ID: 1071556882

View in Genome Browser
Species Human (GRCh38)
Location 10:86611225-86611247
Sequence TACCTTGACCTCCCAAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071556879_1071556882 -7 Left 1071556879 10:86611209-86611231 CCTCAGGTGATCCACCTACCTTG 0: 252
1: 10827
2: 37868
3: 73147
4: 93034
Right 1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG No data
1071556873_1071556882 21 Left 1071556873 10:86611181-86611203 CCATGTTTGGCTGGTCTCTATCC No data
Right 1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG No data
1071556876_1071556882 -1 Left 1071556876 10:86611203-86611225 CCCTGCCCTCAGGTGATCCACCT No data
Right 1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG No data
1071556875_1071556882 0 Left 1071556875 10:86611202-86611224 CCCCTGCCCTCAGGTGATCCACC No data
Right 1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG No data
1071556877_1071556882 -2 Left 1071556877 10:86611204-86611226 CCTGCCCTCAGGTGATCCACCTA 0: 3
1: 947
2: 34309
3: 80153
4: 113927
Right 1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG No data
1071556878_1071556882 -6 Left 1071556878 10:86611208-86611230 CCCTCAGGTGATCCACCTACCTT 0: 3
1: 62
2: 330
3: 591
4: 935
Right 1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071556882 Original CRISPR TACCTTGACCTCCCAAAGTG TGG Intergenic
No off target data available for this crispr