ID: 1071539318

View in Genome Browser
Species Human (GRCh38)
Location 10:86466160-86466182
Sequence TAGGCACCTCACCTCCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071539318_1071539320 -7 Left 1071539318 10:86466160-86466182 CCTCAGGGGAGGTGAGGTGCCTA No data
Right 1071539320 10:86466176-86466198 GTGCCTAGGAATCTTCCTTGTGG No data
1071539318_1071539323 4 Left 1071539318 10:86466160-86466182 CCTCAGGGGAGGTGAGGTGCCTA No data
Right 1071539323 10:86466187-86466209 TCTTCCTTGTGGTGTCTTCAGGG No data
1071539318_1071539322 3 Left 1071539318 10:86466160-86466182 CCTCAGGGGAGGTGAGGTGCCTA No data
Right 1071539322 10:86466186-86466208 ATCTTCCTTGTGGTGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071539318 Original CRISPR TAGGCACCTCACCTCCCCTG AGG (reversed) Intronic