ID: 1071532677

View in Genome Browser
Species Human (GRCh38)
Location 10:86401365-86401387
Sequence GGTTACAGCGTCCGGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071532663_1071532677 22 Left 1071532663 10:86401320-86401342 CCAGGCCCGAGCTTGTCTCGAGC No data
Right 1071532677 10:86401365-86401387 GGTTACAGCGTCCGGGCGGCCGG No data
1071532670_1071532677 0 Left 1071532670 10:86401342-86401364 CCAGAAGGGCCAGCCTCGGAGGA No data
Right 1071532677 10:86401365-86401387 GGTTACAGCGTCCGGGCGGCCGG No data
1071532672_1071532677 -9 Left 1071532672 10:86401351-86401373 CCAGCCTCGGAGGAGGTTACAGC No data
Right 1071532677 10:86401365-86401387 GGTTACAGCGTCCGGGCGGCCGG No data
1071532665_1071532677 16 Left 1071532665 10:86401326-86401348 CCGAGCTTGTCTCGAGCCAGAAG No data
Right 1071532677 10:86401365-86401387 GGTTACAGCGTCCGGGCGGCCGG No data
1071532664_1071532677 17 Left 1071532664 10:86401325-86401347 CCCGAGCTTGTCTCGAGCCAGAA No data
Right 1071532677 10:86401365-86401387 GGTTACAGCGTCCGGGCGGCCGG No data
1071532662_1071532677 27 Left 1071532662 10:86401315-86401337 CCGTGCCAGGCCCGAGCTTGTCT No data
Right 1071532677 10:86401365-86401387 GGTTACAGCGTCCGGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071532677 Original CRISPR GGTTACAGCGTCCGGGCGGC CGG Intergenic