ID: 1071549854

View in Genome Browser
Species Human (GRCh38)
Location 10:86558266-86558288
Sequence ATTTATTCTGAATCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071549854_1071549858 17 Left 1071549854 10:86558266-86558288 CCAGCAGAGGATTCAGAATAAAT No data
Right 1071549858 10:86558306-86558328 CCATGCTGCCTGACAAAAATGGG No data
1071549854_1071549856 16 Left 1071549854 10:86558266-86558288 CCAGCAGAGGATTCAGAATAAAT No data
Right 1071549856 10:86558305-86558327 GCCATGCTGCCTGACAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071549854 Original CRISPR ATTTATTCTGAATCCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr