ID: 1071566212

View in Genome Browser
Species Human (GRCh38)
Location 10:86672704-86672726
Sequence CAGCCCGGAGGACCTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071566212_1071566218 5 Left 1071566212 10:86672704-86672726 CCCAGGCCAGGTCCTCCGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1071566218 10:86672732-86672754 AACTGCATCTAACTCTGTGAGGG No data
1071566212_1071566219 15 Left 1071566212 10:86672704-86672726 CCCAGGCCAGGTCCTCCGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1071566219 10:86672742-86672764 AACTCTGTGAGGGATCCAAAAGG No data
1071566212_1071566220 20 Left 1071566212 10:86672704-86672726 CCCAGGCCAGGTCCTCCGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1071566220 10:86672747-86672769 TGTGAGGGATCCAAAAGGAGAGG No data
1071566212_1071566217 4 Left 1071566212 10:86672704-86672726 CCCAGGCCAGGTCCTCCGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1071566217 10:86672731-86672753 GAACTGCATCTAACTCTGTGAGG No data
1071566212_1071566221 28 Left 1071566212 10:86672704-86672726 CCCAGGCCAGGTCCTCCGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1071566221 10:86672755-86672777 ATCCAAAAGGAGAGGACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071566212 Original CRISPR CAGCCCGGAGGACCTGGCCT GGG (reversed) Intronic
900345117 1:2206875-2206897 CAGGCAGGAGGCCGTGGCCTGGG - Intronic
900429133 1:2593681-2593703 GCTCCCTGAGGACCTGGCCTCGG + Intronic
900433019 1:2611799-2611821 CTGCCTGGAGGAGCTGGCCCTGG - Intronic
900537508 1:3186183-3186205 CAGCGCGGAGGACGAGGCCGAGG + Exonic
900999841 1:6143435-6143457 GAACACGGAGGGCCTGGCCTGGG - Intronic
901405011 1:9039690-9039712 CTGCCCGGAGGAGGCGGCCTCGG + Intronic
901657919 1:10781221-10781243 CTGCCTGGAGGGGCTGGCCTGGG - Intronic
902078179 1:13803707-13803729 CGGCCCGGAGAACCTGCCCGCGG - Intronic
902911054 1:19597334-19597356 CAGCCCGGAGGAGGTGGTCGGGG + Intronic
903586486 1:24419510-24419532 CATCCCACAGGGCCTGGCCTAGG - Exonic
903692416 1:25183873-25183895 CAGCCCCGCGGACCTGCCCATGG + Intergenic
903907346 1:26696312-26696334 CAGCCCGGGGGACTGGGCCCCGG + Exonic
904673132 1:32180589-32180611 CCTCCCGGACAACCTGGCCTCGG - Intronic
906154503 1:43606168-43606190 CAGCCCTGAGGCTGTGGCCTGGG - Intronic
906531115 1:46524645-46524667 CAGCCAGGAGGACCCAGCATGGG - Intergenic
907518912 1:55010578-55010600 GAGGCCGGGGGTCCTGGCCTAGG + Exonic
907559440 1:55375234-55375256 CAGCCCTAAGGCCCTTGCCTAGG + Intergenic
908561278 1:65309416-65309438 CAGCCAGGAGGTGCTGGCCTGGG + Intronic
911027360 1:93448763-93448785 TAGCCCCGCGGACCTGGCCCGGG - Intronic
911451545 1:98068056-98068078 CAGCTAGGAGTAGCTGGCCTGGG + Intergenic
915902139 1:159854878-159854900 CGGCCCCGAGGACGTGGCCCTGG - Exonic
917729052 1:177855948-177855970 CAGCATGGAGGACCAGCCCTGGG + Intergenic
918050532 1:180969135-180969157 CAAGCCGGGTGACCTGGCCTGGG - Intergenic
918061025 1:181061322-181061344 CAAGCCGGGTGACCTGGCCTGGG - Exonic
918185857 1:182127227-182127249 CAGCCTGGAGGAACAGGGCTAGG + Intergenic
920313987 1:205065018-205065040 CTGCCCTGCGGACCCGGCCTGGG + Intronic
920445738 1:206014849-206014871 CAGCACTCAGGACCAGGCCTAGG - Intronic
921387595 1:214586603-214586625 CATCCCAGAGGGTCTGGCCTTGG + Intergenic
922211843 1:223492255-223492277 CAGCCTGGAGCTCCTGGCCTGGG + Intergenic
923079435 1:230639943-230639965 CTGCCCAGAGGACATGGCCCTGG - Intergenic
923361785 1:233219006-233219028 CAGTGCAGAGGACCTGCCCTGGG + Intronic
1065293195 10:24251448-24251470 CAGATCAGAGGCCCTGGCCTGGG + Intronic
1066484831 10:35833343-35833365 AAGCCAGGAGGTCCTGGCCAGGG - Intergenic
1069422584 10:68260540-68260562 CAGCCCATTGGACCTGGCCAGGG - Intergenic
1069828842 10:71270589-71270611 CAGGCGGGAAGACCTGGGCTTGG + Intronic
1070600294 10:77861545-77861567 CAGCCATGAGGACCTGGGCGTGG + Intronic
1071452527 10:85810723-85810745 CAGCCTGGTGGACCTGCCCCAGG + Intronic
1071566212 10:86672704-86672726 CAGCCCGGAGGACCTGGCCTGGG - Intronic
1072744658 10:97931759-97931781 CCGCCCGCATGAGCTGGCCTGGG - Intronic
1073123202 10:101134269-101134291 CCGCCAGAAGTACCTGGCCTCGG + Exonic
1073176473 10:101560365-101560387 CACCCCAAAGGACCTGGCCAGGG + Intergenic
1074377912 10:112953317-112953339 CAGCCTGGTGGAACTGGCCCTGG - Intronic
1074556125 10:114492067-114492089 CAGCCACGAGTAGCTGGCCTTGG - Intronic
1075103890 10:119524553-119524575 CAGCACCGAGGACAGGGCCTGGG - Intronic
1075787048 10:125057065-125057087 CTGCCCCCAGGACCTGGCATGGG - Intronic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1076116589 10:127905898-127905920 CAGCCAGGAGGAGCTGAGCTTGG + Intergenic
1076427714 10:130379474-130379496 CAGCCTGCAGGCCCTGGCCAGGG - Intergenic
1076657755 10:132036168-132036190 CAGCCCGGAGCACGCGGCCGTGG + Intergenic
1076821609 10:132942560-132942582 CAGCCGCGAGGACCCGGCCACGG + Exonic
1077107515 11:848499-848521 CACCCCTGACGACCTGGGCTGGG - Intronic
1077178836 11:1203319-1203341 CAGCCTGGAGGGCTTGGGCTGGG + Intergenic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1077390808 11:2299992-2300014 CAGCCCCAAGGAGCTGGCCCAGG - Intronic
1079005955 11:16791136-16791158 CAGCCCAGAGGACCAGCCCCCGG - Exonic
1079710911 11:23680778-23680800 CATTCCGGAGGGCCAGGCCTGGG - Intergenic
1083227479 11:61294268-61294290 CCCCCCGGAGGACGTGGCCGCGG + Intronic
1083323726 11:61862962-61862984 TTCCCCGCAGGACCTGGCCTGGG + Exonic
1083485724 11:62981924-62981946 CAGCCAGGAGGAACTGGCCCAGG + Exonic
1083746006 11:64736809-64736831 CATCCTGGAGGAGCTGGCCATGG - Exonic
1083829280 11:65221060-65221082 CAGCCAGGATGAGCTGGCCCAGG - Intergenic
1083955787 11:65982180-65982202 GAGCCTGGAGGACCTGGGCAGGG - Intergenic
1084689094 11:70714683-70714705 GAGCCAGGAGGACCTGGGTTTGG - Intronic
1084712613 11:70853256-70853278 CAGCCAGGTGGACCTGGACCAGG + Intronic
1084785234 11:71438180-71438202 AAGCCCTGAGAACCTGGGCTGGG - Intronic
1084889626 11:72230303-72230325 CAGGGCGGAGCCCCTGGCCTAGG + Intronic
