ID: 1071541603

View in Genome Browser
Species Human (GRCh38)
Location 10:86489922-86489944
Sequence CTTAAGACACAGTTTTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071541601_1071541603 18 Left 1071541601 10:86489881-86489903 CCTTGAAAAAAAAAAAAAAAGGC 0: 2
1: 56
2: 551
3: 4142
4: 21564
Right 1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071541603 Original CRISPR CTTAAGACACAGTTTTGGCT TGG Intronic
No off target data available for this crispr