ID: 1071562728

View in Genome Browser
Species Human (GRCh38)
Location 10:86656216-86656238
Sequence CACTGTGCCCAGGGTATAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 290}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071562728_1071562733 -10 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562733 10:86656229-86656251 GGGCACAGTGATCTTGCTGGTGG 0: 1
1: 0
2: 2
3: 14
4: 176
1071562728_1071562739 9 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562739 10:86656248-86656270 GTGGGACTCACGGGGATGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 132
1071562728_1071562740 20 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562740 10:86656259-86656281 GGGGATGCTGGGCAACCTGACGG 0: 1
1: 0
2: 1
3: 31
4: 238
1071562728_1071562735 -1 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562735 10:86656238-86656260 GATCTTGCTGGTGGGACTCACGG 0: 1
1: 0
2: 0
3: 9
4: 157
1071562728_1071562734 -9 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562734 10:86656230-86656252 GGCACAGTGATCTTGCTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1071562728_1071562738 8 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562738 10:86656247-86656269 GGTGGGACTCACGGGGATGCTGG 0: 1
1: 0
2: 0
3: 17
4: 158
1071562728_1071562737 1 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562737 10:86656240-86656262 TCTTGCTGGTGGGACTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1071562728_1071562736 0 Left 1071562728 10:86656216-86656238 CCCACTATACCCTGGGCACAGTG 0: 1
1: 0
2: 3
3: 25
4: 290
Right 1071562736 10:86656239-86656261 ATCTTGCTGGTGGGACTCACGGG 0: 1
1: 0
2: 0
3: 27
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071562728 Original CRISPR CACTGTGCCCAGGGTATAGT GGG (reversed) Exonic
900437573 1:2638815-2638837 CACTGTGCTCAGGGCAGAGGTGG + Intronic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
901755308 1:11438005-11438027 CACAGTGTCCAGAATATAGTAGG + Intergenic
902617936 1:17634148-17634170 CACGGTGCCCAGGATATAAACGG - Intronic
903268961 1:22176028-22176050 CACTGTGCCCGGCACATAGTAGG + Intergenic
903575484 1:24337218-24337240 CACTGTCCCCAGAGCATAGCAGG + Intronic
904323573 1:29712301-29712323 CACAGTGCCCAGTACATAGTAGG - Intergenic
905554018 1:38867700-38867722 CAATGTGCTCAGCGTATAGTTGG - Intronic
906341300 1:44983405-44983427 CTTTGTGCCTTGGGTATAGTAGG - Intronic
906728995 1:48064977-48064999 CACTGTGCCTAGCATGTAGTAGG - Intergenic
906948003 1:50311917-50311939 CACAGTGTTCAGTGTATAGTAGG + Intergenic
908025157 1:59942850-59942872 CTCTGTGCCCAGCACATAGTAGG - Intergenic
908389924 1:63675197-63675219 CACTGTGCCTGGAGCATAGTGGG + Intergenic
908986596 1:70031215-70031237 CACAGTGCCTAGGATAGAGTAGG + Intronic
909308171 1:74108936-74108958 CACAGTGCCTGGGATATAGTAGG + Intronic
910374368 1:86552762-86552784 TACTGTGTCCAGGTTGTAGTAGG + Intronic
910536908 1:88309061-88309083 AACTGTGCCCAGGACATAGCAGG - Intergenic
911419784 1:97626046-97626068 CACTTTGCCCATAGTCTAGTAGG - Intronic
912710206 1:111944520-111944542 CCCTGTGCCCAGGGCATGGCTGG - Intronic
914451683 1:147798372-147798394 CACAGTGCTCAGAGGATAGTTGG - Intergenic
915296754 1:154926735-154926757 CACAGTGACCAGCGTACAGTAGG - Intronic
915434201 1:155891199-155891221 CACCGTGCCCAGCTGATAGTGGG - Intergenic
918428591 1:184435629-184435651 CACTGTGCCTGGCGTATAGATGG + Intronic
918576374 1:186065615-186065637 CACTGTGCCTAGAACATAGTAGG - Intronic
918649085 1:186937910-186937932 CACAGTGCCCAGAATATAGTAGG + Intronic
919710778 1:200726055-200726077 CACTGTTTCCATAGTATAGTTGG + Intergenic
920357931 1:205389335-205389357 CACTGTGCCCAGCCTACATTTGG + Intronic
921129778 1:212209800-212209822 CACTATGCCTAGGACATAGTAGG - Intergenic
921173125 1:212566564-212566586 AACTGTGACCAGGGCATAGAGGG + Intronic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
923442541 1:234034809-234034831 CACTGTGCCCAGCCCATAGATGG + Intronic
923854889 1:237835671-237835693 CACTGTGCCCAGAGTAAATGAGG - Intergenic
924614522 1:245601641-245601663 CACAGTGCCCAGCACATAGTAGG + Intronic
1064076875 10:12275902-12275924 CACTGTGCCCAGGTGATAAATGG + Intergenic
1064337316 10:14455412-14455434 CACTGTGCCCAGCCTATATACGG + Intronic
1066646846 10:37618896-37618918 CACTGTGCCCCAAGTCTAGTTGG + Intergenic
1068778315 10:60891634-60891656 CACTGTGCCCAGCCTAGAGGAGG + Intronic
1069570211 10:69490115-69490137 CACTGTGGTCAGGGAACAGTGGG + Intronic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1071707294 10:88012821-88012843 TTCTGTTCCCAGGGTGTAGTAGG + Intergenic
1072483739 10:95834197-95834219 CTCTGTGCCTAATGTATAGTAGG + Intronic
1073012357 10:100371407-100371429 CTCTGTGGCCAGGGTGTAGCTGG - Intergenic
1075216331 10:120539421-120539443 CACTGTGCCCAGCACACAGTGGG + Intronic
1076500871 10:130935091-130935113 CACTGAGCCCAGTGCATAGCAGG + Intergenic
1078729552 11:13962993-13963015 CACTTTGTCCAGGGTCTCGTCGG - Exonic
1078739189 11:14050778-14050800 CAGTGTGCCCAGGGTAAACCGGG + Intronic
1079396579 11:20068886-20068908 CACAGTGCCCGGGGCATAGCTGG - Intronic
1080297635 11:30748903-30748925 CACAGTGCCTAGTGCATAGTAGG - Intergenic
1084071552 11:66739738-66739760 CACTGCGCCCAGGCTATAATTGG - Intergenic
1086973245 11:93105952-93105974 GACTGTTCCCAGTGTATAGTAGG - Intergenic
1088563015 11:111134880-111134902 CCCTGTGCCTTGGGTATACTTGG - Intergenic
1089139281 11:116273303-116273325 CACAGTGCCCAGCGTATAACAGG - Intergenic
1089980125 11:122765394-122765416 CACTGAGCCCAGGGCTCAGTGGG - Intronic
1090908483 11:131097560-131097582 CACTGTGCCCAGTGCTGAGTTGG + Intergenic
1091076165 11:132619407-132619429 CACAGTGCCTAGTGTATGGTAGG + Intronic
1091875138 12:3927532-3927554 CAGTGTGCCCAGGATATTGAGGG - Intergenic
1092871333 12:12808409-12808431 CAGTGTCCCCAGGGTATCGAGGG - Intronic
1095177809 12:39113341-39113363 CACTGTGCCCAGCCTGTACTTGG + Intergenic
1096385768 12:51194313-51194335 CACTGTGCCCAGCCTATAACAGG + Intronic
1097923122 12:65098541-65098563 CACAATGCCCAGGACATAGTAGG - Intronic
1098346632 12:69511769-69511791 CACTGTGCCCATTTTATAGATGG - Intronic
1100515962 12:95328002-95328024 CACTGTGCCCAGCCTAGAGATGG - Intergenic
