369 20:64327974-64327996 AGGGCGCAGGCGGCGGCGGGCGG - Intergenic
1176952639 21:15064861-15064883 ACGGCGCAGCGGCGGACGCGAGG + Exonic
1178534909 21:33403352-33403374 ACGGGGCGGGGGCGGGGGCGCGG + Exonic
1179437166 21:41369832-41369854 CGGGAGCGGGGGCGGGGGCGGGG - Intronic
1179554531 21:42163714-42163736 AGGGCTCAGTGGGGGGTGCGGGG + Intergenic
1179663420 21:42893054-42893076 TGGGCGCTGTGGCGGGGGCGCGG - Intronic
1179794780 21:43776452-43776474 GGGGCGCGGGGCGGGGCGCGGGG + Intergenic
1179810130 21:43865050-43865072 AGGACGCGGGGGGGGACGCGGGG - Intergenic
1179891654 21:44338730-44338752 AGGGGGGAGGGGCAGGGGCGAGG - Intronic
1179893362 21:44348961-44348983 AGGGCGCAGCTGCGGGTGTGTGG + Intergenic
1180002555 21:45001942-45001964 AGGGGGCAGGGGCAGGGGCAGGG - Intergenic
1180093062 21:45542447-45542469 AAGGCGGCGCGGCGGGCGCGCGG + Exonic
1180174315 21:46080323-46080345 AGGGAGGAGGGGGGGACGCGAGG - Intergenic
1180837221 22:18935986-18936008 GGGGTGCAGGCGGGGGCGCGGGG - Intronic
1180843537 22:18970116-18970138 AGGGGGCGGGGGGGGGCGGGGGG + Intergenic
1180891476 22:19291853-19291875 CGGGGGCAGGGGCGGGGGCAGGG - Intergenic
1180891483 22:19291865-19291887 CGGGGGCAGGGGCGGGGGCAGGG - Intergenic
1180957968 22:19749698-19749720 AGGGCACAGGGCCGGGAGGGAGG + Intergenic
1180960553 22:19760613-19760635 AGGGGGAAGGGGCGGGGGAGGGG + Intronic
1181007989 22:20023322-20023344 AGGCCGCAGGGGCCGCTGCGAGG + Intronic
1181458124 22:23070862-23070884 AGGGCGCCGGGGATGCCGCGCGG + Intronic
1182211370 22:28679915-28679937 AGGGCGCGAGGCGGGGCGCGCGG - Intergenic
1182532252 22:30969389-30969411 AGGGCGAAGGAACGGGCGTGCGG + Intergenic
1182552459 22:31107584-31107606 TGGGGGCGGGGGCGGGGGCGGGG - Intronic
1182903911 22:33920610-33920632 GGGGCGCGGGGCCGGGGGCGCGG + Intronic
1183071521 22:35399870-35399892 ATGGCGGAGGGGCGGGCGCGCGG - Intergenic
1183294135 22:37019790-37019812 AGGGGACAGCTGCGGGCGCGGGG + Intronic
1183358928 22:37373458-37373480 CGGGGGCAGCGGCGGGGGCGGGG - Exonic
1183492006 22:38121808-38121830 AGGGTCCAAGGGCGGGCACGAGG - Intronic
1183630940 22:39032134-39032156 AGGGCCCAGGGCCGGGAGAGAGG + Intronic
1183649477 22:39145718-39145740 AGGGGGCGGGGGCGGGGGCGGGG + Intronic
1183683685 22:39349922-39349944 CGCGCGCAGGGGAGGGGGCGGGG + Intronic
1183746995 22:39697782-39697804 AGGGTGCAGGGGTGGGTGCCTGG + Intergenic
1184146571 22:42614894-42614916 CGGCCGAAGGGGCGGGCTCGCGG - Exonic
1184164858 22:42720990-42721012 AGGGCGCGCGGGCGGGGTCGCGG - Intronic
1184333887 22:43841974-43841996 CGAGCACAGGGCCGGGCGCGTGG - Intronic
1184481795 22:44752519-44752541 TGGGCGGAGGGGCGGGGGGGCGG + Intronic
1184557465 22:45240979-45241001 AGGGGACAGGGGCGGGGCCGGGG - Intergenic
1184562114 22:45269269-45269291 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1184562118 22:45269275-45269297 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1184562122 22:45269281-45269303 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1184568879 22:45309900-45309922 ACGCGGCTGGGGCGGGCGCGCGG + Intronic
1184590047 22:45476105-45476127 AGGAGGGAGGGGCGGGCGTGGGG + Intergenic
1185272390 22:49935332-49935354 GGGGCGCGGGGTGGGGCGCGGGG + Intergenic
1185315655 22:50178188-50178210 CGGGGGCAGGGGCGGGGCCGGGG - Exonic