1089951769 11:122534727-122534749 CAGTCCAGAGGCCCTGGCCCTGG + Intergenic
1090412279 11:126517545-126517567 CAGCCCTGGGGTCCTGGCCTTGG - Intronic
1090660713 11:128879972-128879994 CAGCACAGAAGGCCTGGCCTAGG + Intergenic
1091083490 11:132695650-132695672 CAGCCAGCAGGACCTGAACTTGG + Intronic
1096529590 12:52234372-52234394 CAGCCCTGAGTTCCTGGCTTTGG - Intronic
1097732921 12:63150536-63150558 CAGCCTGGCCGACCTGGCCGTGG - Exonic
1101753406 12:107601976-107601998 CACCCCTGAGGATCTGGGCTCGG - Intronic
1101879647 12:108617513-108617535 CAGCCCTGCTGACCTGCCCTGGG - Intergenic
1102261590 12:111446499-111446521 CAGCCCATTGGACCTGGACTTGG - Intronic
1102688461 12:114742236-114742258 CAGCCCGCAGCACCTGGCAAGGG - Intergenic
1104728828 12:131094100-131094122 CAGCCCTGAGCACCCAGCCTCGG + Intronic
1104861684 12:131927511-131927533 AAGCCAGGGGGACCAGGCCTTGG + Intergenic
1104919568 12:132283516-132283538 CAGCCCTGCTCACCTGGCCTTGG + Intronic
1105000368 12:132686900-132686922 CACCCCGCAGGGCCTGGCCCGGG + Intronic
1105306012 13:19169730-19169752 CAGCCAGGAGGCCCTGGATTAGG + Intergenic
1105356641 13:19665035-19665057 CAGCCCTGAGGTGCTGACCTGGG - Intronic
1105917284 13:24928262-24928284 TAGCCCGGATCACCTGGGCTTGG - Intergenic
1108253741 13:48591219-48591241 CAGCCCTGAGGAGCTGCCCAAGG - Intergenic
1112558452 13:100490884-100490906 GGGCCCTGAGCACCTGGCCTCGG - Intronic
1117194769 14:53328897-53328919 CAGCCCCGGGGAGCTGACCTGGG + Intergenic
1117307186 14:54488628-54488650 CAACCAGAAGGACCTGGCGTGGG + Intronic
1118318930 14:64742142-64742164 CAGCCCGGCCCACCTGGCCCGGG + Exonic
1119031217 14:71194132-71194154 CAGCCATTAGGACCTGGCCTCGG - Intergenic
1119765765 14:77186730-77186752 CATCCCTGAGGACCTGGCAGAGG + Intronic
1121287584 14:92748423-92748445 CAGACGGGAGGCCCTGGCCTCGG + Intronic
1122262345 14:100530669-100530691 GAGCCTGGAGGAGCTGGGCTGGG + Intergenic
1122266666 14:100549931-100549953 CAGCCTGGAGGGCGTGGCCCTGG - Intronic
1122969981 14:105148559-105148581 CGGGCCGGGGGAGCTGGCCTCGG + Intronic
1123024514 14:105418482-105418504 CAGCCCGCAGGATGTGTCCTGGG + Intronic
1123041816 14:105493340-105493362 CACCCCGTCGGGCCTGGCCTTGG + Intronic
1202854485 14_GL000225v1_random:42358-42380 CAGCAGGGAGAAACTGGCCTGGG - Intergenic
1125698485 15:41659942-41659964 CACCCCGGAGTACCGGGGCTTGG - Intronic
1127734368 15:61828009-61828031 CCACCCTGAGGACGTGGCCTTGG + Intergenic
1130305519 15:82710115-82710137 CACCCCCGACCACCTGGCCTCGG + Intergenic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1132669423 16:1096563-1096585 CAGCATGGAGGCCCTGGTCTGGG - Intergenic
1132813881 16:1816898-1816920 CATCCGGGAGAAGCTGGCCTGGG - Exonic
1132870566 16:2114026-2114048 CAGCCAGCAGGACCTGCCCGGGG + Intronic
1132985176 16:2762354-2762376 CAGCCCGGAGGGGCAGGTCTCGG + Exonic
1132995028 16:2818322-2818344 CGGCCCGGGGGTGCTGGCCTTGG - Intronic
1133589360 16:7227728-7227750 CTGCACGCAGCACCTGGCCTAGG + Intronic
1133896850 16:9937997-9938019 CTGCCCGTAGCAGCTGGCCTTGG + Exonic