1100633874 12:96415544-96415566 CATTGTGCCCAGCCTAAAGTGGG + Intergenic
1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG + Intronic
1101422973 12:104564508-104564530 CACAGTGCTCAGGGTTTAGCGGG + Intronic
1101949077 12:109160417-109160439 CCCTGTGCCCAGTCCATAGTGGG + Intronic
1102029565 12:109732110-109732132 CCCTATCCCCAGGGTTTAGTTGG - Intronic
1103250334 12:119494476-119494498 CACTGGGCCCACTGTTTAGTGGG + Intronic
1103360674 12:120351613-120351635 CCCCGTGCCCAGGGTATAGGTGG - Intronic
1106389796 13:29323991-29324013 CACTGTGCCCTGGGTATTGCTGG + Intronic
1109316824 13:60759092-60759114 TAATGTGCCCATGGTATAATAGG + Intergenic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1110543830 13:76734786-76734808 CACTGTGCCCAGCCTGAAGTAGG + Intergenic
1110732261 13:78892457-78892479 CACTGTGTTCAGTGCATAGTAGG + Intergenic
1112585828 13:100717863-100717885 CACTGTGCCCCGCACATAGTAGG - Intergenic
1113588778 13:111483631-111483653 CAATGTGCCCAGCACATAGTAGG + Intergenic
1115491024 14:33958256-33958278 CACAGAGCCTGGGGTATAGTGGG - Intronic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1117284680 14:54275673-54275695 AACTGTGCCCAGCACATAGTAGG - Intergenic
1117970306 14:61244989-61245011 CGCTGTGCCTCAGGTATAGTAGG - Intronic
1118302378 14:64627068-64627090 TATTGTGCCCAGCATATAGTAGG - Intergenic
1119079956 14:71683849-71683871 CATTGTGCCCAGTGTATTTTTGG + Intronic
1119472223 14:74907247-74907269 CAATGTTCCCAGGGTAAAATGGG - Intronic
1120003803 14:79334088-79334110 CACAGTGCCTAGGACATAGTAGG - Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1122140165 14:99658839-99658861 CACTGTGACCAGCACATAGTAGG - Intronic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1123832227 15:24152063-24152085 CACTGTGCCAAAGGAAAAGTTGG + Intergenic
1124944861 15:34255340-34255362 CACTGGGCCCAGAGTTTGGTGGG - Exonic
1125409334 15:39389134-39389156 GACAGTGCCCAGTGTATAATAGG + Intergenic
1125726598 15:41871412-41871434 CACTGTGCCCACGCTCTAGCAGG + Exonic
1126470458 15:49005039-49005061 CACTGCGCCCAGCCAATAGTGGG - Intronic
1127422593 15:58821959-58821981 CACTGTGCCCAGCCTATGGATGG - Intronic
1128093036 15:64931843-64931865 CACAGTGCCCAGGACATAATAGG + Intronic
1129956243 15:79639419-79639441 AACAGTGCCCAGGCTAAAGTAGG - Intergenic
1130214412 15:81954682-81954704 CACTGTGCCCAGAGCATCATAGG - Intergenic
1130397294 15:83513712-83513734 CACTCTACCCAGGGCATGGTAGG + Intronic
1130687872 15:86054705-86054727 CACAATGCCCTGGGCATAGTAGG - Intergenic
1132870645 16:2114335-2114357 CACTGAGAACAGGGTATCGTTGG + Exonic
1134165518 16:11926336-11926358 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1134471116 16:14526784-14526806 CACTGTGCCAGGGTTAAAGTTGG + Intronic
1134500556 16:14766348-14766370 CAGGGTGCCCAGGGGATACTCGG + Intronic
1134527096 16:14952961-14952983 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1134545307 16:15103387-15103409 CAGGGTGCCCAGGGGATACTCGG - Intronic
1134580027 16:15362702-15362724 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1134678441 16:16106922-16106944 CACAGTGCCCAGTGCACAGTGGG - Intronic
1134714681 16:16351494-16351516 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1134722558 16:16394858-16394880 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1134756305 16:16670517-16670539 CACAGTGCCCAGCACATAGTAGG + Intergenic
1134944870 16:18317011-18317033 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1134952134 16:18357164-18357186 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1134989765 16:18688647-18688669 CACAGTGCCCAGCACATAGTAGG - Intergenic
1135055802 16:19231280-19231302 CACTGTGCCCAGCATACAGAGGG - Intronic
1135074821 16:19384122-19384144 CACTGCGCCCAGCCTATAGAAGG + Intergenic
1135121755 16:19772104-19772126 GACTGGGCCCAGGGGATCGTAGG + Intronic
1135363422 16:21833654-21833676 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136046026 16:27615640-27615662 CACTGTGCCCGGCCTGTAGTGGG + Intronic
1136150058 16:28341575-28341597 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136166293 16:28455390-28455412 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136196680 16:28659642-28659664 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1136213020 16:28773767-28773789 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1136257746 16:29053680-29053702 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1136307221 16:29380380-29380402 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136320746 16:29482623-29482645 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136380874 16:29894889-29894911 CACTGTGCCCGGCCTATAGAGGG - Intronic
1136435319 16:30221963-30221985 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1137636443 16:49991089-49991111 CACTGTGCCCAGCCTAGTGTTGG - Intergenic
1138600119 16:58049126-58049148 CACAGTGCCCAGGCCACAGTGGG + Intergenic
1139694152 16:68661597-68661619 CACTGTGCCCAGTACAAAGTAGG - Intronic
1140656319 16:77143701-77143723 CCTTGTGCCTAGGGTAGAGTTGG - Intergenic
1141434739 16:83993588-83993610 CACTGTGTCCAGCACATAGTAGG - Intronic
1141642603 16:85349946-85349968 CACAGTGTCCAGGGCACAGTAGG - Intergenic
1142722572 17:1786500-1786522 CACTGTGCCCAGCCTATCCTGGG + Intronic
1143006656 17:3840430-3840452 CACTGTGCCTGGGACATAGTAGG + Intronic
1143156681 17:4841811-4841833 CACCGTGCCCAGCATATACTGGG - Intronic
1143772326 17:9176582-9176604 GACTTTGCACAGGGTATAATGGG + Intronic
1145017230 17:19407285-19407307 CACTGTGCCCAGCACTTAGTAGG + Intergenic
1145216282 17:21054907-21054929 CACTGTGCCCAGGGCATTTTGGG - Intergenic
1146513661 17:33472358-33472380 CAATGTGCCCAGTGCATGGTGGG - Intronic
1146524300 17:33552960-33552982 CAGTGGGCCCAGGGTTCAGTTGG - Intronic
1148203907 17:45767757-45767779 CAGTGTGCCCAGCACATAGTAGG + Intergenic
1149544028 17:57489730-57489752 CACTGTGCCCAGCACACAGTGGG - Intronic
1150056546 17:62021876-62021898 CACTGTGCCCAGGCTTTAGAAGG - Intronic
1150494837 17:65599369-65599391 CACAGTGCCCAGCACATAGTAGG - Intronic
1150866476 17:68855922-68855944 CACTGTGCCCAGCCTAGAGTTGG - Intergenic
1151422721 17:74008978-74009000 CACTGTGCTGAGTGCATAGTAGG - Intergenic