1185413390 22:50697422-50697444 AGGGCGGGAGGGAGGGCGCGAGG + Intergenic
1185420237 22:50730879-50730901 AGGGGCTGGGGGCGGGCGCGGGG + Intergenic
1203287314 22_KI270734v1_random:161285-161307 GGGGTGCAGGCGGGGGCGCGGGG - Intergenic
949129568 3:483615-483637 TGGGGGCGGGGGGGGGCGCGGGG + Intergenic
950345288 3:12287794-12287816 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
950345292 3:12287800-12287822 TGGGGGCGGGGGCGGGGGCGGGG - Intronic
950438494 3:12994162-12994184 GGGGGGCGGGGGCGGGCGCTCGG + Intronic
950459337 3:13111999-13112021 AGGGTGCAGGGGCTGGGGCAAGG - Intergenic
950530383 3:13549430-13549452 CGGGCACAGAGGCCGGCGCGGGG + Intronic
950610675 3:14124813-14124835 AGGGCGCCGAGGCAGGCGCGCGG - Exonic
950829521 3:15859947-15859969 AAGCCGCAAGGGTGGGCGCGGGG + Intergenic
952316030 3:32233034-32233056 AGGGAGTTGGGGCGGGCGCAGGG - Intergenic
952744465 3:36764262-36764284 ATGGCGCGGCGGCGGGCTCGGGG + Intergenic
953925367 3:46979927-46979949 CGGGTGCGGGTGCGGGCGCGGGG - Intronic
954210329 3:49093672-49093694 GGCGCGCCGGTGCGGGCGCGCGG - Intronic
954333659 3:49903898-49903920 AGGGCGCCGGGCTGGGCGGGCGG + Intronic
954779115 3:53046183-53046205 ATGGCGCTGGGGCGGGAGCGGGG - Intronic
955356597 3:58237477-58237499 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
956813627 3:72888371-72888393 AGCGCGCGGGGACAGGCGCGGGG - Exonic
958638593 3:96777074-96777096 AGGGCGGCGGGGCGGGCGCAGGG + Intergenic
960914363 3:122681187-122681209 AGGTGGCCGGGGCGGGGGCGGGG + Intronic
960993941 3:123328956-123328978 AGGGCACTGGGGCGGGCGGCAGG + Intronic
961322283 3:126084133-126084155 AGGACGCAGGGGCGGGCCTGCGG + Exonic
961427304 3:126858289-126858311 TGGTGGCAGGGGCGGGGGCGGGG + Intronic
962164840 3:133038317-133038339 TGGTCGGAGGGGCGCGCGCGGGG + Intergenic
962222356 3:133574187-133574209 CGGGCGGCGGGGCGGGCGCGGGG + Exonic
962918901 3:139934509-139934531 AGGCTGCAGTGGCGGGGGCGGGG - Intergenic
963061816 3:141232111-141232133 TAGGCTCAGGGGCGAGCGCGGGG - Intronic
964451403 3:156816648-156816670 CGAGGGCGGGGGCGGGCGCGGGG - Intergenic
966724731 3:183099307-183099329 AGTGGGCAGAGGCGGGAGCGAGG - Intronic
966861047 3:184230925-184230947 GGAGCGCGGGTGCGGGCGCGCGG - Intronic
966886468 3:184380219-184380241 AGGGCGGAGGGCCGGGCCGGGGG - Exonic
966886485 3:184380260-184380282 AGGGCGCGGGAGCGGGCGGAGGG - Exonic
968035186 3:195542821-195542843 AGACCCCAGGGGCGGGCGGGCGG - Intronic
968066632 3:195762720-195762742 GTGGTGCAGGGCCGGGCGCGTGG - Intronic
968066645 3:195762764-195762786 GCGGTGCAGGGCCGGGCGCGTGG - Intronic
968134259 3:196209901-196209923 ACGGGGTAGGGCCGGGCGCGGGG + Intronic
968382314 4:107534-107556 AGCGCGGAGGGGCGGGCGGAGGG - Intergenic
968479300 4:826435-826457 GGGGGGCGGGGGCGGGGGCGGGG + Intergenic
968511425 4:997484-997506 CGGGCCCAGGGGCGGGGACGTGG + Intronic
968514714 4:1011350-1011372 AGGGCGCGCGGGCGGGGCCGGGG + Intronic
968515006 4:1012103-1012125 GGGGCGCGGGGGCGGGGGCGGGG - Intronic
968556320 4:1248145-1248167 AGGGAGCACGGGCGGGCGCCGGG - Intronic
968618433 4:1592787-1592809 AGGGAGGAGAGGCGGCCGCGGGG + Intergenic
968653069 4:1767557-1767579 AGGCCGCCGGGTCGGGGGCGGGG + Intergenic
