ID: 1071533069

View in Genome Browser
Species Human (GRCh38)
Location 10:86403577-86403599
Sequence ACAACAACAACAACAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071533069_1071533071 28 Left 1071533069 10:86403577-86403599 CCAGGTGTTGTTGTTGTTGTTGT No data
Right 1071533071 10:86403628-86403650 GTTGCTGTTGAGACGGAGTCTGG No data
1071533069_1071533070 21 Left 1071533069 10:86403577-86403599 CCAGGTGTTGTTGTTGTTGTTGT No data
Right 1071533070 10:86403621-86403643 TGTTGTTGTTGCTGTTGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071533069 Original CRISPR ACAACAACAACAACAACACC TGG (reversed) Intergenic