1151621409 17:75247681-75247703 CACGGTGACCAGGGCTTAGTAGG - Intronic
1154116773 18:11618345-11618367 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1154382747 18:13867396-13867418 CACTGTGCCCAGCTTAAATTTGG - Intergenic
1154940188 18:21104790-21104812 CTTTGTGCCAAGGGTTTAGTTGG - Intronic
1154993377 18:21616972-21616994 CACTGTGCCCAGCCTATATCTGG + Intronic
1161251468 19:3282582-3282604 CACAGTGCCCAGGGAACAGAAGG + Intronic
1161623957 19:5314991-5315013 CACTGGGCCTAGTGCATAGTAGG - Intronic
1162418542 19:10552742-10552764 CACTGTGGCCAGGGGATGGAAGG + Intronic
1162722549 19:12670896-12670918 CACTGTGCCCAGCTGAGAGTAGG - Exonic
1164404811 19:27935304-27935326 CACTGTCCCCAGGGTACCCTGGG - Intergenic
1164556937 19:29260387-29260409 CCCAGTGCCCAGCATATAGTTGG - Intergenic
1165106668 19:33474117-33474139 TGCTGGGGCCAGGGTATAGTAGG - Intronic
1165348192 19:35262066-35262088 CACAGTGAGCAGGGTTTAGTGGG - Intronic
1166750986 19:45163953-45163975 CTCAATGCCCAGGGTATAGAGGG + Exonic
1168115879 19:54221180-54221202 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168118862 19:54240928-54240950 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168121683 19:54255383-54255405 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168125180 19:54278909-54278931 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168169291 19:54575433-54575455 CACAGGGCCCAGGGTGAAGTTGG - Exonic
1168172075 19:54595816-54595838 CACAGGGCCCAGGGTGAAGTTGG - Exonic
1168176794 19:54632641-54632663 CACAGGGCCCAGGGTGAAGTTGG - Exonic
1168185606 19:54697826-54697848 CACAGGGCCCAGGGTGAAGTTGG - Intronic
1168187582 19:54709732-54709754 CACAGGGCCCAGGGTGAAGTTGG - Intergenic
928035439 2:27818228-27818250 CACTGTTCTCAGGGTATACGTGG + Intronic
929634552 2:43504589-43504611 CACCATGCCCAGCCTATAGTAGG - Intronic
929644096 2:43610098-43610120 CACAGTGCCCAGAACATAGTAGG - Intergenic
930146733 2:48014880-48014902 CACAGTGTCCAGCATATAGTTGG + Intergenic
931666191 2:64610948-64610970 CACTGTGCCCAGCCTATTGTTGG - Intergenic
933639909 2:84747938-84747960 CTCTGAGCCAAGGGTAGAGTTGG + Intronic
934561979 2:95318129-95318151 CACTGTCCCCAGGTCACAGTGGG - Intronic
935210640 2:100937075-100937097 CAGTGTGCCCAGCATAGAGTAGG + Intronic
936387994 2:112047591-112047613 CACTCTGCCCTGCGCATAGTGGG + Intergenic
937390056 2:121478310-121478332 CACTGTGCCCAGCCTGTAGGTGG - Intronic
938405991 2:131033489-131033511 CTCTGGGCCCTGGGTACAGTGGG - Intronic
938933652 2:136109588-136109610 CACTGTGCCTGGCGTATAGTAGG - Intergenic
939220083 2:139290712-139290734 CACTGTGCCTAGGGTAGAGGGGG - Intergenic
939415758 2:141894759-141894781 CACTGTGCCCAGCATAAATTAGG - Intronic
940997372 2:160164401-160164423 CACTGTGCCCAGCCTAAAATGGG - Intronic
941123392 2:161558117-161558139 CACAGTGCCCAGCATATAATAGG + Intronic
941699845 2:168592637-168592659 CACTGTGCCCAGTGACTAATTGG + Intronic
941981349 2:171460822-171460844 CACTGTGCCCAGCTGATAGTGGG + Intronic
942562045 2:177230015-177230037 AACTCTGCCTAGGGTATAGTGGG + Intronic
942713703 2:178866989-178867011 CAATGTGCCCAGGCTAAAGAAGG + Intronic
