ID: 1071542238

View in Genome Browser
Species Human (GRCh38)
Location 10:86496538-86496560
Sequence TTCATCTGTTGATGGACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8368
Summary {0: 109, 1: 466, 2: 1275, 3: 2600, 4: 3918}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071542238_1071542246 15 Left 1071542238 10:86496538-86496560 CCAAGTGTCCATCAACAGATGAA 0: 109
1: 466
2: 1275
3: 2600
4: 3918
Right 1071542246 10:86496576-86496598 TGGAAGGCATGGAGGTGTGGTGG No data
1071542238_1071542244 7 Left 1071542238 10:86496538-86496560 CCAAGTGTCCATCAACAGATGAA 0: 109
1: 466
2: 1275
3: 2600
4: 3918
Right 1071542244 10:86496568-86496590 ACAAAATGTGGAAGGCATGGAGG No data
1071542238_1071542241 -5 Left 1071542238 10:86496538-86496560 CCAAGTGTCCATCAACAGATGAA 0: 109
1: 466
2: 1275
3: 2600
4: 3918
Right 1071542241 10:86496556-86496578 ATGAATGGATAAACAAAATGTGG 0: 567
1: 3051
2: 5908
3: 7998
4: 17954
1071542238_1071542242 -1 Left 1071542238 10:86496538-86496560 CCAAGTGTCCATCAACAGATGAA 0: 109
1: 466
2: 1275
3: 2600
4: 3918
Right 1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG No data
1071542238_1071542245 12 Left 1071542238 10:86496538-86496560 CCAAGTGTCCATCAACAGATGAA 0: 109
1: 466
2: 1275
3: 2600
4: 3918
Right 1071542245 10:86496573-86496595 ATGTGGAAGGCATGGAGGTGTGG No data
1071542238_1071542243 4 Left 1071542238 10:86496538-86496560 CCAAGTGTCCATCAACAGATGAA 0: 109
1: 466
2: 1275
3: 2600
4: 3918
Right 1071542243 10:86496565-86496587 TAAACAAAATGTGGAAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071542238 Original CRISPR TTCATCTGTTGATGGACACT TGG (reversed) Intronic
Too many off-targets to display for this crispr