968660035 4:1795055-1795077 GGGGCGCGGGGGCGCGGGCGGGG - Intronic
968660961 4:1798532-1798554 AGGGGGCCGGGGCGGGGGTGGGG - Intronic
968701051 4:2058640-2058662 GGGGCGCATGCGCGGCCGCGGGG + Intergenic
968929910 4:3573357-3573379 AGGGCCCAGGGGCTGCCGCCTGG + Intergenic
969110075 4:4839076-4839098 CGGGAGCTGGGGCGGGCACGTGG - Intergenic
969260164 4:6028352-6028374 TGTGCGCAGGGGCGGGGGCAGGG - Intronic
969694002 4:8724758-8724780 AGGGAGGAGGGGCGGGCCAGCGG - Intergenic
972740401 4:41881889-41881911 AGGGGGCGGGGGCGGGCGCTGGG - Intergenic
972770982 4:42196864-42196886 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
972770990 4:42196876-42196898 CGGGGGCAGGGGCGGGGGCGGGG - Intergenic
973758922 4:54100011-54100033 CGCGAGGAGGGGCGGGCGCGCGG - Exonic
973993630 4:56435692-56435714 AGGGCGGAGGGGCGGTCCCGCGG + Intergenic
974069374 4:57110217-57110239 CGGGGGCAGGGGCGGGCAGGAGG + Exonic
974701569 4:65455089-65455111 TGGGAGCAGTGGCGGGCGCCTGG + Intronic
975552854 4:75630842-75630864 CTGGGGCAGGGGCGGGCGCCGGG + Intergenic
976398470 4:84582791-84582813 AGCACGCAGAGGCGGGGGCGGGG + Intergenic
977065315 4:92305688-92305710 GGCGAGCAGGGGCGGGCGGGGGG + Intronic
977932186 4:102761039-102761061 CGGGCGCAGCCGCGGGCGGGAGG + Intergenic
978766717 4:112412157-112412179 AGGGCACAGGGGCGGGGGAGGGG - Intronic
979785673 4:124712784-124712806 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
980969524 4:139555986-139556008 AGGGGACAGTGGCGGCCGCGGGG + Intronic
981128441 4:141132824-141132846 AGGGCGCGGGGGCGGGGAGGGGG - Exonic
981315547 4:143336710-143336732 AGGGCGGGTGGGCGGGCGAGCGG + Intergenic
981615341 4:146638831-146638853 GGGGCGCGGGGGTAGGCGCGGGG + Intergenic
981782135 4:148442416-148442438 AGGGGGCAGGGGCAGGGGCAGGG + Exonic
982042401 4:151409121-151409143 GGGGGGCGGGGGCGGGGGCGGGG - Intergenic
983249282 4:165326890-165326912 CGGGGGCGGGGGCGGGGGCGGGG - Intergenic
983249288 4:165326896-165326918 AGTGCCCGGGGGCGGGGGCGGGG - Intergenic
984206327 4:176792348-176792370 CGGGGGCAGGGGTGGGGGCGCGG + Exonic
984462867 4:180058687-180058709 GGGGCGCGGGGCCGGGCGGGCGG - Intergenic
984804598 4:183739719-183739741 AGGTGGCGGGGGCGGGCGGGGGG - Intergenic
985068432 4:186144944-186144966 CGGGCGCGGGCGCGGGCGGGTGG + Exonic
985472375 5:53922-53944 GGGGCAGAGGGGCGGGCCCGGGG + Intergenic
985484457 5:140726-140748 GGTGCGCAGGGGAGGGCGTGGGG - Intronic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985588115 5:751308-751330 GGGGCGCAGGGGCAGGTGTGGGG + Intronic
985588137 5:751357-751379 GGTGGGCAGGGGCGGGCGTGGGG + Intronic
985602785 5:843775-843797 GGGGCGCAGGGGCAGGTGTGGGG + Intronic
985602808 5:843824-843846 GGTGGGCAGGGGCGGGCGTGGGG + Intronic
985628906 5:1004903-1004925 AGCGGGCGGCGGCGGGCGCGGGG - Intergenic
985629973 5:1009100-1009122 AGGGCGGGAGGGCGGGCGGGCGG + Intronic
985629977 5:1009108-1009130 AGGGCGGGCGGGCGGGCGTGGGG + Intronic
985630046 5:1009352-1009374 ACCGCGCAGGGGCAGGCGTGGGG - Intronic
985703234 5:1386122-1386144 GGGGCTCTGGGGCCGGCGCGGGG + Intergenic
985713865 5:1445266-1445288 GGGGCGCAGGGGCGGGGGCCGGG - Intronic
985784470 5:1886716-1886738 AGGGTGCGCGGGCCGGCGCGGGG - Intronic
986330850 5:6714714-6714736 AGGCCGCGGGGGCGGGGGCGGGG + Intronic
