ID: 1071533071

View in Genome Browser
Species Human (GRCh38)
Location 10:86403628-86403650
Sequence GTTGCTGTTGAGACGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071533069_1071533071 28 Left 1071533069 10:86403577-86403599 CCAGGTGTTGTTGTTGTTGTTGT No data
Right 1071533071 10:86403628-86403650 GTTGCTGTTGAGACGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071533071 Original CRISPR GTTGCTGTTGAGACGGAGTC TGG Intergenic