ID: 1071561883

View in Genome Browser
Species Human (GRCh38)
Location 10:86651682-86651704
Sequence CTATCAGTGCAGAGGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071561875_1071561883 15 Left 1071561875 10:86651644-86651666 CCACGGAAGGGGAGATGTGGCTG No data
Right 1071561883 10:86651682-86651704 CTATCAGTGCAGAGGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071561883 Original CRISPR CTATCAGTGCAGAGGTCCCT GGG Intergenic
No off target data available for this crispr