1134521966 16:14922878-14922900 CAGCCAGCAGGACCTGCCCGGGG - Intronic
1134709636 16:16321529-16321551 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134716849 16:16361558-16361580 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134949967 16:18347116-18347138 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1134957903 16:18390601-18390623 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1135420874 16:22304780-22304802 CAGCCAGGAGGCACAGGCCTAGG + Intronic
1135915739 16:26604046-26604068 CAGGCAGGAGGCCCTGCCCTGGG + Intergenic
1137549095 16:49424609-49424631 CACCCCTGACGACCTGGGCTGGG - Intergenic
1138396051 16:56705555-56705577 CAGCAGGGAGGGCCTGCCCTGGG + Intronic
1139354870 16:66361422-66361444 GTGCCCGGAGGAGGTGGCCTGGG - Intergenic
1140872473 16:79120015-79120037 CAGCCCAGTGGCCGTGGCCTGGG + Intronic
1141673407 16:85504828-85504850 CAGGCCGGTGGCTCTGGCCTTGG + Intergenic
1142639689 17:1278937-1278959 CTGCCCGGAGCAGCTGACCTAGG + Intergenic
1143016105 17:3892134-3892156 CAGGCCACAGGACCGGGCCTTGG - Intronic
1143034899 17:3989207-3989229 CAGCCCAGGGCAGCTGGCCTCGG + Intergenic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1145882882 17:28364824-28364846 CACCCATGAGCACCTGGCCTGGG - Exonic
1146451974 17:32981766-32981788 CAGCAGGGAGGCCCTGGCCCTGG + Intronic
1148323273 17:46770071-46770093 CAGCACTCAGGACCCGGCCTGGG + Intronic
1148432109 17:47650510-47650532 CCTCCCGGAGGCCCAGGCCTCGG + Intronic
1148695271 17:49555012-49555034 CGGCCCGGAGCACCTGGCTGGGG + Intergenic
1148784540 17:50139630-50139652 CAGCCCTGATGACCAGGGCTGGG + Intronic
1149553580 17:57557576-57557598 CAGCCCAGAGAACCTGTCCCTGG - Intronic
1149756492 17:59190807-59190829 CAGCCAAGAGAACTTGGCCTGGG + Intronic
1150791782 17:68205359-68205381 GAGCCCGGAGCGCCTGGGCTCGG - Intergenic
1151493701 17:74447066-74447088 GGGCCCTGAGGACCTGGCCCCGG + Exonic
1151819794 17:76491291-76491313 CAGCTGGGATGGCCTGGCCTTGG - Intronic
1151826741 17:76527968-76527990 CAGCGCAGAGGACCTGGGCCTGG - Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152362878 17:79840489-79840511 CAGTCCGGAGGGCCTTGGCTTGG - Intergenic
1152381164 17:79942930-79942952 CAGCCGTCAGGACCTGGCGTGGG - Intronic
1152635776 17:81429967-81429989 CCGCCCGGAACATCTGGCCTGGG + Intronic
1152704273 17:81834689-81834711 CAGCAAGGAGGACCTGACCTGGG - Intronic
1152738493 17:82008875-82008897 CTGCCCCCAGGACCTGGCCTTGG + Intronic
1152876940 17:82791858-82791880 CAGGCCGCACCACCTGGCCTGGG - Intronic
1153421950 18:4916801-4916823 CAGCAGTGAGGACCTGGGCTTGG + Intergenic
1155847473 18:30727633-30727655 CAGCCTGGAGGGCCTGACATTGG - Intergenic
1156148503 18:34215616-34215638 CAGCTCGGAGGACCTCGGATGGG + Intronic
1161063561 19:2226981-2227003 CAGCACGGAGGAGCCGGCCACGG - Exonic
1161238016 19:3207507-3207529 CCGCCGGGAGGAGCTGGGCTGGG + Intronic
1161825766 19:6563886-6563908 AAGCCCAGCTGACCTGGCCTTGG - Intergenic
1161984130 19:7644604-7644626 ATGCCCGCAGGACCTGGCCATGG + Exonic
