ID: 1071548661

View in Genome Browser
Species Human (GRCh38)
Location 10:86548856-86548878
Sequence GGGGTGCTGGTCCATCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071548661_1071548669 13 Left 1071548661 10:86548856-86548878 CCCTCAAGATGGACCAGCACCCC No data
Right 1071548669 10:86548892-86548914 AGCACAGCATCAAACCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071548661 Original CRISPR GGGGTGCTGGTCCATCTTGA GGG (reversed) Intergenic
No off target data available for this crispr