ID: 1071553617

View in Genome Browser
Species Human (GRCh38)
Location 10:86585807-86585829
Sequence CATGGAGCCCACAAAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071553617_1071553621 -2 Left 1071553617 10:86585807-86585829 CCAGTGCCTTTGTGGGCTCCATG No data
Right 1071553621 10:86585828-86585850 TGTATTGCGGTATCTGCTTGAGG No data
1071553617_1071553622 7 Left 1071553617 10:86585807-86585829 CCAGTGCCTTTGTGGGCTCCATG No data
Right 1071553622 10:86585837-86585859 GTATCTGCTTGAGGCTCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071553617 Original CRISPR CATGGAGCCCACAAAGGCAC TGG (reversed) Intergenic
No off target data available for this crispr