1162438594 19:10679092-10679114 CAGCCCGTTGGCTCTGGCCTAGG - Exonic
1163159774 19:15457666-15457688 CGGCCCAGAAGAGCTGGCCTGGG + Exonic
1163416158 19:17187712-17187734 CAGCCAGGAGCACCTGGACAAGG - Intronic
1163820139 19:19491848-19491870 CAGCCCGCAGCCCCTGGCCATGG - Intronic
1163831849 19:19550760-19550782 CAGCCGGGAGGAACTGGGGTGGG - Intergenic
1164417641 19:28059855-28059877 CAGCCATGAACACCTGGCCTGGG + Intergenic
1165045947 19:33105087-33105109 GAGCCAAGAGGACCTGGCCCAGG - Intronic
1165092863 19:33395854-33395876 CAGCCCTCAGGGCCTGCCCTGGG - Intronic
1166888407 19:45974881-45974903 CAGCCTGCAGCACCTGCCCTGGG + Intergenic
1167502519 19:49855970-49855992 CTGCCCAGAGGACCTGGCTCTGG + Intronic
925168671 2:1737056-1737078 CAGCCCGGAGCACCAGGGCAGGG - Intronic
925196548 2:1930553-1930575 CTGCCCGCAGGACCTGGGCAAGG - Intronic
925740000 2:6996837-6996859 CAGCCAGGAGAACCTTGCCACGG + Intronic
927471920 2:23384031-23384053 CAGCTGGGAGGAGCTGGCCTGGG - Intergenic
927705736 2:25295287-25295309 CAGCCCGCAGGCCCTGGCCCAGG + Intronic
928611195 2:32993904-32993926 GAGCCCAGAGGTCCCGGCCTGGG - Intronic
932418262 2:71586601-71586623 CAGGCAGGAGGCCCTGCCCTTGG + Intronic
932708629 2:74046632-74046654 CAGCCCTCAGGCCCTGGCCGGGG - Exonic
933809935 2:86026908-86026930 CAGCCGGAAGGAGCAGGCCTTGG + Exonic
935713234 2:105917583-105917605 CTGCAGAGAGGACCTGGCCTGGG - Intergenic
935792966 2:106611058-106611080 TAGCCCGGAGGAACCCGCCTGGG - Intergenic
936066617 2:109337384-109337406 CACACAGGAGGACCTAGCCTTGG - Intronic
936068729 2:109351237-109351259 CACCCGGGAGGGGCTGGCCTTGG + Intronic
936122806 2:109760845-109760867 CCGCCCGGAGCACCCGGCCCAGG - Intergenic
937126009 2:119475428-119475450 CAGCTCTGGGCACCTGGCCTGGG - Intronic
937984551 2:127632689-127632711 CAGCCTTGAGGGCCTGGGCTGGG - Intronic
944465171 2:199993510-199993532 CAGCCCAGATGACCTGGGCTTGG - Intronic
945566065 2:211401476-211401498 CAGCACGGAGGACTTCTCCTTGG - Intronic
946984741 2:225258540-225258562 CAGCCCAAGGGACCTGACCTAGG - Intergenic
947391775 2:229646737-229646759 GGACCCTGAGGACCTGGCCTAGG - Intronic
947586611 2:231360632-231360654 GAGCCCGCAGGGCCTGGCCTGGG + Intronic
948062140 2:235049928-235049950 CAGCAGGGAGGACCTGGGGTTGG + Intronic
948317850 2:237043037-237043059 CAGCCCTGCAGACCTGGCTTTGG + Intergenic
948586987 2:239025824-239025846 CCCCCGGGACGACCTGGCCTGGG - Intergenic
948807715 2:240460138-240460160 CAGCCCTGTGGAAATGGCCTTGG - Intronic
948912725 2:241012415-241012437 CAGGCCGGAGGGGCTGCCCTGGG - Intronic
949031434 2:241799200-241799222 CAGCCCCGAGGACAGAGCCTGGG + Intronic
1174309667 20:49642127-49642149 CAGCACAGAGGATGTGGCCTTGG - Intronic
1174358354 20:50012975-50012997 CAGCCAGGTGGACCTGCCCTGGG + Intergenic
1175155471 20:56968187-56968209 CCGCCCCCAGGACCTGTCCTGGG - Intergenic
1175220156 20:57412117-57412139 CAGGCAAGAGGACCAGGCCTGGG + Intergenic
1175440612 20:58988426-58988448 CAGCCTCGGGGAGCTGGCCTTGG + Intronic
