ID: 1071558035

View in Genome Browser
Species Human (GRCh38)
Location 10:86621211-86621233
Sequence CACAAAGACATTCCATCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071558035_1071558040 20 Left 1071558035 10:86621211-86621233 CCTTTTGATGGAATGTCTTTGTG No data
Right 1071558040 10:86621254-86621276 CATTGTGTATTGGATTTGTAAGG No data
1071558035_1071558038 10 Left 1071558035 10:86621211-86621233 CCTTTTGATGGAATGTCTTTGTG No data
Right 1071558038 10:86621244-86621266 TCTGTTCCATCATTGTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071558035 Original CRISPR CACAAAGACATTCCATCAAA AGG (reversed) Intergenic
No off target data available for this crispr