986748097 5:10761386-10761408 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
986748101 5:10761392-10761414 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
988369279 5:30346010-30346032 GGGGGGCCGGGGGGGGCGCGGGG - Intergenic
988609316 5:32710584-32710606 AGGGGGAGGGGGCTGGCGCGGGG + Intronic
990175990 5:53109542-53109564 AGGGCCCGGGGGCGGGGGCGGGG + Exonic
990741105 5:58913784-58913806 CGGGGGCAGGGACGGGTGCGGGG - Intergenic
991391152 5:66144608-66144630 AGAGCGCGGACGCGGGCGCGCGG + Intronic
997233030 5:132257588-132257610 AGGGAGCGGGGGCGGGGGCTGGG + Intronic
998149115 5:139746994-139747016 AGGGCGAAGGACCGGGCGAGGGG - Intergenic
998849606 5:146340452-146340474 AGGGCGCAGCGTCGGGAGCCGGG + Exonic
999129473 5:149271914-149271936 AGGGCGCAGGGGCTCCGGCGCGG - Exonic
999298800 5:150477489-150477511 AGGGCGCAGTGGGGGGCGGAGGG + Intergenic
999328267 5:150656747-150656769 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
999328271 5:150656753-150656775 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
999696278 5:154190790-154190812 CGGGCGGACGGGCGGACGCGCGG + Exonic
1000014549 5:157266029-157266051 GCGGCGAAGGGGCGGGCGCTGGG + Intergenic
1000995319 5:167952721-167952743 TGGGCGCTGGGGCCGGGGCGTGG - Exonic
1001342850 5:170862667-170862689 CGGGCGCGGGCGCGGACGCGAGG + Intronic
1002190091 5:177473406-177473428 AGGGGCCGGGGGCGGGGGCGGGG + Intronic
1002191854 5:177482517-177482539 AGGGCCTAGGGGCGGGGGCCAGG - Intergenic
1002291828 5:178205301-178205323 CCGGCGCAGGGGCGGGCGGATGG + Intronic
1002508732 5:179698910-179698932 AGGGGCCAGGGGCGGGCACAGGG + Exonic
1002532841 5:179858935-179858957 AGTGCGCAGGGGCGGGGCCGCGG - Intronic
1002888145 6:1313358-1313380 CGGGCGCGGGGACCGGCGCGCGG - Exonic
1002926769 6:1609688-1609710 CGGGCGCCGGCGCGGGCGCAGGG + Intergenic
1003058216 6:2841768-2841790 GTGGCGCGGGGGCGGGCGCGGGG - Intronic
1003112127 6:3259221-3259243 CGGGCGGCGGGGCGGGGGCGCGG + Intronic
1003645443 6:7910317-7910339 GGGGCGCGGGGCCGGGAGCGCGG - Intronic
1004396228 6:15248436-15248458 TGGGAGCGGGGGCGGGGGCGTGG + Intronic
1004562125 6:16760987-16761009 TGGGCGCAGGGGCGGCCGGCGGG - Intronic
1004627916 6:17393911-17393933 CGGGCGCGGGGGCCGGGGCGCGG + Intronic
1004864122 6:19837250-19837272 TGGGCGCGCGGGCGGGGGCGCGG - Intergenic
1005881123 6:30061701-30061723 AGGGCGCAGGGTCGGAAGCTTGG + Intronic
1006187719 6:32190201-32190223 AGGGAGAAGGGGGGGGAGCGAGG + Intergenic
1006302392 6:33200444-33200466 AGGGAGGAAGGGCGGGCGAGCGG + Exonic
1006304126 6:33208658-33208680 CCGGCGCGGGGGCGGGAGCGGGG + Intronic
1006512136 6:34527187-34527209 GGGGGGCGGGGGCGGGGGCGGGG + Intronic
1006950779 6:37819814-37819836 AGGGGGAAGGAGCGGGCGCGCGG - Exonic
1007032381 6:38639963-38639985 AGCGCGCAGTGGCGCGTGCGCGG - Intronic
1007478305 6:42133811-42133833 AGGAGACAGGGGCGGGGGCGGGG + Intronic
1008013253 6:46491021-46491043 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1010244788 6:73653500-73653522 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1010244792 6:73653506-73653528 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1010815795 6:80356936-80356958 GGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1011186105 6:84677082-84677104 AGGGAGCAGGGGCAGGTGAGTGG + Intergenic
