ID: 1071563086

View in Genome Browser
Species Human (GRCh38)
Location 10:86658135-86658157
Sequence CTCTATAAGCAGTGGCTCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071563078_1071563086 6 Left 1071563078 10:86658106-86658128 CCCAGGCCCCTGTCTTCTTCACC 0: 1
1: 0
2: 3
3: 58
4: 402
Right 1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 110
1071563081_1071563086 -1 Left 1071563081 10:86658113-86658135 CCCTGTCTTCTTCACCAGTAGCC 0: 1
1: 0
2: 0
3: 14
4: 178
Right 1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 110
1071563076_1071563086 20 Left 1071563076 10:86658092-86658114 CCTCATGTCCTTCACCCAGGCCC 0: 1
1: 0
2: 1
3: 50
4: 404
Right 1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 110
1071563079_1071563086 5 Left 1071563079 10:86658107-86658129 CCAGGCCCCTGTCTTCTTCACCA 0: 1
1: 0
2: 2
3: 43
4: 501
Right 1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 110
1071563080_1071563086 0 Left 1071563080 10:86658112-86658134 CCCCTGTCTTCTTCACCAGTAGC 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 110
1071563082_1071563086 -2 Left 1071563082 10:86658114-86658136 CCTGTCTTCTTCACCAGTAGCCT 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 110
1071563077_1071563086 12 Left 1071563077 10:86658100-86658122 CCTTCACCCAGGCCCCTGTCTTC 0: 1
1: 0
2: 7
3: 77
4: 539
Right 1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071563086 Original CRISPR CTCTATAAGCAGTGGCTCTT TGG Exonic
903768184 1:25748089-25748111 CTGTGTAGACAGTGGCTCTTTGG + Intronic
905539157 1:38746512-38746534 CTCCAAAAGCCATGGCTCTTTGG - Intergenic
908098738 1:60768475-60768497 CTCTAGAAGCAGGTGATCTTTGG - Intergenic
910457577 1:87413851-87413873 TTCTTTGAGCAGTGGCTCTCTGG + Intergenic
910775443 1:90870184-90870206 CTCTATAAGGGTTGACTCTTAGG + Intergenic
914314886 1:146500646-146500668 TTCTTTGAGCAGTGGCTCTCTGG + Intergenic
914499466 1:148232741-148232763 TTCTTTGAGCAGTGGCTCTCTGG - Intergenic
917356822 1:174134129-174134151 CTCTAAAAGCAGAACCTCTTAGG + Intergenic
924278789 1:242415261-242415283 CTTTCTAACCAGTGACTCTTGGG - Intronic
1064202196 10:13294264-13294286 CTCTAAGAGCAGTGGTTCCTGGG + Intronic
1066224405 10:33368275-33368297 CTCAATAAGCACTTGCTCTTTGG - Intergenic
1066542743 10:36466834-36466856 CACTTTAAGCATTTGCTCTTTGG - Intergenic
1066552400 10:36573612-36573634 CTTTACAAGCAGGGGCACTTGGG + Intergenic
1070744897 10:78927725-78927747 CCCAGTGAGCAGTGGCTCTTTGG + Intergenic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1071888986 10:89981725-89981747 GTTTAAAAGCAGGGGCTCTTGGG + Intergenic
1074562650 10:114547704-114547726 CTGGATAAGCAGTGGCACTTGGG - Exonic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1078868855 11:15325320-15325342 CCCTAAAAGCTGTGGCTCTTTGG + Intergenic
1079309258 11:19349898-19349920 CTCCATAGGCAGTTGCTTTTCGG + Intergenic
1082013251 11:47465351-47465373 CTCTATGTGGAGTGGGTCTTGGG - Intergenic
1082824162 11:57566093-57566115 CTCTATCATCTGTGACTCTTTGG + Intronic
1084093257 11:66893290-66893312 CTCTGTCAGGAGTGGCTCTTAGG - Intronic
1085426030 11:76405370-76405392 CTCAATAAGCATTAGCTATTTGG + Exonic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1089633918 11:119800340-119800362 CTCAATTAGTGGTGGCTCTTAGG - Intergenic
1091665982 12:2418848-2418870 CTCTACAAGCAGTGGAGCTGGGG - Intronic
1091807738 12:3367754-3367776 CTCTGGAAGCTGTGGCTCTGGGG - Intergenic
1093511553 12:19935390-19935412 CTCAAAATGCCGTGGCTCTTAGG + Intergenic
1106895401 13:34294911-34294933 CTCTGCAAACACTGGCTCTTCGG + Intergenic
1106987994 13:35378445-35378467 CTTTATAAGCAGTGGCTAAGTGG - Intronic
1107046879 13:36002154-36002176 CTATATAAGCACAGGCTTTTTGG + Intronic
1109540569 13:63773761-63773783 ATGTATAAGCAGGAGCTCTTTGG - Intergenic
1109665863 13:65536060-65536082 ATATATAATCAGTGGCTATTGGG + Intergenic
1111775806 13:92659952-92659974 ATATACAAGCAGTGGCTCCTTGG - Intronic
1113600477 13:111564935-111564957 CTCCAATAGCAGAGGCTCTTGGG + Intergenic
1115449855 14:33534814-33534836 CACTCTAAGCAGTGACTCTTGGG + Intronic
1116589391 14:46751526-46751548 CTCTATAAACAGTGACTCCAGGG + Intergenic
1116821488 14:49632314-49632336 CTCTATGAGAAGTGGCTAATTGG - Intronic
1116956876 14:50932991-50933013 CTCTTTGAGCTGTGGCTCTTCGG + Intronic
1122823943 14:104360580-104360602 CCCTATAAGCAGGGGGACTTTGG + Intergenic
1124061143 15:26294610-26294632 CTCTATCAGCACAGGCTTTTGGG - Intergenic
1125404293 15:39336718-39336740 CTCCATGGGCAGTGGCTCTTGGG - Intergenic
1127435873 15:58957665-58957687 CTCTCGAAGCATTGGCTCTATGG - Intronic
1128814358 15:70596600-70596622 CTGTATGAGTAATGGCTCTTTGG + Intergenic
1132189708 15:99842260-99842282 ATATACAAGCAGTGGCTCCTTGG + Intergenic
1133284618 16:4684817-4684839 CTCCCTAAGCAGTGGCTCTGGGG - Intronic
1133696779 16:8271843-8271865 CTCTAGATGCAGTGCCTCTGAGG + Intergenic
1134311900 16:13082799-13082821 TTATTTAAGGAGTGGCTCTTGGG - Intronic
1135304621 16:21357368-21357390 CTCCAACAGCAGTGGCTGTTTGG - Intergenic
1136301364 16:29336495-29336517 CTCCAACAGCAGTGGCTATTTGG - Intergenic
1138738558 16:59280548-59280570 CTATAGCAGAAGTGGCTCTTGGG - Intergenic
1140222039 16:73050654-73050676 CTCTGGAAGCCCTGGCTCTTCGG + Intronic
1142063061 16:88043192-88043214 CTCCAACAGCAGTGGCTGTTTGG - Intronic
1143784725 17:9247780-9247802 CTCTACAAACAGTGTCTCCTTGG - Intergenic
1147040743 17:37716722-37716744 CTCTATGAGCTGTAGCTCTAAGG - Intronic
1151364271 17:73606965-73606987 CTCAAGAAGCATTGGCTCTTGGG - Intronic
1153891292 18:9517957-9517979 CTCTCTAAGCAGAGGCTCAGTGG + Intronic
1158448746 18:57544198-57544220 CTCTATAATCACTGCCTATTTGG - Intergenic
1159729618 18:72009146-72009168 CTCTAGAAGCAGTAGGTCTTTGG + Intergenic
1163005219 19:14393248-14393270 CTCTATCAGCAATGGCTAATGGG + Intronic
1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG + Exonic
925337241 2:3107438-3107460 CTTTATTAGCAGTGGCACTGAGG + Intergenic
927488731 2:23506464-23506486 CTACAGGAGCAGTGGCTCTTGGG - Intronic
928639369 2:33281684-33281706 CTCCATCAGCAGAGACTCTTGGG - Intronic
933171518 2:79130986-79131008 AACTATAGGCAGTGGCTCATGGG + Intergenic
937479603 2:122244466-122244488 CTCCATAAGCTTTGGCTCTGGGG + Intergenic
946055273 2:216895675-216895697 TTCTCTAAGCAGTGGCCCATTGG - Intergenic
948631249 2:239304006-239304028 CTTTATAAGCTGTGGCTCACAGG - Intronic
1170298596 20:14856952-14856974 CTTTACAAGCAGTGGCACTCAGG - Intronic
1176058652 20:63162106-63162128 CTCTATCAGCACGGGCTCTCTGG - Intergenic
1181444005 22:22954633-22954655 CTGTGGATGCAGTGGCTCTTGGG + Intergenic
1183321693 22:37168853-37168875 CTATATAAGCAGTGCCCCTCTGG - Intronic
1183818488 22:40324071-40324093 CTTTAGTAGCAGTGGCTCTCCGG - Exonic
1184036169 22:41919414-41919436 CCCAAGAAGCAGAGGCTCTTGGG + Intergenic
950632350 3:14290933-14290955 CTCTGGAGGCAGTGGCTCCTTGG - Intergenic
950678798 3:14570757-14570779 CGGTAAAAGCAGTGCCTCTTGGG - Intergenic
953657554 3:44865534-44865556 CTCTAGAAGCAGTGACTGGTGGG + Exonic
