ID: 1071564942

View in Genome Browser
Species Human (GRCh38)
Location 10:86666926-86666948
Sequence TCCTCCCCAGCCTGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071564937_1071564942 4 Left 1071564937 10:86666899-86666921 CCACACTGGTTATGCCCTGCTGC No data
Right 1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG No data
1071564936_1071564942 5 Left 1071564936 10:86666898-86666920 CCCACACTGGTTATGCCCTGCTG No data
Right 1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG No data
1071564931_1071564942 30 Left 1071564931 10:86666873-86666895 CCCTGAGGGTGGGTGCCTTCCTT No data
Right 1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG No data
1071564938_1071564942 -10 Left 1071564938 10:86666913-86666935 CCCTGCTGCTGAGTCCTCCCCAG No data
Right 1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG No data
1071564935_1071564942 11 Left 1071564935 10:86666892-86666914 CCTTCTCCCACACTGGTTATGCC No data
Right 1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG No data
1071564932_1071564942 29 Left 1071564932 10:86666874-86666896 CCTGAGGGTGGGTGCCTTCCTTC No data
Right 1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG No data
1071564934_1071564942 15 Left 1071564934 10:86666888-86666910 CCTTCCTTCTCCCACACTGGTTA No data
Right 1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071564942 Original CRISPR TCCTCCCCAGCCTGGCAGGA TGG Intergenic