1012939703 6:105403331-105403353 AGGGCGCTAGGGAAGGCGCGGGG - Intergenic
1013272878 6:108559697-108559719 TGGGCGGCGGGCCGGGCGCGCGG - Intergenic
1014079552 6:117270910-117270932 CGGGCGCCGGGGCGGTTGCGAGG - Exonic
1014736321 6:125099512-125099534 AGAGGGCGGGGGCGGGGGCGGGG + Intergenic
1014736323 6:125099518-125099540 CGGGGGCGGGGGCGGGGGCGAGG + Intergenic
1016340820 6:143060479-143060501 TGGGCGCCGGGCCGGGCGAGGGG - Intronic
1016340897 6:143060782-143060804 CGGGGGCGGGGGCGGGGGCGGGG - Intronic
1016340918 6:143060815-143060837 CGGGCGCGGGCGCGGGCGCGGGG - Intronic
1016676200 6:146771545-146771567 AGGGGCCAGGGGCGGGGGCACGG - Intronic
1017771681 6:157649497-157649519 AGGGCACAGGGGCTGGGTCGAGG - Intronic
1017877644 6:158537216-158537238 GGGGCGGCGAGGCGGGCGCGGGG - Intronic
1017877726 6:158537516-158537538 AGGGGGCGGGGGCCGGCGCCAGG - Intronic
1018959983 6:168441271-168441293 AGCGCGGCTGGGCGGGCGCGTGG - Exonic
1019054375 6:169213082-169213104 AGGGCCCAGGAGAGGGCGCAGGG + Intergenic
1019343704 7:519898-519920 GGGGGGCGGGGGCGGGGGCGGGG - Intronic
1019343822 7:520269-520291 GGAGCGCCGGGGCGGGGGCGGGG - Intronic
1019404544 7:876827-876849 AGGCGGCGGGGGCGGGCGCTGGG - Intronic
1019471694 7:1224598-1224620 AGGCCGCAAGTGCGGGGGCGGGG + Intergenic
1019472669 7:1229744-1229766 AGGGCCCAGGCGCGCGCGCCCGG - Intergenic
1019472804 7:1230207-1230229 AGGGGGCGGGGGCGGGGGAGGGG + Intergenic
1019472819 7:1230236-1230258 AGGGCGCGGGGGAGGGCGTGGGG + Intergenic
1019472831 7:1230261-1230283 GGGGCGCGGGGAAGGGCGCGGGG + Intergenic
1019472839 7:1230273-1230295 AGGGCGCGGGGGAGGGGGAGGGG + Intergenic
1019474638 7:1238196-1238218 TGCGGGCAGGGGCGGGGGCGCGG - Intergenic
1019550155 7:1598184-1598206 AGGGAGCAGGGGCTGGCTCAGGG - Intergenic
1019559180 7:1647531-1647553 GGGGCGGAGGGGCTGGTGCGGGG + Intergenic
1019662526 7:2232712-2232734 TGGGAGACGGGGCGGGCGCGGGG + Intronic
1020274370 7:6615696-6615718 CGGGGGCCGGGGCGGGGGCGGGG - Exonic
1021958859 7:25852743-25852765 TGGGCGCTGGGGTGGGGGCGGGG + Intergenic
1021969377 7:25951409-25951431 TGGGGGCGGGGGCGGGGGCGCGG + Intergenic
1022091012 7:27108236-27108258 CGGCGGCAGGGGCGGGCGCAGGG - Exonic
1022747548 7:33188134-33188156 TGGGGGGAGGGGCGGGGGCGAGG + Intronic
1023170512 7:37386362-37386384 AGGGGGCAGGGGCTGGAGGGGGG + Intronic
1023842377 7:44104626-44104648 GGGGCTCCGGGGAGGGCGCGGGG - Exonic
1024043816 7:45574452-45574474 GCGGCGCCGGGGCGGGCGGGCGG - Intronic
1024580050 7:50793630-50793652 TGGGCGCAGGGCGTGGCGCGGGG + Intergenic
1025198612 7:56949164-56949186 GGCGCGCAGGGTCAGGCGCGGGG - Intergenic
1025673340 7:63627772-63627794 GGCGCGCAGGGTCAGGCGCGGGG + Intergenic
1026000351 7:66556273-66556295 TGGGCGCGGGCGCGGGCGCGAGG - Intergenic
1026360433 7:69598052-69598074 GGGGGGCGGGGGCGGGGGCGTGG - Intergenic
1026662816 7:72317154-72317176 AGGGAGCAGGGGAGGGAGGGAGG + Intronic
1026890129 7:73977016-73977038 AGGGCCGAGGGGAGGGAGCGCGG + Intergenic
1027260486 7:76461614-76461636 AGGGCCCAGGGGCGGGCAGAAGG - Intergenic
1027311863 7:76959727-76959749 AGGGCCCAGGGGCGGGCAGAAGG - Intergenic
1028160101 7:87475714-87475736 CGGGGGCGGGGGCGGGGGCGAGG - Exonic