955250946 3:57281590-57281612 CTCAATAAGCAGAGGCTTATTGG - Intronic
955355346 3:58226505-58226527 CTCTTGAAACAGTGTCTCTTGGG + Intergenic
962327832 3:134450439-134450461 CTGTAAAAGCAGTGGAGCTTGGG - Intergenic
962494581 3:135926437-135926459 CCCTATAAGCCATGGCTCTTTGG + Intergenic
963052882 3:141157697-141157719 CTCCATAAGAAGGAGCTCTTAGG + Intergenic
964481042 3:157138610-157138632 CTGTATAACCAGAAGCTCTTGGG - Intergenic
967237290 3:187398031-187398053 CTTTATAAGCATTGTCACTTTGG - Intergenic
967256752 3:187601046-187601068 TTCTATTAGCAGTGGGGCTTGGG + Intergenic
971090810 4:23343115-23343137 CTCGATAGGCAGTTCCTCTTTGG - Intergenic
971141715 4:23931787-23931809 CTCAATAATCAGTAGCTCATGGG + Intergenic
973105665 4:46333808-46333830 CTCTACTAGCTGTGGGTCTTTGG - Intronic
973607077 4:52598775-52598797 CTTTATAAGCAGTGATTCTCTGG + Intronic
976037266 4:80839002-80839024 CTAAATAAGCAGTGTGTCTTTGG - Intronic
977468813 4:97415742-97415764 CTCTTTAAGAAGAGGCTATTTGG - Intronic
978121075 4:105079969-105079991 GTCTATAAGCATTGGCCCTAAGG + Intergenic
980490984 4:133528380-133528402 CCCTATAAAGAGTAGCTCTTTGG - Intergenic
986165957 5:5271594-5271616 ATCTAAATGGAGTGGCTCTTCGG + Intronic
989350787 5:40484089-40484111 CTCTTTAATCAGTGACTCTTAGG - Intergenic
989757028 5:44967830-44967852 TTCCAGAAGCAGTGGATCTTTGG - Intergenic
993112063 5:83669751-83669773 CTGGATAAGTATTGGCTCTTGGG + Intronic
994305222 5:98195080-98195102 CTCTCTAAGCACTGGGTCTCTGG - Intergenic
995979294 5:118082045-118082067 TTCTACAAACATTGGCTCTTAGG - Intergenic
999708085 5:154292279-154292301 CTCTAGAAGCAGAAGCTCTGGGG - Intronic
1000217211 5:159172167-159172189 CTCTATATGCAGTTACTTTTTGG + Intronic
1000473650 5:161677846-161677868 CTCTTTAAGAAGTGTCTTTTTGG + Intronic
1001325571 5:170721284-170721306 CTCAATAAACAGTGGCTCAGTGG - Intronic
1003209894 6:4053247-4053269 CTCCCTAAGCTGTGGCTCCTGGG + Intronic
1005222689 6:23606103-23606125 CTTTATAACAACTGGCTCTTGGG + Intergenic
1005245537 6:23880217-23880239 GTATATAATCAGTGGCTCTATGG - Intergenic
1007174241 6:39885342-39885364 CTCTTTGAGCACTGGCTCCTGGG + Intronic
1013022935 6:106237765-106237787 CTATATAAGCAGTGATTATTTGG - Intronic
1019050960 6:169183276-169183298 CTCTGCAAGGAGTTGCTCTTTGG - Intergenic
1019388708 7:773511-773533 CTCTCTGAGCTGTGGCCCTTGGG + Intronic
1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG + Intergenic
1026340765 7:69432079-69432101 CCCTATTTGCAGCGGCTCTTTGG - Intergenic
1026651966 7:72223508-72223530 CTTTTTAAGCAGTGGCTGCTGGG - Intronic
1029434737 7:100556656-100556678 CTCTATGATCAGAGGCACTTGGG - Intronic
1031320460 7:120320296-120320318 TTCTATAAGAAGTGTCACTTTGG + Intronic
1032119836 7:129147817-129147839 CTCTAGAAGCCCTGACTCTTGGG + Intronic
1035554593 8:556786-556808 CTCTGTAAGCATTGGCTCTTTGG + Intergenic
1039148982 8:34481712-34481734 CTCTATAGGCAGGAGCTTTTAGG - Intergenic
1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG + Intergenic
1046966050 8:120166952-120166974 CTTGATAAGCATTGGCACTTTGG - Intronic
1051525857 9:18043575-18043597 CTCCATAAGCACAGGCTCTGGGG - Intergenic
1051950479 9:22625322-22625344 ATCTATCAGCAGGGACTCTTCGG + Intergenic
1055804970 9:80082444-80082466 TTCTAAAAGCAGTGGCTGTAAGG - Intergenic
1059426611 9:114225134-114225156 CGCTATTTGCAGTGTCTCTTAGG + Intronic
1187102784 X:16212286-16212308 CTGAAGATGCAGTGGCTCTTTGG + Intergenic
1189318234 X:40070777-40070799 CTCTAGAACCAGTGCTTCTTTGG + Intronic
1199725102 X:150572346-150572368 TTGTATAAGCAGTTGCTATTTGG + Intronic