ID: 1071545017

View in Genome Browser
Species Human (GRCh38)
Location 10:86522167-86522189
Sequence GCCTGCGGAGGCCGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071545008_1071545017 15 Left 1071545008 10:86522129-86522151 CCGGTGCCTGGGGACCGCGGGCT No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data
1071545001_1071545017 26 Left 1071545001 10:86522118-86522140 CCAGGGACCCGCCGGTGCCTGGG No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data
1071545005_1071545017 18 Left 1071545005 10:86522126-86522148 CCGCCGGTGCCTGGGGACCGCGG No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data
1071545009_1071545017 9 Left 1071545009 10:86522135-86522157 CCTGGGGACCGCGGGCTGTGCAG No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data
1071544999_1071545017 29 Left 1071544999 10:86522115-86522137 CCTCCAGGGACCCGCCGGTGCCT No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data
1071545004_1071545017 19 Left 1071545004 10:86522125-86522147 CCCGCCGGTGCCTGGGGACCGCG No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data
1071544998_1071545017 30 Left 1071544998 10:86522114-86522136 CCCTCCAGGGACCCGCCGGTGCC No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data
1071545010_1071545017 1 Left 1071545010 10:86522143-86522165 CCGCGGGCTGTGCAGCTGTGCCG No data
Right 1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071545017 Original CRISPR GCCTGCGGAGGCCGCCGCCC GGG Intergenic
No off target data available for this crispr