ID: 1071549858

View in Genome Browser
Species Human (GRCh38)
Location 10:86558306-86558328
Sequence CCATGCTGCCTGACAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071549854_1071549858 17 Left 1071549854 10:86558266-86558288 CCAGCAGAGGATTCAGAATAAAT No data
Right 1071549858 10:86558306-86558328 CCATGCTGCCTGACAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071549858 Original CRISPR CCATGCTGCCTGACAAAAAT GGG Intergenic
No off target data available for this crispr