ID: 1071542242

View in Genome Browser
Species Human (GRCh38)
Location 10:86496560-86496582
Sequence ATGGATAAACAAAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071542237_1071542242 17 Left 1071542237 10:86496520-86496542 CCAAAAGGTAAAAACAATCCAAG 0: 1
1: 6
2: 133
3: 660
4: 2100
Right 1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG No data
1071542238_1071542242 -1 Left 1071542238 10:86496538-86496560 CCAAGTGTCCATCAACAGATGAA 0: 109
1: 466
2: 1275
3: 2600
4: 3918
Right 1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG No data
1071542240_1071542242 -9 Left 1071542240 10:86496546-86496568 CCATCAACAGATGAATGGATAAA 0: 971
1: 2576
2: 4620
3: 7496
4: 10634
Right 1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071542242 Original CRISPR ATGGATAAACAAAATGTGGA AGG Intronic
No off target data available for this crispr