ID: 1071542366

View in Genome Browser
Species Human (GRCh38)
Location 10:86498229-86498251
Sequence CTACAGCAGGACAAGGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071542362_1071542366 6 Left 1071542362 10:86498200-86498222 CCAGGTTAGAATAAAAGCTTATA 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1071542366 10:86498229-86498251 CTACAGCAGGACAAGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071542366 Original CRISPR CTACAGCAGGACAAGGGCGC TGG Intronic
No off target data available for this crispr