1175492751 20:59390156-59390178 AAGCCCTGAGGATCTGGGCTGGG - Intergenic
1175839046 20:62015075-62015097 CAGCCCAGCGGACGTGGCCCTGG - Intronic
1175908612 20:62393987-62394009 CAGCCCTGAGAACGTGGCCCTGG - Intronic
1175946172 20:62559793-62559815 CATCCCTGAGGTCCTGGCTTAGG + Intronic
1175999457 20:62825461-62825483 CAGGCCGGGGGACCAGGTCTGGG + Intronic
1176077573 20:63255197-63255219 CAGACCCCAGGACCTGCCCTGGG - Intronic
1179529921 21:42011073-42011095 GAGCCCGGACGCCCTGGCCGCGG - Intergenic
1179640601 21:42745208-42745230 AAGCCCCGGGGGCCTGGCCTCGG + Intronic
1180057631 21:45367108-45367130 GAGCCAGGAGGACCAGGCCTGGG - Intergenic
1180954847 22:19737007-19737029 CACCCCTGAGGACCTGCCCAGGG + Intergenic
1181027276 22:20133274-20133296 CAGCCTGGGGAGCCTGGCCTGGG + Intronic
1181745457 22:24952708-24952730 CAGCCCGCGGCACCTGCCCTGGG - Intronic
1181779239 22:25180954-25180976 CAGCCTGGAGGAGCCGGCCAGGG + Intronic
1182318571 22:29463842-29463864 CAGGGCTGGGGACCTGGCCTGGG - Intergenic
1182480441 22:30605490-30605512 CAGCCTGGAGGAGGTGGCCATGG - Intronic
1182765277 22:32753753-32753775 AGGCCTGGAGGGCCTGGCCTGGG - Intronic
1182765296 22:32753815-32753837 AGGCCTGGAGGGCCTGGCCTGGG - Intronic
1182836712 22:33348091-33348113 TAGCCAGGAGGACCTGCCCTTGG - Intronic
1184094993 22:42311625-42311647 CAGCTGGGAGGGCCAGGCCTGGG - Intronic
1184179094 22:42807301-42807323 TGTCCCGCAGGACCTGGCCTTGG - Intronic
1184747601 22:46465254-46465276 AGGCCTGGAGGACCTGGACTTGG - Intronic
1184848294 22:47102422-47102444 CAGCCCTGGGCACCTGGCCTTGG - Intronic
1184938222 22:47740411-47740433 CAGCCAGGAGGCACTGGGCTGGG - Intergenic
1185199117 22:49491261-49491283 CAGCCTGGAGGAGCTGGGCCTGG - Intronic
1185214538 22:49590936-49590958 CAGCCAGGAGCACGTGGCGTGGG - Intronic
1185228056 22:49664364-49664386 ATGCCAGGAGGACCTGGCCAGGG - Intergenic
1185245694 22:49771632-49771654 CTGCCCCGGGGCCCTGGCCTTGG - Intergenic
1185335553 22:50269630-50269652 GGGGCCAGAGGACCTGGCCTGGG - Intronic
951981848 3:28575512-28575534 CAGCCCGGAGGGACTGACCCCGG + Intergenic
953813302 3:46132762-46132784 CAGGCCGTAAGACCTGGGCTCGG - Intergenic
954633758 3:52060473-52060495 CAGCCTGGTGGAGCTGGTCTGGG - Intergenic
954809674 3:53240294-53240316 CGGCCCCGAGGCCCTGGCCCAGG + Exonic
956748653 3:72329384-72329406 GAGCCCGGAGCACCAGGCCTGGG + Intergenic
960024371 3:112991218-112991240 AAGCCCGGAGGACATAGCCAGGG + Exonic
960442487 3:117706187-117706209 CAGCCAGGAGGACATGCCCTGGG - Intergenic
961448111 3:126990557-126990579 AAGCCCAGAAGGCCTGGCCTCGG - Intronic
962209676 3:133466914-133466936 CAGCCTGGAGGCTCTGGACTTGG - Exonic
962806907 3:138934195-138934217 CAGCCCTGAGGACCTGGATCCGG + Intergenic
966818099 3:183905553-183905575 CAACCAGGAGAACCTGGTCTAGG - Intergenic
968433408 4:572757-572779 CAGCCAGGTGGACCTGCCCGGGG - Intergenic
968471260 4:783439-783461 CATCCAGGAGGGCCCGGCCTGGG + Intergenic
968521814 4:1037611-1037633 CAGCCCTGAGGCCCGGGCCGCGG + Intergenic