944943424 2:204654815-204654837 CACAGTGCCCAGGTTTTTGTTGG + Intronic
946824574 2:223663946-223663968 CACTGTGCCCAGCCTGTATTTGG - Intergenic
947599269 2:231435493-231435515 CACTGTGCCCGGCCAATAGTTGG + Intergenic
1170838014 20:19901523-19901545 CATTTTCCCCAGGGTTTAGTTGG - Intronic
1171116289 20:22527396-22527418 CACTGTGCCCAGCCTATTGCAGG - Intergenic
1172224643 20:33297296-33297318 CCCTGTGCCCAGGGTGTGCTTGG - Intronic
1172457659 20:35090660-35090682 CACTGTGCCCAGCCTCTGGTGGG + Intronic
1173464536 20:43270576-43270598 CACTGTGCCCAGCTCATAGTAGG + Intergenic
1173579468 20:44137086-44137108 CATTGTGCCCAGCACATAGTAGG + Intronic
1173870756 20:46340600-46340622 CACGGGGCCCAGTGCATAGTAGG - Intergenic
1174417702 20:50378480-50378502 AACTGTGCCTGGGGCATAGTAGG - Intergenic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175463080 20:59169475-59169497 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1176711743 21:10155897-10155919 CACCATGCCCAGGCTGTAGTGGG - Intergenic
1176998693 21:15585451-15585473 CACTGTGCCCAGGCAAAAGCAGG - Intergenic
1178894720 21:36548916-36548938 GAATGTGCCCAGGGTGTGGTGGG - Intronic
1181054889 22:20256231-20256253 CACTGAGCCCAGGGCACAGAGGG + Intronic
1181516762 22:23418606-23418628 AACTGTGCCCAGGCCATGGTCGG - Intergenic
1182339261 22:29606240-29606262 CACTGTGCCCTGCGAAAAGTTGG + Intronic
1182909231 22:33966942-33966964 CACAATGCCCAGCATATAGTTGG - Intergenic
1183432073 22:37771995-37772017 CACAGTGCCCAGGATATAGTAGG - Intronic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184461752 22:44641666-44641688 CACAGTGCCCAGCATATAGCAGG - Intergenic
1184963763 22:47951467-47951489 CACTGTGGCCAGGATAAAGCAGG - Intergenic
1184994796 22:48197552-48197574 GACTGTGCCCAGGGTAGATGTGG - Intergenic
949366058 3:3281927-3281949 CACTGGGGCCAGAGCATAGTAGG + Intergenic
954307257 3:49735064-49735086 CACTGCGCCCAGTCTAGAGTGGG - Intronic
956455111 3:69413096-69413118 CACAGTGCCTAATGTATAGTAGG + Intronic
960872685 3:122265649-122265671 CACTGTGGCCAAGGTATTCTAGG + Intronic
960916099 3:122696503-122696525 CCCTTTGCCCAAGGAATAGTAGG - Intronic
962423759 3:135250861-135250883 CACTGTGCCCATTGTATAACAGG - Intronic
962551874 3:136501891-136501913 CACTGTGCCCGGCCTATACTGGG - Intronic
962734158 3:138309394-138309416 CACTGTGCCCAGCCAACAGTGGG - Intronic
963631936 3:147744225-147744247 CACAGTGCCCAGCACATAGTAGG - Intergenic
964667330 3:159188798-159188820 CAATGTGCCCAGCTCATAGTAGG + Intronic
967713490 3:192736712-192736734 CATTGTGCCCAGCATATAGCAGG + Intronic
972692991 4:41417810-41417832 CACTGTGCCCAGCCTCTAGAGGG + Intronic
974831411 4:67193856-67193878 CACTGTGCTCAGCATATAGTAGG + Intergenic
981612999 4:146616163-146616185 AAGTGTGCCCAGTCTATAGTGGG + Intergenic
982183515 4:152773006-152773028 CACTGTGCCCGGCCTAAAGTAGG + Intronic
986644302 5:9901544-9901566 CACTTTGCTCTGGGTATAATAGG + Intergenic
990873111 5:60455345-60455367 CACAGGGCACAGGATATAGTAGG + Intronic
992323009 5:75632531-75632553 CACTGTGGCCAAGGGATAGGTGG + Intronic
993118926 5:83751367-83751389 CACTGTGCCCGGACTATAGTAGG + Intergenic
