ID: 1071541603 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:86489922-86489944 |
| Sequence | CTTAAGACACAGTTTTGGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1071541601_1071541603 | 18 | Left | 1071541601 | 10:86489881-86489903 | CCTTGAAAAAAAAAAAAAAAGGC | 0: 2 1: 56 2: 551 3: 4142 4: 21564 |
||
| Right | 1071541603 | 10:86489922-86489944 | CTTAAGACACAGTTTTGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1071541603 | Original CRISPR | CTTAAGACACAGTTTTGGCT TGG | Intronic | ||
| No off target data available for this crispr | |||||