1028160103 7:87475720-87475742 GGGGGGCGGGGGCGGGGGCGGGG - Exonic
1029536991 7:101162939-101162961 GGGGCGCCGGCGCGCGCGCGCGG + Exonic
1029644373 7:101844180-101844202 TGGGGGCGGGGGCGGGGGCGGGG - Intronic
1029735718 7:102464855-102464877 AGTGCGCAGGCGCGGCCGTGGGG + Exonic
1029746427 7:102517805-102517827 AGGAGGCGGGGGCGGGGGCGGGG + Intergenic
1029764364 7:102616784-102616806 AGGAGGCGGGGGCGGGGGCGGGG + Intronic
1029849332 7:103446072-103446094 AGTGCGCGCGGGCGGCCGCGGGG - Intronic
1030304155 7:108002608-108002630 AGGCCGCAGGGGCCGGGGCTTGG + Intronic
1031043549 7:116862918-116862940 CGGGCGGGGGCGCGGGCGCGGGG + Intronic
1031361825 7:120857364-120857386 GGGGCGGCGGGGCGGGGGCGGGG + Intronic
1031361831 7:120857376-120857398 CGGGGGCGGGGGCGGGGGCGAGG + Intronic
1031602055 7:123722008-123722030 TGGGGGCAGGGGCAGGCGGGAGG + Intronic
1032159860 7:129502258-129502280 GGGGCGAGGGGGCGGGCGCGGGG - Intergenic
1032159869 7:129502277-129502299 GGGGCGAGGGGGCGGGCGCGGGG - Intergenic
1033220505 7:139523987-139524009 GGGCGGCGGGGGCGGGCGCGGGG - Exonic
1033227391 7:139572772-139572794 ACGGGGCAGGGGCGGGGGGGGGG - Exonic
1034344253 7:150376550-150376572 AGGGAGCAGGGGCGGGTCCTTGG + Intronic
1034418787 7:150978378-150978400 AGGGCGGTGCTGCGGGCGCGCGG - Intergenic
1034422034 7:150995560-150995582 AGGGTGCAGGGGTGGGAGGGGGG - Intronic
1034536305 7:151727959-151727981 AGGGCCCTGGGGCGGACGCCCGG + Intronic
1034569068 7:151940740-151940762 AGGGCGGAGTGGGGGGCGCTGGG + Intergenic
1034994784 7:155570884-155570906 TGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1035168596 7:157005763-157005785 AGGGCGGCGGCGGGGGCGCGGGG - Exonic
1035283336 7:157791520-157791542 AGGGAGCGGGGGCGGGTGCAGGG - Intronic
1035383030 7:158452509-158452531 AGGTTGCAGGGGCAGGTGCGTGG - Intronic
1035389847 7:158496989-158497011 AGGGCGCAGGGAAGGGGGAGGGG - Intronic
1035389857 7:158497009-158497031 AGGGCGCAGGGAAGGGGGAGAGG - Intronic
1035581024 8:738941-738963 AGCGCGCAGGGCCGGGACCGGGG - Intergenic
1036390292 8:8318858-8318880 CGGGAGCCGGGGCGGGGGCGGGG + Exonic
1036390299 8:8318870-8318892 CGGGGGCGGGGGCGGGCCCGGGG + Exonic
1036768663 8:11564449-11564471 AGGGCGCAGAGGCGGGGACGCGG - Exonic
1037262801 8:17027220-17027242 AGAACGGAGGGGCGGGGGCGGGG - Exonic
1037562707 8:20089010-20089032 TGGGGGCAGGGGTGGGGGCGGGG + Intergenic
1038204960 8:25457904-25457926 GGGGCGCGGGGACGGGGGCGCGG - Intronic
1038575563 8:28701333-28701355 GGGGCGCGGGGCCGGGCGCCGGG - Exonic
1038596582 8:28891150-28891172 TGGGCTGAGGGGCGGGCGTGAGG + Intronic
1039050125 8:33485034-33485056 AAGACGCGGGGGCGCGCGCGCGG + Exonic
1039554333 8:38466221-38466243 GGTGCGCAGGGCCGGGGGCGTGG - Intronic
1039911251 8:41828723-41828745 AGGACTCTGGAGCGGGCGCGAGG - Intronic
1041107503 8:54457788-54457810 AGGGGCAAGGGGCGGGCGTGGGG + Intergenic
1041167227 8:55102207-55102229 GGCGGGCAGGGGCGCGCGCGGGG + Intergenic
1041682591 8:60608456-60608478 AGGGAGCAGGACCGGGGGCGGGG - Intronic
1042962895 8:74321604-74321626 GGGGACGAGGGGCGGGCGCGGGG - Intronic
1044430781 8:92103579-92103601 AGGGCGCGCGGGCTGGCGGGCGG + Intergenic
1045336154 8:101205756-101205778 AGGGCGCAGGCGTGCGAGCGGGG - Intronic