968531292 4:1093157-1093179 CAGGCCTCAGGACCTGCCCTGGG - Intronic
968963716 4:3758879-3758901 CAGCCCTGGGTACCTGGCTTGGG - Intergenic
969277652 4:6147726-6147748 CTGCCCAGAGGGCCCGGCCTGGG + Intronic
969498251 4:7538468-7538490 CGGCCCAGAGGAGCTGGCCCAGG + Intronic
970400239 4:15710249-15710271 CAGGCCACAGTACCTGGCCTTGG + Intronic
975321152 4:73011454-73011476 CACCCCTGAGCACCTGGCCATGG + Intergenic
976695057 4:87910307-87910329 CAGCCAGAAGGAGCTGGCCTTGG - Intergenic
979523724 4:121696717-121696739 CAGCCCGGAGGGCCCCGCCACGG + Intronic
979546877 4:121950308-121950330 CATCCCGGAGGTCTCGGCCTCGG + Intronic
981946484 4:150350714-150350736 CAGCACTGAGGACCAGGACTGGG + Intronic
985599547 5:819588-819610 CAGCCGGGAGTTCCTGGCCTTGG + Exonic
985618412 5:938400-938422 CAGCCCAGTGGCCCTGGCTTTGG + Intergenic
985678463 5:1244118-1244140 CAGCCAGGCAGACCTGCCCTCGG - Intronic
985778268 5:1856775-1856797 CAGCCCGGGGGTGCCGGCCTGGG - Intergenic
986261988 5:6155572-6155594 CAGCCTGGCTGGCCTGGCCTTGG + Intergenic
991351149 5:65721976-65721998 CAGCCCCGAGGACCAGGGGTCGG - Exonic
992005747 5:72475848-72475870 CAGCCCGTAAAATCTGGCCTCGG + Intronic
993720021 5:91313276-91313298 CTGCCCAGAAGAGCTGGCCTTGG - Intergenic
996329172 5:122311400-122311422 CACCCCTGAGGACGTGGCCAAGG - Intronic
997748537 5:136321351-136321373 CAGTCAGGAGGACCTGGAATTGG + Intronic
998467315 5:142356695-142356717 AAGCCCGGCGGAGCTGCCCTGGG + Intergenic
1001217744 5:169871723-169871745 CATCCAGGAGCACCAGGCCTTGG - Intronic
1001441264 5:171744751-171744773 TAGCCCCAAGGACCAGGCCTAGG - Intergenic
1002088830 5:176792789-176792811 AAGCCGGGAGGAGCTGCCCTGGG + Intergenic
1002169518 5:177367330-177367352 CAGCCCCAAGGACCCGGCCTGGG + Intronic
1002567684 5:180120844-180120866 CTGGCCGGTGGATCTGGCCTGGG + Intronic
1006981971 6:38154315-38154337 GAGCCCAGGGGAGCTGGCCTGGG + Exonic
1007381346 6:41492306-41492328 CAGCCAGGAGGTCCTGGACAAGG + Intergenic
1016992014 6:149936841-149936863 CTTCTCGGAGGACCTGGACTAGG - Intergenic
1017811961 6:157990026-157990048 CAGCCCACAGGACCTGGCCGGGG - Intronic
1018651921 6:165999292-165999314 CAGCCCGGCGGACCTTGGCCTGG - Intergenic
1019524314 7:1473940-1473962 CAGCACGGAGGGTCTGGGCTGGG + Intronic
1019542993 7:1559821-1559843 CAGCCAGGAGGAGCAGGCCCTGG + Intronic
1019700726 7:2474074-2474096 CAGCCAGGAGGGGCAGGCCTGGG + Intergenic
1020136803 7:5592408-5592430 CTGCCTGGAGGAGGTGGCCTTGG - Intergenic
1022711504 7:32855058-32855080 CAGGCCGGAGTTCCAGGCCTGGG + Intergenic
1023054227 7:36278811-36278833 CAGCCAGGAGCATCTGGCCAGGG + Intronic
1023951241 7:44847901-44847923 GAGCGCGGAGGCCCTGGCGTCGG - Intronic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1023990501 7:45125699-45125721 CTCCTCGGAGGAGCTGGCCTCGG + Intergenic
1025032925 7:55572172-55572194 CGCCCCAGAGGACCTTGCCTGGG - Intronic
1026403890 7:70044194-70044216 CAGCCTGGAGGACCTGCACCTGG - Intronic
1026745273 7:73006350-73006372 CACCCCGAAGGAGCTTGCCTCGG - Intergenic