995198670 5:109401304-109401326 CACTGTGCCCAGGCTGTCATTGG - Intronic
996942260 5:129022311-129022333 CACAGTGTCCAGCATATAGTTGG + Intronic
998122597 5:139591083-139591105 CACTGTGCCCAACCTATGGTGGG + Intronic
998254380 5:140573590-140573612 CACTGGGCCCAGCATACAGTGGG + Intronic
1000370543 5:160531765-160531787 CACTGTGCCCAAAGTATTGATGG + Intergenic
1001321974 5:170690093-170690115 CACGGTGCCCAGCACATAGTAGG + Intronic
1001590942 5:172864766-172864788 CACTGTGCCCAGCATATAATAGG - Intronic
1001601057 5:172928650-172928672 CCCTGTACCCAGGGTATAGTAGG + Intronic
1003415518 6:5904462-5904484 AACTGTGTCCAGGGTAGATTTGG + Intergenic
1003668152 6:8130731-8130753 CACAGTGCTGAGGATATAGTAGG + Intergenic
1005934511 6:30509971-30509993 CACTGTGCCCAGCGTAAACGTGG + Intergenic
1006308776 6:33242391-33242413 CACTGTGCCCAGTGTAATGCAGG - Intergenic
1006656641 6:35599992-35600014 CACTTAGCCGAGGTTATAGTAGG - Intronic
1007177748 6:39908342-39908364 CACGGTGCCCAGATTATAGCAGG - Intronic
1012921861 6:105228291-105228313 CACTGTGCCCAGCCAATAGAAGG - Intergenic
1013225999 6:108119669-108119691 CACCGTGCCCGGGGTAGAGGTGG - Intronic
1013256925 6:108396777-108396799 CACTGCACCCAGGCCATAGTAGG + Intronic
1014260585 6:119212126-119212148 CACTGTGCCCGGCCAATAGTAGG + Intronic
1014637668 6:123868154-123868176 CACTGTGCCCAGCCTGTACTGGG + Intronic
1014885819 6:126780140-126780162 CACTGGATCCAGGGTATGGTTGG - Intergenic
1015764295 6:136699563-136699585 CAGTGAGCCCAGGCTGTAGTGGG - Intronic
1016062779 6:139647487-139647509 GTGTGAGCCCAGGGTATAGTGGG - Intergenic
1016378907 6:143452907-143452929 CACAATGCCCAGCGTAAAGTGGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017498074 6:154998959-154998981 CACAATGCCCTGGGTAAAGTAGG + Intronic
1018271787 6:162087490-162087512 CACAGTGCCTAGCGTAAAGTAGG - Intronic
1018884893 6:167926876-167926898 CACAGTCCCCAGCATATAGTAGG + Intronic
1020617204 7:10474562-10474584 AACTGTGCCTAGTATATAGTAGG + Intergenic
1021880139 7:25087169-25087191 CTCTGTGCCCAGTTTATAATTGG - Intergenic
1022107541 7:27207731-27207753 CACTGTGCCCAAGGCTTGGTAGG - Intergenic
1023518987 7:41031966-41031988 CCCTGTGCCCAGTATCTAGTAGG + Intergenic
1025252942 7:57364069-57364091 AACTGTGCCTGGGGCATAGTAGG + Intergenic
1026401972 7:70023131-70023153 CACTGTGCCCAGCCTCTAATTGG + Intronic
1027375718 7:77547222-77547244 CACAGTACCTAGGGCATAGTGGG - Intronic
1029009531 7:97243922-97243944 CACTGTGCCCAGCCAAGAGTTGG + Intergenic
1029598820 7:101551873-101551895 CACTGTGGCCAGCACATAGTAGG - Intronic
1033719042 7:144037439-144037461 CACTGTGCCTAGAATATTGTAGG + Intergenic
1036045511 8:5135611-5135633 CTCTGTGCCCAGGCTGCAGTGGG + Intergenic
1041226030 8:55699065-55699087 AACTGTACCCAGGCTACAGTGGG - Intronic
1044445662 8:92272367-92272389 CACATTTCCCAGGCTATAGTAGG - Intergenic
1046004552 8:108463667-108463689 CTCTGTGCCAAGGGTAAAGATGG + Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048295335 8:133209718-133209740 CACTGTGCCCAGAACAGAGTTGG - Intronic
1049371405 8:142269615-142269637 CACTGTGCCCAGGCCATGGTGGG + Intronic