1045432129 8:102124099-102124121 CGGGCGCAGGGGTGGGTTCGAGG - Intronic
1047998705 8:130359023-130359045 TGGGCGCAGGGGCGGCCTCCCGG + Intronic
1048440657 8:134457101-134457123 AGGGCGCAGGTGCCGGAGCTGGG - Intergenic
1048553904 8:135457367-135457389 AGGGCGGGGCGGCGGGCGCGGGG + Intergenic
1048976091 8:139673942-139673964 AGGGCGGTGGGGCAGGGGCGGGG - Intronic
1049379586 8:142305339-142305361 AGGGCGCAGGGGTGGGAGGGGGG + Intronic
1049383777 8:142330830-142330852 GGGGGGCAGGGGCGGGAGTGTGG - Intronic
1049552445 8:143266910-143266932 AGGGCGCTGGGGCCCCCGCGAGG + Intronic
1049620918 8:143597969-143597991 CGGGGGCTGGGGCGGGCGCGGGG - Exonic
1049643920 8:143727741-143727763 GGAGCGCAGGGGCGGGCCCGAGG - Exonic
1049661526 8:143821750-143821772 TGGGGGCAGGGGCAGGGGCGGGG - Intronic
1049762617 8:144337952-144337974 AGGTCGCGGGGGCGGCCCCGGGG + Intergenic
1049803974 8:144530637-144530659 GGCGCGGAGGGGCGGGGGCGGGG + Intronic
1051170228 9:14313973-14313995 AGGGCGAGCGGGCGGGCGGGAGG + Intronic
1051629317 9:19127601-19127623 AGGGCGCCGGGACGTGCCCGAGG - Intronic
1051809309 9:21031641-21031663 AGGAGGCAGGGGCGGCCCCGCGG + Intergenic
1052362229 9:27573491-27573513 CGGGCCCGGGGGCGGGCCCGGGG - Intronic
1052824908 9:33167394-33167416 CGGGGGCGGGGCCGGGCGCGGGG + Intergenic
1054731424 9:68705602-68705624 AGGGCGGAGGGGGCGGCGGGCGG - Intronic
1056154156 9:83817842-83817864 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1056659743 9:88535094-88535116 AGGGCGCAGGAGTGTGGGCGGGG + Exonic
1056773949 9:89498082-89498104 AGAGCGCTGAGGCCGGCGCGGGG + Intronic
1056807602 9:89740982-89741004 AGGGGGCAGGGGTGGGGACGGGG - Intergenic
1056992281 9:91423560-91423582 CGGGCGGGCGGGCGGGCGCGGGG - Intronic
1057245602 9:93451877-93451899 CGGGCGCGGGTGCGGGCGGGGGG - Exonic
1057487079 9:95494121-95494143 AGTGCGCAGGCGCTCGCGCGGGG + Intronic
1058005152 9:99906593-99906615 CGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1059145639 9:111897014-111897036 AGCGCGCAGGCGAGAGCGCGCGG + Exonic
1060514573 9:124257908-124257930 GGCGGGGAGGGGCGGGCGCGCGG + Intronic
1060552697 9:124492997-124493019 GGGGCCCAGGGGCGGGGCCGAGG + Intronic
1060596732 9:124853164-124853186 AGGGCGCGGGGCCGGGCTCTGGG + Intergenic
1060811668 9:126614060-126614082 GGGGTGCAGGGGCGGCCCCGCGG - Intergenic
1061275927 9:129569271-129569293 AGGGGGCGGGGGCGCGGGCGCGG + Intergenic
1061450970 9:130666820-130666842 GGGGCGCAAGGGCCGGCGAGGGG + Intronic
1061472241 9:130835605-130835627 AGGGCGCAGGCGGGAGCGCGCGG - Intronic
1061480894 9:130897315-130897337 AGGGCACAGGGGTGCGTGCGGGG - Intergenic
1061480905 9:130897353-130897375 AGGGCACAGGGGTGTGTGCGGGG - Intergenic
1061489800 9:130938673-130938695 TGGGCGCGGGCGCGGGCGCGGGG + Exonic
1061580110 9:131531202-131531224 CTGGGGAAGGGGCGGGCGCGGGG - Intronic
1061610039 9:131740024-131740046 GGGGAGCGGCGGCGGGCGCGCGG - Intronic
1061802293 9:133119304-133119326 AGGGCCCAAGGGAGGGGGCGGGG - Intronic
1061825648 9:133256732-133256754 AGGGTGCAGAGGCGGGTGTGTGG - Intronic
1061853504 9:133429282-133429304 AGGACGCAGGGGTGGGCGCAGGG - Intronic
1061901743 9:133676340-133676362 AGGGCACAGGGGCTGGGGAGAGG + Intronic
1061972346 9:134051535-134051557 AGGGAGCTGGGGCAGGCGAGGGG - Intronic