1026873092 7:73865136-73865158 CAGCCCAGAGAGCCTGGCCCAGG - Exonic
1027031381 7:74891023-74891045 CACCCCGAAGGAGCTTGCCTCGG - Intergenic
1027098469 7:75358746-75358768 CACCCCGAAGGAGCTTGCCTCGG + Intergenic
1029399578 7:100335639-100335661 CACCCCGAAGGAGCTTGCCTCGG + Intergenic
1029446302 7:100614802-100614824 CTCCCTGGAGGACCTGGGCTGGG + Intronic
1034275971 7:149824022-149824044 CCCCCCGGAGGTCCTGGACTGGG + Intergenic
1034383661 7:150720460-150720482 CAGGAAGGAGGACCTGGCCGGGG + Exonic
1034440046 7:151081711-151081733 CAGCCCGGAGGGGCCGGGCTCGG + Exonic
1035021202 7:155801496-155801518 AAGCCCAGAGGAGGTGGCCTGGG - Exonic
1035131338 7:156656862-156656884 CAGCCCGCAGGGCCTGGCGCTGG + Intronic
1035171726 7:157021052-157021074 GAGCCCGGCGGGCCTGGGCTTGG + Intergenic
1035455649 7:159006933-159006955 CTGCCCTGAGCACCTGGCCCAGG - Intergenic
1036662285 8:10716130-10716152 CAGCCCAGAGGTCCCTGCCTCGG - Intergenic
1036746816 8:11415619-11415641 CACCCAGGTGGTCCTGGCCTAGG - Intronic
1037730176 8:21517499-21517521 AAGCTCCTAGGACCTGGCCTTGG + Intergenic
1037948323 8:23003239-23003261 TCGCCAGGAGGCCCTGGCCTCGG - Intronic
1039041274 8:33410900-33410922 CTGCCTGGAGGGTCTGGCCTGGG - Intronic
1045429781 8:102102871-102102893 CAGAGCTGAGGACCAGGCCTTGG - Intronic
1045800686 8:106097295-106097317 CAGTCCAGAGGGCCTGCCCTAGG + Intergenic
1046977725 8:120300980-120301002 CAGCTTGGAGGAGCTGGGCTGGG + Intronic
1049218724 8:141419185-141419207 CAGCCCTGAGGACCTGTGCAGGG + Intronic
1049664221 8:143835849-143835871 CAGCGCCCAGGACCTCGCCTCGG - Exonic
1049848907 8:144820398-144820420 CATCCCTGAGCACCTGGCATCGG + Intergenic
1053351843 9:37418386-37418408 GAGGCCGAAGGGCCTGGCCTGGG - Intergenic
1055744345 9:79426664-79426686 CAGTCTGGAGGCCCTGCCCTTGG - Intergenic
1060509014 9:124218741-124218763 CAGCCTTGAGGTCCAGGCCTGGG - Intergenic
1060932162 9:127496074-127496096 GAGCCCAGGGGACCTGGCCAAGG + Exonic
1061484635 9:130914147-130914169 CAGCACTGAGGCCCAGGCCTGGG + Intronic
1062052970 9:134456962-134456984 GAGCCCTGAGGGCCTGGCCATGG - Intergenic
1062088893 9:134663731-134663753 CTGCCCTGAGGACTTGGACTTGG + Intronic
1062268504 9:135698397-135698419 CCGGCGGGAGGACATGGCCTCGG - Exonic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1192723799 X:73727023-73727045 GAGCCCTGAAGATCTGGCCTGGG + Intergenic
1195269471 X:103215581-103215603 CCGCCCCGAGGCCCTGGCCCTGG - Intronic
1198593910 X:138215556-138215578 AAGCCAGGTTGACCTGGCCTGGG + Intergenic
1199615713 X:149653153-149653175 CTGCAGGGAGTACCTGGCCTGGG - Intergenic
1199626928 X:149750086-149750108 CCCCACGGAGCACCTGGCCTGGG + Intergenic
1199847609 X:151702386-151702408 TAGCCCTGAGGACTTGCCCTGGG + Exonic
1199949637 X:152698129-152698151 CTGCAGGGAGCACCTGGCCTGGG + Intergenic
1199960037 X:152770332-152770354 CTGCAGGGAGCACCTGGCCTGGG - Intergenic
1200017427 X:153178078-153178100 CTGCAGGGAGCACCTGGCCTGGG + Intergenic
1201177864 Y:11321124-11321146 CAGCAGGGAGAAACTGGCCTGGG - Intergenic