1049488293 8:142877653-142877675 CACTGTGCCCAGGGCAGGGAAGG - Intronic
1050633955 9:7590303-7590325 CACAGTGGCCAGCATATAGTAGG - Intergenic
1051198792 9:14594163-14594185 CACCGTGACCAGGTCATAGTAGG - Intergenic
1051288019 9:15515668-15515690 CACTGTGCCCAACGTCCAGTGGG + Intergenic
1052514359 9:29460969-29460991 AACTGTGCCCAGCCAATAGTAGG + Intergenic
1053150252 9:35738706-35738728 CAGTGTGCCAGGGGTATGGTTGG - Intronic
1053518695 9:38754609-38754631 CACTGTGCCCAGCCTAGAGATGG + Intergenic
1053543928 9:39003306-39003328 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1053648734 9:40141588-40141610 CACCGTGCCCAGGCTGTAGCGGG - Intergenic
1053757010 9:41322254-41322276 CACCGTGCCCAGGCTGTAGCGGG + Intergenic
1053808359 9:41826803-41826825 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1054535847 9:66234582-66234604 CACCGTGCCCAGGCTGTAGCGGG + Intergenic
1054622233 9:67360625-67360647 CACTGTGCCCAGGGAGTTGATGG + Intergenic
1054978152 9:71172188-71172210 CACTGTGCCCAGCGCATAGAAGG + Intronic
1055799738 9:80021962-80021984 CACTGTGCCCAGCCTATTCTTGG + Intergenic
1056160597 9:83887991-83888013 CACTGTGCCCAGCCGGTAGTAGG - Intronic
1057074019 9:92125533-92125555 CACTGTGCCCAGCCTACAATAGG - Intergenic
1057085370 9:92205023-92205045 CACTGTGCCCAGCCTACAATAGG + Intergenic
1057747182 9:97761710-97761732 AACAGTGCCCAGAGCATAGTAGG - Intergenic
1058090056 9:100795657-100795679 CACTGTGCCTAGCCTATAGTTGG + Intergenic
1058716037 9:107722743-107722765 CACTGTGCCCAAGATATGTTTGG - Intergenic
1059226533 9:112678090-112678112 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1060119466 9:120974619-120974641 CTCAGTGCCCAGGATATAGCAGG + Intronic
1060168436 9:121440558-121440580 GACTATTCCCAGGGTATAGACGG + Intergenic
1060224621 9:121783377-121783399 CACTGTGCCCTGGGTGTGCTGGG - Intronic
1062298236 9:135847057-135847079 CACCGTGCCCGGCCTATAGTAGG - Intronic
1202796498 9_KI270719v1_random:124886-124908 CACCATGCCCAGGCTGTAGTGGG - Intergenic
1186284704 X:8031106-8031128 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186284707 X:8031140-8031162 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186362716 X:8859285-8859307 CACTGTGCCCAGCCTATCTTTGG + Intergenic
1188236219 X:27734330-27734352 GACAGTGCCCAGGATCTAGTAGG - Intronic
1188309135 X:28596090-28596112 CATTGTGCACAGCATATAGTAGG + Intronic
1190041350 X:47074829-47074851 CACTGTGCCTGGCCTATAGTAGG + Intergenic
1190337916 X:49273945-49273967 CACTGTGCCCAGCACACAGTAGG - Intronic
1190618288 X:52261335-52261357 CACTGTCCCCAGGTTGTACTGGG - Intergenic
1194675472 X:96788942-96788964 CACAGTGCCACAGGTATAGTAGG + Intronic
1195007889 X:100704668-100704690 AACTGGGCCCAGGAAATAGTTGG + Intronic
1197776863 X:130123944-130123966 CACTGTGCCCAGCCTATTCTAGG - Intergenic
1198205163 X:134459013-134459035 CACAGTGCCCAGCACATAGTTGG - Intergenic
1198398111 X:136243414-136243436 CACTGTGCCCAGCCTATTATAGG - Intronic
1198673991 X:139112308-139112330 CACAGTGCCCAACATATAGTAGG + Intronic
1199313553 X:146349750-146349772 CACGGTGCCTAGGGCATGGTGGG - Intergenic