1062306001 9:135907421-135907443 CGGGGGCGGGGGCGGGCGCGGGG + Intergenic
1062395962 9:136352956-136352978 AGTGAGCAGGGGCGGGCGCTAGG + Intronic
1062407135 9:136402247-136402269 AGTGCGCAGGGGCCACCGCGTGG - Exonic
1062476109 9:136728290-136728312 AGCGCCCACGTGCGGGCGCGGGG - Intergenic
1062484906 9:136769903-136769925 AGGGTGCAGTGGCGGGGGCCTGG - Intergenic
1062507708 9:136886578-136886600 CGGGCGCGGGGTCGGGTGCGGGG + Intronic
1062507713 9:136886590-136886612 CGGGTGCGGGGTCGGGCGCGGGG + Intronic
1062565193 9:137161201-137161223 AGTGCGCGGGGCAGGGCGCGGGG + Intronic
1062565201 9:137161220-137161242 GGGGCGCGGGGCAGGGCGCGGGG + Intronic
1062566877 9:137167534-137167556 AGGGGGCAGAGGAGGGCGGGCGG - Intronic
1062579230 9:137222154-137222176 GGGGCGCGGGCGCGGGCGTGGGG + Intergenic
1062594941 9:137295396-137295418 AGGGAGGCGGGGCGGGCGCCGGG - Intergenic
1062609805 9:137368835-137368857 GGGGCGCAGGGCCCGGGGCGGGG + Intronic
1062609913 9:137369089-137369111 GGGGCGCAGGGCCCGGGGCGTGG + Intronic
1185747615 X:2584641-2584663 GAGGCGCGGGGGCGAGCGCGCGG + Intergenic
1186426092 X:9465205-9465227 AGGGCGCTGCGGCGGCGGCGGGG - Exonic
1186496420 X:10015481-10015503 GGGGCGCGGGGGCGGCCGCGGGG - Intergenic
1186802804 X:13110600-13110622 CGGGCGGAGGGGCGGGGGTGGGG - Intergenic
1187464579 X:19515559-19515581 AGGGCGGCGGGGCAGGAGCGGGG + Intergenic
1187802142 X:23075691-23075713 ACGGCGGAGAGGCGGGCGGGAGG + Intergenic
1189778301 X:44489883-44489905 AGTGCGCAGGGGTGGGGACGTGG - Intergenic
1190176677 X:48156291-48156313 GGGGAGCGGGGGCGGGCGCAGGG + Intergenic
1190222605 X:48521997-48522019 AGGGCGGTGGGGGGGGCGGGTGG - Intronic
1190316721 X:49156421-49156443 AGGGCGCTGGGGCACGCGGGCGG + Intergenic
1191141765 X:57121837-57121859 TGGGCGCGGGGGTGGGCGCGGGG - Intergenic
1191141771 X:57121849-57121871 CAGGGGCAGGGGTGGGCGCGGGG - Intergenic
1192314350 X:70040365-70040387 ATGGCACAGGGGCGGGCCCAGGG - Intergenic
1192491061 X:71578001-71578023 AGGGCGCGGGGGGAGGGGCGGGG - Intergenic
1192555013 X:72082261-72082283 AGGGTGCAGGGGCGAGGGTGGGG + Intergenic
1195113025 X:101666152-101666174 CGGGCGGTGGGGCGGGGGCGGGG + Intergenic
1195158080 X:102142471-102142493 TGGGCGGGCGGGCGGGCGCGGGG + Exonic
1195239271 X:102935036-102935058 AGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1195308376 X:103607918-103607940 AGGGCGGGCGGGCGGGCGCGGGG - Intronic
1195894696 X:109733416-109733438 GGCGAGCGGGGGCGGGCGCGTGG - Intergenic
1198398873 X:136251102-136251124 ATGGGACAGGGGCGGGGGCGGGG - Intronic
1198851403 X:140968503-140968525 AGGGCGGGCGGGCGGGCGGGCGG + Intergenic
1199757071 X:150874559-150874581 GGGGGGCGGGGGCGGGGGCGGGG + Intronic
1199832938 X:151562802-151562824 AGGGGGCAGCGGGGGGGGCGGGG + Intergenic
1200058744 X:153474706-153474728 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1200058748 X:153474712-153474734 CGGGGGCGGGGGCGGGGGCGGGG + Intronic
1200058750 X:153474718-153474740 CGGGGGCGGGGGCGGGGGCGCGG + Intronic
1200092955 X:153644289-153644311 CGGGTGCGGGGGCGGGGGCGGGG + Intronic
1200138517 X:153886192-153886214 TGCGCGCAGGGGCGGGGGAGGGG + Intronic
1200249792 X:154546879-154546901 CGGGGGCGGGGGCGGGCGCCTGG + Exonic