ID: 1071540151

View in Genome Browser
Species Human (GRCh38)
Location 10:86475016-86475038
Sequence AGCAAAATGTTACACTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071540150_1071540151 4 Left 1071540150 10:86474989-86475011 CCATGTAATAACATACATGATTT 0: 1
1: 0
2: 0
3: 26
4: 338
Right 1071540151 10:86475016-86475038 AGCAAAATGTTACACTAAGCAGG No data
1071540149_1071540151 15 Left 1071540149 10:86474978-86475000 CCAAAAAAGTACCATGTAATAAC 0: 1
1: 0
2: 0
3: 18
4: 217
Right 1071540151 10:86475016-86475038 AGCAAAATGTTACACTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071540151 Original CRISPR AGCAAAATGTTACACTAAGC AGG Intronic
No off target data available for this crispr