ID: 1071549704

View in Genome Browser
Species Human (GRCh38)
Location 10:86557173-86557195
Sequence CAGGGGAAGCCAGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071549695_1071549704 -2 Left 1071549695 10:86557152-86557174 CCTGTCACCTCCTGCTGGTGCCA No data
Right 1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG No data
1071549699_1071549704 -9 Left 1071549699 10:86557159-86557181 CCTCCTGCTGGTGCCAGGGGAAG No data
Right 1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG No data
1071549691_1071549704 23 Left 1071549691 10:86557127-86557149 CCAGGGAGCGTGCACTCACCTGC No data
Right 1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG No data
1071549693_1071549704 5 Left 1071549693 10:86557145-86557167 CCTGCGGCCTGTCACCTCCTGCT No data
Right 1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071549704 Original CRISPR CAGGGGAAGCCAGAGGAGGA AGG Intergenic
No off target data available for this crispr