ID: 1071556992

View in Genome Browser
Species Human (GRCh38)
Location 10:86612081-86612103
Sequence CGGCAAACAGCCGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071556992_1071556999 13 Left 1071556992 10:86612081-86612103 CCGTCCACCACGGCTGTTTGCCG No data
Right 1071556999 10:86612117-86612139 GACGCTGACTTCCATCCCTCCGG No data
1071556992_1071557000 19 Left 1071556992 10:86612081-86612103 CCGTCCACCACGGCTGTTTGCCG No data
Right 1071557000 10:86612123-86612145 GACTTCCATCCCTCCGGTTCCGG No data
1071556992_1071557003 24 Left 1071556992 10:86612081-86612103 CCGTCCACCACGGCTGTTTGCCG No data
Right 1071557003 10:86612128-86612150 CCATCCCTCCGGTTCCGGCAGGG No data
1071556992_1071557001 23 Left 1071556992 10:86612081-86612103 CCGTCCACCACGGCTGTTTGCCG No data
Right 1071557001 10:86612127-86612149 TCCATCCCTCCGGTTCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071556992 Original CRISPR CGGCAAACAGCCGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr