ID: 1071568673

View in Genome Browser
Species Human (GRCh38)
Location 10:86684693-86684715
Sequence GGCCCCGGCCAGCCTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 843
Summary {0: 1, 1: 0, 2: 13, 3: 98, 4: 731}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071568673_1071568679 6 Left 1071568673 10:86684693-86684715 CCAGGGCCAGGCTGGCCGGGGCC 0: 1
1: 0
2: 13
3: 98
4: 731
Right 1071568679 10:86684722-86684744 CCCCCAGCTACAGCCCACACTGG No data
1071568673_1071568686 21 Left 1071568673 10:86684693-86684715 CCAGGGCCAGGCTGGCCGGGGCC 0: 1
1: 0
2: 13
3: 98
4: 731
Right 1071568686 10:86684737-86684759 CACACTGGGCAGATTCAAGAAGG No data
1071568673_1071568681 7 Left 1071568673 10:86684693-86684715 CCAGGGCCAGGCTGGCCGGGGCC 0: 1
1: 0
2: 13
3: 98
4: 731
Right 1071568681 10:86684723-86684745 CCCCAGCTACAGCCCACACTGGG No data
1071568673_1071568687 24 Left 1071568673 10:86684693-86684715 CCAGGGCCAGGCTGGCCGGGGCC 0: 1
1: 0
2: 13
3: 98
4: 731
Right 1071568687 10:86684740-86684762 ACTGGGCAGATTCAAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071568673 Original CRISPR GGCCCCGGCCAGCCTGGCCC TGG (reversed) Intronic
900126329 1:1070467-1070489 TTCCCCAGCCAGGCTGGCCCTGG + Intergenic
900142533 1:1144688-1144710 GTCCCCGGCAGGCCAGGCCCCGG - Intergenic
900180114 1:1307601-1307623 GGCCCCGCCCCGCCATGCCCCGG - Intronic
900246320 1:1637731-1637753 GGCCCCACCACGCCTGGCCCCGG - Intronic
900257548 1:1704873-1704895 GGCCCCACCACGCCTGGCCCCGG - Intronic
900284809 1:1894047-1894069 GGTCCCTGCAAGCCTGGCCCAGG + Intergenic
900289719 1:1918816-1918838 GGGCCTGGCGGGCCTGGCCCCGG + Intronic
900372812 1:2339783-2339805 AGCTCAGCCCAGCCTGGCCCCGG + Intronic
900400935 1:2472624-2472646 GGCCAATGCCAGCCGGGCCCAGG + Intronic
900402778 1:2479433-2479455 GCCCCGGGCCAGCCGGGCACTGG + Intronic
900418747 1:2546608-2546630 GTCCCCGGCGAGCCTGGCGGGGG + Intergenic
900470817 1:2854104-2854126 GGCCCTGGCCAGCCTGGGCCTGG - Intergenic
900514515 1:3074893-3074915 GGCCCACGCCAGGCTGGACCAGG - Intronic
900530975 1:3153042-3153064 GGCTCTGGCCTGGCTGGCCCCGG - Intronic
900581536 1:3412168-3412190 GGCCCCGAACAGCGTGGCCGAGG + Exonic
900640411 1:3685648-3685670 GGGCTCGGGCAGCCTGGCACAGG + Intronic
901016635 1:6235698-6235720 GGCCCCCGCCGGCCTGCACCTGG + Exonic
901058365 1:6460199-6460221 AGCCCCAGCCAGCCAGGCCCTGG + Exonic
901070202 1:6513175-6513197 GCCCAGGCCCAGCCTGGCCCAGG + Intronic
901088425 1:6625750-6625772 GGCCCGGCCCGGCCCGGCCCAGG + Intronic
901190703 1:7408204-7408226 GCCCCCGGCAAGCCTGGCGATGG + Intronic
901198793 1:7455069-7455091 TGCCCCAGCCAGGCCGGCCCTGG - Intronic
901319212 1:8329590-8329612 GGCACCGGCCAGCCCAGCCCTGG - Intronic
901623199 1:10605582-10605604 CGCACAGGCCACCCTGGCCCCGG - Intronic
901635944 1:10670152-10670174 GGCCCCAGACACCATGGCCCAGG - Intronic
901934031 1:12615950-12615972 GGCTCCGGCCAGCCCGGCTAGGG + Intronic
902169674 1:14599453-14599475 GGCCCCGGCCAGCCTGAGCGAGG + Intronic
902361731 1:15945690-15945712 AGCCCCGCCCAGCCAGGACCAGG - Intronic
903049301 1:20589067-20589089 AGCTCCGGCCAGCCTGGGCTGGG - Exonic
903183064 1:21614789-21614811 GACACCACCCAGCCTGGCCCCGG + Intronic
903192781 1:21666215-21666237 GACCTCTGCCAGGCTGGCCCTGG - Intronic
903382673 1:22907844-22907866 GGGCCCTGCCAGCCTGGCTCTGG - Intronic
903647236 1:24902799-24902821 GGCCCCGGGCAGCCTAGGGCAGG - Intronic
903672933 1:25047085-25047107 AGGCCCCGCCAGCCTTGCCCAGG - Intergenic
904475722 1:30763608-30763630 GGCCCCTCTCAGCCAGGCCCCGG + Intergenic
904612438 1:31732862-31732884 GGCCCCGACCAGGGTGCCCCAGG - Intronic
904699884 1:32351827-32351849 GGCCCCGCACCGCCTGGACCAGG - Intronic
904837642 1:33349601-33349623 GGCCAGGCCCAGCCGGGCCCTGG - Intronic
904948309 1:34215315-34215337 GGCCCTGTCTAGTCTGGCCCTGG - Intronic
905022241 1:34825826-34825848 GGCCAGGACCAGGCTGGCCCCGG + Intronic
905028377 1:34866054-34866076 CGGCCCGCCCAGCCCGGCCCGGG - Exonic
905657279 1:39692709-39692731 TCCCCCAGCGAGCCTGGCCCAGG - Intronic
905883047 1:41476889-41476911 GGCCCCGGGGACCCTGGCCAGGG - Intergenic
905890543 1:41516112-41516134 GGCCCCGGCCAGCCCCGAGCTGG - Intronic
906038487 1:42767531-42767553 GACCCCCGGCGGCCTGGCCCTGG + Exonic
906102667 1:43273111-43273133 GGCGGCGGCCAGCCCGGCCAGGG - Exonic
907308859 1:53528125-53528147 GGCCCGTGGCACCCTGGCCCAGG - Intronic
908534818 1:65067347-65067369 GGCTCCGGCGAGGCTGGCCGCGG - Intergenic
909308704 1:74117560-74117582 GTTCCAGGCCAGCCTGGCCAAGG + Intronic
910550276 1:88467164-88467186 GGCCCGGCCCGGCCCGGCCCCGG + Intergenic
911182816 1:94876104-94876126 GGCCCGGCCCGGCCTAGCCCAGG - Intronic
912451613 1:109770787-109770809 GCCACCTCCCAGCCTGGCCCTGG - Intronic
912491572 1:110065374-110065396 GTCCACAGCCTGCCTGGCCCTGG - Intronic
914428271 1:147599128-147599150 GGCCCAGCCCAGCCTGGCTCAGG - Intronic
914806721 1:150997257-150997279 GGGGCAGGCCAGCCTGGCACTGG + Exonic
914913307 1:151803311-151803333 GCCCTCTTCCAGCCTGGCCCAGG + Intronic
914961583 1:152213998-152214020 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914961831 1:152215408-152215430 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914962078 1:152216818-152216840 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914962328 1:152218228-152218250 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914962452 1:152218933-152218955 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914962692 1:152220334-152220356 GGCCACGGCCAGCGTGGGTCTGG - Exonic
915090057 1:153417860-153417882 GGCCCTGGCCAGGATGGGCCGGG + Intronic
915095427 1:153459216-153459238 GGCCCTGGCCAGGATGGGCCAGG - Intronic
915216488 1:154343979-154344001 CCTCCAGGCCAGCCTGGCCCAGG + Exonic
915238299 1:154501924-154501946 GGCCCCGGCCGGCTCGGCCCAGG + Exonic
915245241 1:154551731-154551753 CGCCCAGGCCGGCCTGGCCAAGG + Intronic
915303102 1:154962457-154962479 GGCCCGGCCCAGCCTAGGCCCGG - Exonic
915674927 1:157520740-157520762 GCCACCGGCCACCCTGACCCTGG - Intronic
915932758 1:160070184-160070206 GCCCCCGGCCGGCCCGACCCCGG - Exonic
916037710 1:160935678-160935700 AGCCCCTGCCAGCCTGAGCCAGG - Intergenic
916226948 1:162497937-162497959 GGGCCCGGCCGGCCTGCCTCAGG + Exonic
916501728 1:165393167-165393189 GGCCCCGCCCAGCCTCCCCAGGG - Intergenic
917442367 1:175079126-175079148 GGCCCTTTCCAGCCTGGGCCAGG - Intronic
917491670 1:175503595-175503617 GGCCCCGGGCAGGCAGGTCCTGG + Intronic
918043533 1:180927531-180927553 GCCCTCGGCCAGCCTGGCTGGGG + Intronic
918043758 1:180928584-180928606 CTCCCAGGCTAGCCTGGCCCAGG - Intronic
918131160 1:181630960-181630982 GGTGCTGGCCAGCCTGGCCTGGG - Intronic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
919926416 1:202194059-202194081 GGCGCCCCCCAGCCCGGCCCGGG + Exonic
920255221 1:204650069-204650091 GCACCTGCCCAGCCTGGCCCTGG + Intronic
920401613 1:205680038-205680060 GGCCCGGTCCGGCCCGGCCCGGG + Intronic
922571237 1:226635757-226635779 GGGCCTTCCCAGCCTGGCCCAGG + Intronic
924741704 1:246797861-246797883 GGCTCCTCCCAGCCTGGCGCAGG - Intergenic
1062854593 10:773658-773680 GGCAGCGGCCAGCCTTGCCCTGG + Intergenic
1063360092 10:5446542-5446564 GGCCACAGCCAACCGGGCCCTGG - Intronic
1063393680 10:5666593-5666615 GGCCCCGCGCGGCCCGGCCCAGG - Intronic
1064290580 10:14030697-14030719 GGCCCCTGGCAGCCTGGCACTGG + Intronic
1065068939 10:22002977-22002999 GGCGCCGTCCAGCCTGTCACTGG + Intronic
1067148660 10:43711830-43711852 ATCCTCGTCCAGCCTGGCCCTGG - Intergenic
1067279508 10:44860742-44860764 GGACCTGGGCAGCCTGGCTCTGG - Intergenic
1067414039 10:46090620-46090642 GGCCCTGGCCAGCCGGACACTGG + Intergenic
1067769897 10:49115538-49115560 GGCCGCCGCCAGCCCGCCCCGGG + Intergenic
1069558944 10:69416194-69416216 GGCCACAGCCTACCTGGCCCTGG - Exonic
1069639450 10:69945398-69945420 GCCTCAGGCCAGCCAGGCCCAGG + Intronic
1069686769 10:70323834-70323856 GGGCCTGGCCCACCTGGCCCTGG - Intronic
1069757918 10:70785157-70785179 GGCCCCAGCCAGCCAGGCAGAGG + Intronic
1069788631 10:71005482-71005504 GGCCCCAGCAGGCCTAGCCCAGG + Intergenic
1069840804 10:71338128-71338150 GGCCTCACCCAGACTGGCCCAGG - Intronic
1069895612 10:71678591-71678613 GTGCCCGCCCAGCCTGGCCACGG + Intronic
1070305038 10:75234799-75234821 GGCCCCTCCCAGGCCGGCCCGGG + Intronic
1070329886 10:75409343-75409365 CTCCCCTGCCCGCCTGGCCCAGG + Intergenic
1070587872 10:77780113-77780135 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1070610144 10:77927034-77927056 GGCCCCGGTGAGCCGGGCCGGGG - Intergenic
1071299785 10:84247806-84247828 GGCCCTGGGCAGCCAGGCCAAGG + Intronic
1071527345 10:86366274-86366296 GCCCCCGCCCAGCCTCGGCCCGG + Intronic
1071568673 10:86684693-86684715 GGCCCCGGCCAGCCTGGCCCTGG - Intronic
1072209867 10:93236576-93236598 AGACCCTGCCAGCCTGGCACAGG - Intergenic
1072617657 10:97060190-97060212 GGCCCAGGTCAGCCCAGCCCTGG + Intronic
1072755534 10:98018421-98018443 GGCTGCCGCCTGCCTGGCCCTGG - Intronic
1073196234 10:101694481-101694503 GGCCCTCGGCCGCCTGGCCCAGG - Exonic
1073479457 10:103777374-103777396 GGCCTGGGCCAGCTTGGCTCTGG + Intronic
1074151418 10:110762969-110762991 GGAACCAGCCAGCCTGGCCGTGG - Intronic
1075654087 10:124149907-124149929 GGCCCCTGTCAGCCAGGCCTGGG - Intergenic
1076096365 10:127737309-127737331 GGCCCCGCCCGGCCAGGCCCAGG + Exonic
1076098823 10:127757406-127757428 GGCTCCAGCAAGCCTGCCCCAGG - Intergenic
1076726855 10:132417997-132418019 GGCCCCGCCCAGCAGTGCCCAGG - Intergenic
1076793276 10:132787571-132787593 GCCCCCGCGGAGCCTGGCCCGGG + Intergenic
1076809164 10:132877829-132877851 GGCACAGGCCATCCTGGGCCCGG + Intronic
1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG + Intergenic
1077043407 11:534387-534409 GGCCCTGCTCAGCCAGGCCCAGG + Intronic
1077045152 11:541397-541419 GGCCAGGGCCAACATGGCCCAGG + Intronic
1077049104 11:558803-558825 GGCCCCTGGCCACCTGGCCCAGG + Intronic
1077058934 11:609383-609405 GCCCCCAGCCAGCCTGGCCGTGG + Exonic
1077058936 11:609385-609407 GGCCACGGCCAGGCTGGCTGGGG - Exonic
1077199370 11:1297780-1297802 GTCCCAGGCCAGCCTCCCCCAGG + Intronic
1077216501 11:1397344-1397366 GGGCCCGGCCTGCCAGGTCCAGG + Intronic
1077286151 11:1766897-1766919 GCCCACGGCCAGCCTGGACCTGG + Intergenic
1077336994 11:2009844-2009866 GGCCCCAGCCAGGCTGGTCCGGG + Intergenic
1077336995 11:2009846-2009868 GGCCCGGACCAGCCTGGCTGGGG - Intergenic
1077341323 11:2027654-2027676 GGCCCCTGCAAGCCCGGCCCCGG - Intergenic
1077376890 11:2209393-2209415 GCCCCCGCCCAGCCTGGGCTGGG - Intergenic
1077458552 11:2696179-2696201 CCCCACGGCCACCCTGGCCCTGG + Intronic
1077474120 11:2778421-2778443 GGCCCCAGACAGCTGGGCCCAGG - Intronic
1077484001 11:2830605-2830627 GCCCCCAGCCTGCCTGGCCCAGG - Intronic
1077507905 11:2940644-2940666 GGCCCAGCCCAGCCCAGCCCAGG - Intergenic
1078069161 11:8097084-8097106 GGGCCTGGCCAGCCTGGGCCTGG - Intronic
1079004723 11:16783609-16783631 CACCCCAGCCAGCCCGGCCCAGG + Intronic
1079385575 11:19976452-19976474 GCCCCCTGCCAGCCTCGCCAGGG - Intronic
1080836368 11:35944280-35944302 GGTCCGGGCCAGCCCGGCGCCGG - Intronic
1081549261 11:44096427-44096449 GACCCCGGCCACCCAGTCCCCGG - Intronic
1081640681 11:44751345-44751367 AACCCCAGGCAGCCTGGCCCTGG - Intronic
1081860941 11:46333075-46333097 GACCCCGGCCCGCCTCTCCCAGG + Intronic
1081990203 11:47333422-47333444 TGCCCCAGCAGGCCTGGCCCTGG - Intronic
1082001315 11:47395040-47395062 GGCCCTCGCCAGCCTGGGCCAGG + Intergenic
1082781970 11:57294890-57294912 GGCCCTGGGCAGACTGGCACAGG + Intergenic
1082996903 11:59262201-59262223 AGGCCCAGCCAGCGTGGCCCTGG - Intergenic
1083163132 11:60867778-60867800 GGCCCCTGCCTCCCTGGCCACGG + Intronic
1083264940 11:61542326-61542348 TGCCCTGCCGAGCCTGGCCCCGG + Intronic
1083333964 11:61912241-61912263 CGCCCCGGGGAGCCAGGCCCTGG - Intronic
1083430666 11:62612446-62612468 GGCCCCGTCCATCCGGCCCCCGG + Exonic
1083540578 11:63509131-63509153 GGCCCAGGGCAGCCTGGAACCGG - Intronic
1083560626 11:63670918-63670940 GGCCCCGCCGAGCCCCGCCCTGG - Intronic
1083623992 11:64062714-64062736 TGCCCCGCGCAGCCTGACCCAGG + Intronic
1083657042 11:64234720-64234742 GGCCCCCGCCCGCCGCGCCCGGG + Exonic
1083720332 11:64600648-64600670 GGGCCAGGCCCGCTTGGCCCAGG - Intronic
1083811371 11:65108616-65108638 GGCAGCGGCCAGCAGGGCCCCGG - Exonic
1084095057 11:66905851-66905873 GGCCCTGGCGAGCTTAGCCCAGG + Intronic
1084171707 11:67404190-67404212 GGCCCCGGGCACCATGGCCCAGG + Exonic
1084179908 11:67441057-67441079 GAACCCTGCCTGCCTGGCCCAGG + Intronic
1084189370 11:67492010-67492032 GGCCCACACCAGCCTGGACCTGG - Exonic
1084295787 11:68213008-68213030 GGCCCCACCCGCCCTGGCCCCGG + Intronic
1084315443 11:68342921-68342943 GGCCCTGGCCAGCCCAGCCGAGG - Intronic
1084331237 11:68431879-68431901 GGCCCTGGCCCTCCTGGCTCGGG + Intronic
1084681812 11:70670749-70670771 AGCCCCGGCCAGCCTGCTCCTGG + Intronic
1084726418 11:70945377-70945399 GGCCCCCACCAGCCTGGTCGTGG + Intronic
1085257703 11:75185377-75185399 GGCCCATGGCATCCTGGCCCTGG + Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1089199391 11:116714730-116714752 GGCCTCTGGCAGCCAGGCCCTGG - Intergenic
1089684721 11:120139403-120139425 TGCCCTGCCCAGCCTGGCCTTGG - Intronic
1089800616 11:121024166-121024188 GGTCCCGGCCAGCCCCGGCCCGG - Exonic
1090028261 11:123185683-123185705 GGACTCTGCCTGCCTGGCCCAGG + Intronic
1090365632 11:126203106-126203128 TGCCCCAGTCTGCCTGGCCCTGG + Exonic
1090398755 11:126435333-126435355 CACCCTGGCCAGCCAGGCCCTGG - Intronic
1090784975 11:130040814-130040836 GGCCCCTGCGAACCTGGCCCCGG - Intergenic
1090977823 11:131691426-131691448 CGGCTCGGCCAGCCTGGACCCGG - Intronic
1091301963 11:134513732-134513754 GGGGCTGGCCAGCCTGGCCAAGG + Intergenic
1091301985 11:134513821-134513843 GGGGCTGGCCAGCCTGGCCAAGG + Intergenic
1202819978 11_KI270721v1_random:65026-65048 GGCCCCAGCCAGGCTGGTCCGGG + Intergenic
1202819979 11_KI270721v1_random:65028-65050 GGCCCGGACCAGCCTGGCTGGGG - Intergenic
1202824308 11_KI270721v1_random:82843-82865 GGCCCCTGCAAGCCCGGCCCCGG - Intergenic
1091599925 12:1912038-1912060 GGCCCCAGCAACCCTGACCCCGG + Intronic
1091697879 12:2640290-2640312 TGCCCAGGCCAGCCTGGCCCAGG - Intronic
1092731639 12:11540338-11540360 GGCCCCGGGCAGTCTTGCCTAGG - Intergenic
1096122005 12:49094413-49094435 GGCGCCGGCCAACCGGCCCCCGG + Exonic
1096186955 12:49587658-49587680 GACCCCTGCCAGCCTTCCCCGGG - Exonic
1096481012 12:51941047-51941069 AGCCCCCTCCAGCCTGGCCCGGG + Intergenic
1097041799 12:56160442-56160464 GGCCCTGCCCAGCCCAGCCCAGG + Intronic
1097167534 12:57093726-57093748 GGCTCCAGCCAGCCAGGCCTTGG + Intronic
1102257938 12:111426955-111426977 GGCCCAGCCCAGCCTGGAGCTGG - Intronic
1102346335 12:112163510-112163532 CTCCCCGCCCAGCCTGGCCCTGG + Intronic
1103330708 12:120151903-120151925 GGCACCTGCCAGCATGGCCTCGG - Intronic
1103506396 12:121444371-121444393 GGCCGGGACCAGCCTGTCCCAGG - Intronic
1103931483 12:124453196-124453218 GACCCCGGCTAGCCTGGGCTGGG - Intronic
1104568301 12:129903960-129903982 CGCCTCGGCCCGCCCGGCCCCGG + Intergenic
1104623756 12:130337443-130337465 GGCCCCGGCCAGCCCCACCCAGG - Intergenic
1104710117 12:130979735-130979757 ACCCCCGCCAAGCCTGGCCCAGG - Intronic
1104861773 12:131927829-131927851 GGCCCCACACAACCTGGCCCCGG + Intergenic
1104934493 12:132357318-132357340 GGGCTCTGCCAGCCTGGGCCTGG - Intergenic
1105819003 13:24063100-24063122 GTCCTCAGCCAGCCTGGACCAGG + Intronic
1105927185 13:25018640-25018662 TGCCGCGGCCGGGCTGGCCCAGG + Intergenic
1106517100 13:30465213-30465235 GGGCCCGGCCGGCCTCGGCCCGG - Intronic
1111672451 13:91348035-91348057 GGCCCGGGGCGGACTGGCCCGGG + Intergenic
1112412059 13:99173112-99173134 GGACCCGCCCAGCCAGGCACGGG + Intergenic
1112692882 13:101916634-101916656 GGCCGCGGCCATGGTGGCCCCGG + Intronic
1113200797 13:107866396-107866418 GGCCCGGGTCAGCTTGGCCTCGG + Exonic
1113740438 13:112709068-112709090 GTCCCCAGCCAGCCTGTCTCAGG + Intronic
1113788104 13:113013455-113013477 GGCCGCAGCCAGCACGGCCCAGG + Intronic
1113877054 13:113601256-113601278 GTCCCCGTTCAGCCTGTCCCGGG + Intronic
1114270703 14:21098421-21098443 GGCCCCGGCCCCCCCGCCCCCGG + Exonic
1116436261 14:44897757-44897779 GGCCCTGGGCAGCCGCGCCCGGG - Intronic
1116436269 14:44897772-44897794 GGCCACGCCCACCCTGGCCCTGG - Intronic
1116905181 14:50396929-50396951 GGCCCCGCCCAGGCAGACCCGGG - Intronic
1116950121 14:50871992-50872014 GGCCGCGAACAGCCTGACCCGGG + Intronic
1117108696 14:52426206-52426228 GAACCGGTCCAGCCTGGCCCAGG - Intergenic
1117377390 14:55129132-55129154 GGGCTCGCCCAGCCTGGTCCGGG + Exonic
1117680680 14:58200076-58200098 GGCCGCGGCGCGCCGGGCCCGGG - Intronic
1119483810 14:74975551-74975573 GGGTCAGGTCAGCCTGGCCCAGG + Intergenic
1120836277 14:89040878-89040900 GGCTCCTGCCTCCCTGGCCCGGG - Intergenic
1121535721 14:94689608-94689630 GGCCCCGGCCAGCCGCGCCCAGG - Intergenic
1122079120 14:99254631-99254653 GGCCGGGGCCAGCGAGGCCCTGG + Intronic
1122178513 14:99938073-99938095 GGCCACGGCCAGGCAAGCCCAGG - Intronic
1122265935 14:100546879-100546901 CGCCCAGGCCAGACTGGCTCAGG - Intronic
1122290555 14:100678365-100678387 GGCCCCAGCCAGAGAGGCCCCGG + Intergenic
1122365755 14:101194037-101194059 TGCCCCGGCCTGTCTGCCCCAGG + Intergenic
1122502790 14:102212432-102212454 GGCTCAGCCCAGGCTGGCCCAGG + Intronic
1122519617 14:102334155-102334177 GGCCCCTCTCAGCCTGGGCCTGG + Intronic
1122625658 14:103084292-103084314 GCCCCTCCCCAGCCTGGCCCCGG + Intergenic
1122627207 14:103090740-103090762 GCCCTTGGCCAGCCTGGGCCAGG + Intergenic
1122658467 14:103278963-103278985 GACCCCCGCCAGCCTTGGCCCGG - Intergenic
1122715393 14:103693842-103693864 CGACCCGGCCAGGCTGGCTCAGG + Intergenic
1122787158 14:104169054-104169076 TGCCCCAGCCAGCCAGGCCTGGG - Intronic
1122816177 14:104315296-104315318 TGCCCCTGCCAGCCTGGCTCTGG + Intergenic
1122959627 14:105088451-105088473 GGCCCCAGCCAGCGGGGCCGAGG + Intergenic
1122971173 14:105152835-105152857 GGCCTGGGCCAGCCCTGCCCAGG + Intronic
1123031132 14:105451682-105451704 GTCCCCGGCAAGCATGGACCCGG - Intronic
1123059996 14:105590284-105590306 AGCCCAGGCCAGCCCAGCCCAGG + Intergenic
1123084136 14:105709665-105709687 AGCCCAGCTCAGCCTGGCCCAGG + Intergenic
1202852531 14_GL000225v1_random:30514-30536 GTGCCCTGCCAGCCTGTCCCGGG - Intergenic
1202853605 14_GL000225v1_random:36807-36829 GAGCCCTGCCAGCCTGTCCCGGG - Intergenic
1202858250 14_GL000225v1_random:64474-64496 GCGCCCTGCCAGCCTGTCCCGGG + Intergenic
1202859557 14_GL000225v1_random:72760-72782 GCGCCCTGCCAGCCTGTCCCGGG + Intergenic
1125356804 15:38824966-38824988 GGCCCAAGCCAGCCTGGCCCTGG + Intergenic
1125589324 15:40844575-40844597 GGCCCGCGCCCGCCTCGCCCCGG + Exonic
1126600593 15:50423897-50423919 GGCCCCGGCGAGGCTGGGCACGG - Intergenic
1126680655 15:51199017-51199039 GGGCCCTGCCAGCCTGGTTCTGG - Intergenic
1127996084 15:64153759-64153781 GGCCCAGGCCAGACAGGCCCAGG - Intronic
1128344076 15:66842679-66842701 GACCCCGGCCCGCCCGCCCCGGG - Intergenic
1128999453 15:72320063-72320085 GGCCCGGGCCCGCCCCGCCCCGG - Exonic
1129382666 15:75177971-75177993 GGCCCCAGTGAGCCAGGCCCTGG + Intergenic
1129948247 15:79560613-79560635 GGGACCGCCCGGCCTGGCCCCGG - Intergenic
1130209482 15:81910080-81910102 AGCCGAGGCCAGGCTGGCCCAGG + Intergenic
1130370624 15:83283498-83283520 AGTCCCGCCCAGCCTGGCCTTGG - Intronic
1131119619 15:89814389-89814411 GGCCGCGGCCACTCTGTCCCTGG - Intronic
1131147763 15:90025179-90025201 GGACCCGGTCACCCTGGCTCTGG - Intronic
1131527110 15:93161249-93161271 GCCCCCGGCAAGCATGGCGCAGG - Intergenic
1132480641 16:164834-164856 CGCCCCGCCCCGCCGGGCCCCGG - Intronic
1132504153 16:298353-298375 GCCCCCGGCCACCCTGGGCTGGG - Intronic
1132548404 16:544114-544136 GGCGCCGGTCAGCCTTGCCAGGG - Intronic
1132571591 16:646689-646711 CGTCCCGGCCAGCCGGGCCCAGG - Intronic
1132600598 16:770949-770971 GGCCCCGGCCAGCCTGTGGGAGG + Exonic
1132626896 16:895472-895494 GCTCCCGTCCTGCCTGGCCCCGG - Intronic
1132634737 16:938222-938244 GGCCATGGCCTGCCTGGCACAGG + Intronic
1132651090 16:1021750-1021772 GGCCCGGCCCTTCCTGGCCCAGG + Intergenic
1132659326 16:1054450-1054472 TGCCCCGGCCAGCCTGCCCCAGG - Intergenic
1132728869 16:1350937-1350959 TGTCTCGTCCAGCCTGGCCCAGG + Exonic
1132751168 16:1458397-1458419 GGTTCAGGCCAGCCTGGCGCGGG + Intronic
1132765184 16:1530931-1530953 GGCCCCTGCCTGCCAGGCCGAGG + Intronic
1132769144 16:1551352-1551374 GTCCCCGGCTTGACTGGCCCTGG - Intronic
1132799328 16:1743961-1743983 GGCCCCTCCCTGCCTGTCCCTGG + Intronic
1132846647 16:2003880-2003902 GGCCCCTGGCACCCTGGCCTAGG + Intronic
1132866725 16:2096881-2096903 GGCCCCGGCCAGCCTCACACAGG + Intronic
1132884902 16:2178375-2178397 GCCCCCGGCCAGGCGGTCCCCGG + Exonic
1132886623 16:2185072-2185094 AGCCCTGGCCACCCTGGCCCTGG + Intronic
1132896020 16:2229772-2229794 GGCCCCTCCCAGCCAGGCCCTGG - Intronic
1132934836 16:2475036-2475058 GGCTCCGGCCTGCCCGGCTCTGG - Intergenic
1132935008 16:2475604-2475626 GGCCCCGCCCCGCCCCGCCCAGG + Intronic
1133272283 16:4616116-4616138 TGGCCCCGCCAGCCTGTCCCAGG - Intergenic
1133320933 16:4913401-4913423 AACCCCTGCCACCCTGGCCCCGG - Intronic
1133777535 16:8909214-8909236 GGCCCCTGACCGCCTGGCCGTGG - Intronic
1133916384 16:10113079-10113101 GCCCCCAGGCAGCCTGGCCCAGG - Intronic
1134059271 16:11189128-11189150 CGCCACGCCCAGCCTGGCCCGGG - Intergenic
1134136626 16:11680738-11680760 GGCCCTGGGCAGCCAGGCTCTGG - Intronic
1134644954 16:15858333-15858355 GGCCCGGCCCGGCCCGGCCCGGG - Intergenic
1134654383 16:15937036-15937058 GGCCTGGGACAGCCTGGGCCTGG - Intergenic
1135773630 16:25236656-25236678 GGCTCAGGGCAGCCTGGCCTTGG - Exonic
1136175584 16:28514281-28514303 GGGCCTGGCCAGTCAGGCCCTGG + Intergenic
1136270212 16:29144088-29144110 GGGCCTGGCTGGCCTGGCCCAGG + Intergenic
1136402276 16:30025188-30025210 GCCCCCGGCCTGCCAGGCCCAGG - Exonic
1136514373 16:30759142-30759164 GGCCCAGCCCAGCCCTGCCCTGG + Exonic
1136666746 16:31819443-31819465 GGTCCCAGCCAGCGAGGCCCCGG + Intergenic
1136990161 16:35147154-35147176 GGGTCTGGCCAGCCTGTCCCTGG - Intergenic
1137666445 16:50252343-50252365 GTCCCCCGCCAGCCTGGCTTCGG + Intronic
1138023067 16:53502593-53502615 GTCCCCAGCGAGCCTGGCCCGGG - Intronic
1138335988 16:56253136-56253158 GGCCCCCTCTTGCCTGGCCCAGG + Intronic
1138508005 16:57487732-57487754 GGCCCAGGCTAGCTTGGCCATGG - Intergenic
1138550182 16:57743638-57743660 GGCCCCAGCCGGCCTCACCCCGG + Intronic
1138619066 16:58197703-58197725 GGCCGCGGGCAGCAGGGCCCGGG - Exonic
1138688449 16:58746906-58746928 GGCCCAGTCCTGCCAGGCCCAGG - Intergenic
1139430192 16:66907034-66907056 GGCCCCTGTCATCCTGGCTCAGG - Intergenic
1139506065 16:67398648-67398670 GGCCCCTGCCATCCTGGCCCTGG - Exonic
1139530474 16:67540154-67540176 GGCCCGGGACAGCCTGGCAGAGG + Exonic
1139530475 16:67540156-67540178 GGCCTCTGCCAGGCTGTCCCGGG - Exonic
1139806220 16:69566692-69566714 GGCCCCGGCCTCCCGGGCTCGGG + Intronic
1140091968 16:71846131-71846153 ACCCCAGGCCTGCCTGGCCCCGG - Intronic
1141184821 16:81779566-81779588 GACCCCGGCCCGCCGTGCCCGGG + Intronic
1141560936 16:84867376-84867398 GGCAGCGTCCAGCCTGGCTCTGG + Intronic
1141637152 16:85320208-85320230 GGCCCCACCCAGCAGGGCCCTGG + Intergenic
1141760480 16:86025793-86025815 CTCCCCTGCCAGCCTGGCCTGGG - Intergenic
1141909393 16:87048152-87048174 GTCCGCGGCCTGCCTGCCCCGGG + Intergenic
1141972287 16:87492330-87492352 GGCCCCGGCCCGCGCGTCCCCGG - Intergenic
1142073803 16:88105922-88105944 GGGCCTGGCTGGCCTGGCCCAGG + Intronic
1142230249 16:88896785-88896807 CGCCCCGGCCAGCCTGGGCCTGG + Intronic
1142799797 17:2337849-2337871 GGACCCGCCCCGCCCGGCCCAGG - Intronic
1143007458 17:3846160-3846182 GGCCCCGGCGGGGCCGGCCCTGG - Exonic
1143021557 17:3919426-3919448 AGCCTCTGCCAGGCTGGCCCAGG - Intergenic
1143088417 17:4434031-4434053 GGACACTGCCTGCCTGGCCCTGG - Exonic
1143178059 17:4967891-4967913 CGCCCAGGCCAGGCGGGCCCAGG - Intergenic
1144447137 17:15341600-15341622 GGCCCAGACCAGTCTGGCCCTGG + Exonic
1144833103 17:18142665-18142687 GGCCCTTGCCAGCCTGGCCTGGG - Intronic
1144872648 17:18380539-18380561 GGGCCCAGCCAGGCTGGCTCAGG + Intronic
1144943073 17:18954635-18954657 GGCCCCCGCCAGACTCTCCCAGG - Intronic
1144951745 17:18998157-18998179 GGCCCCAGCCTGGCAGGCCCTGG - Intronic
1145252881 17:21305925-21305947 TGCCCAGGGAAGCCTGGCCCAGG + Intronic
1145278391 17:21450561-21450583 GGCCACTGACAGCTTGGCCCTGG - Intergenic
1145761880 17:27429989-27430011 GGGCATGCCCAGCCTGGCCCCGG + Intergenic
1146055305 17:29577900-29577922 GGCCACGCCCAGCCTTGCCCTGG - Intronic
1146329590 17:31916902-31916924 AGCCCCAGCCAGCCCGACCCGGG + Intergenic
1146398987 17:32488881-32488903 GGCCTCTGGCTGCCTGGCCCAGG + Exonic
1146656370 17:34637483-34637505 GGCCCCAGCCAACCAGGGCCCGG + Exonic
1146693006 17:34889589-34889611 GGCACCTGCCAGCCTGAACCTGG - Intergenic
1147179161 17:38674009-38674031 GGCCCCGCCTCGCCCGGCCCCGG - Exonic
1147189444 17:38730270-38730292 GTCCCCGGCCCGCCAGGCCCCGG - Exonic
1147313071 17:39606448-39606470 GGCCCCGGAGCCCCTGGCCCGGG + Exonic
1147317432 17:39627547-39627569 TGCCCCGGCCGGACTGGCCTGGG + Intronic
1147668529 17:42163712-42163734 GGCCCTGGCCAGCCAGGGCAGGG + Exonic
1147705502 17:42422510-42422532 CTCCCCTCCCAGCCTGGCCCGGG - Intronic
1147732706 17:42614017-42614039 GTCCCAGGCCAGGCCGGCCCTGG + Intronic
1147739964 17:42665846-42665868 GTCCCAGGCCAGGCTGGCCCTGG + Intronic
1147739966 17:42665848-42665870 GCCCAGGGCCAGCCTGGCCTGGG - Intronic
1147788673 17:42998866-42998888 CGCCGCAGCCAGCCTGGTCCCGG - Intronic
1148562540 17:48614211-48614233 CGCCCCGGCCTGCCAGGCCTTGG + Intronic
1148839785 17:50487736-50487758 TGCCCTGGAAAGCCTGGCCCTGG + Intergenic
1149597225 17:57871418-57871440 GTCCCAGCCCAGCCTGCCCCTGG - Intronic
1149606265 17:57927220-57927242 TGCCCAGGCCCGCCTGCCCCTGG - Intronic
1149649876 17:58270003-58270025 GGGCCCAGCCAGCCAGGCTCAGG - Exonic
1149772240 17:59331471-59331493 GGCCCGGCCCAGCCTGGGCTAGG - Intergenic
1150150915 17:62808271-62808293 GGCGCCGGCCGGCCTTGCCTGGG + Exonic
1150280555 17:63927705-63927727 GGCTTGGCCCAGCCTGGCCCAGG + Intergenic
1150627435 17:66850406-66850428 GGCACAAGCCAGCCTGCCCCAGG - Intronic
1151597607 17:75087921-75087943 GGGCCCGCCCTGCCTGGCCGCGG + Intronic
1151703791 17:75756526-75756548 GGCCCCAGCCTTCCTGGCTCTGG - Exonic
1151748608 17:76024483-76024505 GGGCCCAGCCAGGCTGGCTCAGG - Intronic
1151800569 17:76377030-76377052 GGCCTGGTCCAGCCTGGCACAGG + Intronic
1151948327 17:77331505-77331527 GGACCCGCCCAGCCTGGGCAGGG + Intronic
1152245330 17:79182388-79182410 AGCCCGGGCCAGGCTGGCGCCGG + Intronic
1152294299 17:79457678-79457700 GTCCTAGGCCAGCCAGGCCCTGG + Intronic
1152406337 17:80100170-80100192 AGCTCCAGCCAGCCTGGCCCGGG + Exonic
1152436485 17:80279309-80279331 GGCCCCCACCTGCCTGGGCCTGG - Intronic
1152554361 17:81045684-81045706 GGCCCTGGGCAGCCTGGCCATGG - Intronic
1152649822 17:81487751-81487773 GGCCCCGGCCAGGCGGGGCGCGG + Intergenic
1152657720 17:81527737-81527759 GGGCCGGGCCAGCCTGGCCCAGG + Intergenic
1152695435 17:81741604-81741626 GGCGCTGCCCAGCCTGGCCCTGG - Intergenic
1152732057 17:81977388-81977410 GCCCCGGCCCAGCCTGGCCCCGG + Intronic
1152805424 17:82353667-82353689 TGCCCCGGCCTCCCTGGCCCTGG + Intergenic
1152924467 17:83080811-83080833 GGCCCGGGCCAGCCCGGCCACGG - Intronic
1152926842 17:83091222-83091244 GGCCCGGTCCAGCCTGGCACTGG - Intronic
1153489177 18:5630212-5630234 GGACCCGGCCAGGCAGCCCCCGG + Intronic
1154066354 18:11110699-11110721 CGCCCCGGCCCGCCCGCCCCGGG + Intronic
1154202430 18:12308503-12308525 GTCCCCGGCCGGCCACGCCCCGG - Intronic
1154329205 18:13415768-13415790 GACACCGGGCAGCGTGGCCCTGG - Intronic
1155261731 18:24050050-24050072 GGCACCAGCCAGCCAGGCCTGGG - Intronic
1156350572 18:36298089-36298111 GGCCGCGCCCAGCCCAGCCCAGG - Intronic
1157490031 18:48116686-48116708 GGCCACTGCTTGCCTGGCCCTGG + Intronic
1158517913 18:58146287-58146309 GGCCCAGTCCAGCATGGCTCTGG + Intronic
1159864071 18:73683794-73683816 ACCCCAGGCCAGCCTGCCCCAGG + Intergenic
1160404812 18:78638133-78638155 CGCCCCGGCCGGCCTGGGGCTGG + Intergenic
1160559606 18:79747792-79747814 GGCCACTGCCAGCGTGGCCGCGG - Intronic
1160577447 18:79864440-79864462 GGCCGCCTCCAGCCCGGCCCCGG - Intronic
1160803042 19:979392-979414 TGTCCCGGCCAGCCTCGGCCAGG - Intergenic
1161007889 19:1945409-1945431 GCCCCCTGCCAGCCCTGCCCAGG + Intronic
1161083743 19:2324255-2324277 GGCCCGCCCCAGCATGGCCCAGG + Intronic
1161089099 19:2351388-2351410 GGCCCTGGCCTGCCTGGCTGAGG + Intronic
1161162892 19:2770434-2770456 GCAGCCGGCCAGCCTGCCCCGGG - Intronic
1161232170 19:3179793-3179815 GGCCCGGGCCAGGCAGTCCCCGG - Exonic
1161314510 19:3611569-3611591 GGCCCCACCCAGCCTGGCTGAGG + Exonic
1161332903 19:3696761-3696783 GGCCCTGCACAGCCTGCCCCGGG - Intronic
1161401237 19:4066965-4066987 CGCCCCCCCCAGCCTGGCCTCGG + Intergenic
1161452650 19:4355030-4355052 CGCCCCCGCCCACCTGGCCCTGG - Intronic
1161749918 19:6088142-6088164 GGCCCTGGCCAGCCTGGGTTAGG - Intronic
1161903742 19:7139188-7139210 AGCCCCAGCCAAACTGGCCCAGG + Intronic
1161948188 19:7452013-7452035 TGCCACGCCCAGCCTGGCCTGGG + Intronic
1161973368 19:7596101-7596123 GGCGGCGGCCAGCCTGGCGTGGG + Exonic
1162016452 19:7849100-7849122 GGGCCAGGACAGCCTGGGCCAGG + Exonic
1162040707 19:7969293-7969315 GGCCCCGGGCTGCCTGGCTTTGG - Intronic
1162128803 19:8513106-8513128 GACAGCTGCCAGCCTGGCCCCGG - Exonic
1162154061 19:8664685-8664707 GGCCCTGGGCAGCCCAGCCCAGG - Intergenic
1162235954 19:9309724-9309746 CGCCCCGCCCTGCCTGCCCCGGG - Intronic
1162299265 19:9835112-9835134 GCCCCCGGCCAGCCTCAGCCTGG - Intergenic
1162573089 19:11483614-11483636 GGCCCCGGCAAGCCCGGGCGTGG + Exonic
1162740480 19:12770969-12770991 GGCGCTGACTAGCCTGGCCCAGG - Exonic
1162909841 19:13842824-13842846 AGCCTCGGCCGGCCCGGCCCGGG - Intergenic
1162918343 19:13886012-13886034 GGGCCCGGCCAGCAAGGGCCCGG + Exonic
1163038073 19:14583208-14583230 GGCCCCGGCCAGGCTGGGGCTGG + Intronic
1163038765 19:14587465-14587487 GGCCCTGGCCAGGCTGGGGCTGG + Intronic
1163039511 19:14592132-14592154 GGCCCTGGCCAGGCTGGGGCTGG + Intronic
1163152804 19:15424961-15424983 GGCCCTGGCCAGCCACGCACGGG - Exonic
1163232898 19:16016013-16016035 GACCCCTGCCAACCAGGCCCCGG - Intergenic
1163282182 19:16324849-16324871 CGCCCCGACCAGCCCGGCCTCGG + Exonic
1163297401 19:16421213-16421235 GGCCCCCTCCAGCCTGTCACAGG - Intronic
1163370418 19:16898024-16898046 CGCCCCGGGCCTCCTGGCCCGGG - Intronic
1163417433 19:17195174-17195196 GCGGCCGACCAGCCTGGCCCTGG + Exonic
1163453795 19:17394233-17394255 GGTTCCGCCCAGCCTGGCCGTGG + Intergenic
1163509659 19:17727202-17727224 GGCCACGCCCAGCCTGGAGCTGG + Exonic
1163647923 19:18500683-18500705 GGCCCCGGGCAGCATGGCAGAGG + Intronic
1163660568 19:18574691-18574713 TGTCCCAGCCAGCCTGCCCCAGG - Intronic
1163698905 19:18777506-18777528 GCCCCCCGCCAGCCCGCCCCCGG + Exonic
1163721758 19:18901193-18901215 GGGCACGGCCAGCCAGCCCCAGG + Intronic
1163807004 19:19405676-19405698 CGCCCCGCCCAGCCGGGCGCGGG + Intronic
1164388293 19:27795042-27795064 GGGTCTGGCCAGCCTGTCCCTGG - Intergenic
1164816960 19:31211680-31211702 AGCCCAGGCCAGCCAGACCCTGG + Intergenic
1165058635 19:33194454-33194476 CGCCGCGGCCGGCCTGGGCCCGG - Intronic
1165079992 19:33301666-33301688 GCCGCCGGCCTGCCGGGCCCTGG - Exonic
1165114941 19:33523021-33523043 GGCTCCCACCAGCCTGGCCATGG - Intergenic
1165201784 19:34150694-34150716 GGACCAGGCCAGCCTGGCTAAGG - Intergenic
1165750480 19:38256409-38256431 GCCCCCGGCTAGCCCCGCCCTGG - Exonic
1165922612 19:39308142-39308164 GGCCCCGGCCCTGCCGGCCCAGG - Exonic
1165953998 19:39490291-39490313 GGCTCCAGCCAGTGTGGCCCTGG + Exonic
1166789790 19:45392004-45392026 GGCTCCGGCCCCCCGGGCCCTGG + Exonic
1167287604 19:48607296-48607318 GGCCACCACCAGCCTGGCACTGG + Exonic
1167288740 19:48613310-48613332 GGCCCCGGGCACCCTGGGACCGG + Exonic
1167299460 19:48670648-48670670 GGCACAGGCCCGCCTGGCCTGGG - Exonic
1167300139 19:48673232-48673254 AGCCCCGAGCAGCCTGGCCTAGG + Intergenic
1167344968 19:48939580-48939602 GGGCCCCCCCAGCCTGGGCCCGG - Exonic
1167487964 19:49774228-49774250 GGCCCAGGGCAGCCTGGCACAGG - Intronic
1167602814 19:50464578-50464600 GCCACCGGCCAGGCTGGCACAGG - Intronic
1168343882 19:55641229-55641251 TCCCCCAGCCTGCCTGGCCCCGG - Intronic
1168434087 19:56303788-56303810 GGCCACGGGCAGCCTTCCCCGGG + Intronic
925132763 2:1505133-1505155 GGCCCCGGGCAGCCGCGTCCTGG - Intronic
925224465 2:2171057-2171079 GGACCCCTCCAGCCAGGCCCCGG - Intronic
925388513 2:3479978-3480000 GACCCCTGCCAGCCTGGCGGTGG + Intronic
926122939 2:10254735-10254757 GACCCCAGCAGGCCTGGCCCAGG + Intergenic
926621189 2:15048583-15048605 AGTCCCTGCCAGCCTGGCCTTGG - Intergenic
927693504 2:25224472-25224494 TGACCCGGCAAGCCTGGGCCCGG + Intergenic
927702559 2:25277300-25277322 GGCCCCCTCCAGCCTGTCCGGGG + Intronic
929581986 2:43087074-43087096 GGCACTGCCCAGCCTGGCCTGGG - Intergenic
929604522 2:43226036-43226058 AGCCCCGGGCAGCGTGGCCGCGG + Intronic
929936582 2:46297978-46298000 TGCCCCGCGCAGCCCGGCCCTGG - Intronic
931671768 2:64654002-64654024 CGCCCCGGCCCGCCTCTCCCCGG + Intronic
931976224 2:67646859-67646881 GGGCCAGGCCAGCCCAGCCCAGG - Intergenic
934566921 2:95346436-95346458 GGCCCCGCCCCGCCCGGCACGGG - Intronic
934636307 2:95992427-95992449 TGCCGCGGCCAGGCTGGCCCCGG + Intergenic
934728088 2:96638101-96638123 GGCCCCTGCCAGCCCGCCCCCGG + Intronic
934797336 2:97112999-97113021 TGCCGCGGCCAGGCTGGCCCCGG - Intergenic
934836069 2:97590440-97590462 TGCCGCGGCCAGGCTGGCCCCGG + Intergenic
934856845 2:97734984-97735006 GGCCCCTGACAGGCTGCCCCTGG + Intronic
935112429 2:100105162-100105184 GGCCCCGCCCGGCCTTGCCCGGG + Intronic
935129820 2:100253311-100253333 GGGCCCCTCCACCCTGGCCCAGG - Intergenic
935313345 2:101806939-101806961 CGCCAGGGCCAGCCAGGCCCAGG - Intronic
935406897 2:102718827-102718849 GGCCGTGGCCGGCCTTGCCCTGG - Exonic
936049860 2:109214494-109214516 AGCCCAAGCCAGCCAGGCCCTGG + Intronic
936329713 2:111537245-111537267 GACCCAGGCCACGCTGGCCCCGG + Intergenic
937127862 2:119485606-119485628 GGCCCAGTTCAGCATGGCCCCGG - Intronic
937227135 2:120376387-120376409 GGCCCCAGGCAGCCTAACCCTGG + Intergenic
937395444 2:121530617-121530639 CGCCCCCGCCAGCCCCGCCCCGG + Intronic
938140517 2:128791230-128791252 GGCCCTGGCAGGGCTGGCCCTGG - Intergenic
938251251 2:129817265-129817287 GGCCCCTGGCAGGCTGGCTCAGG - Intergenic
942251593 2:174051877-174051899 GGCCCCACCCAGCTTGGGCCAGG - Intergenic
942302108 2:174572158-174572180 GGCCCCAGGCAGCCCAGCCCCGG - Exonic
942311383 2:174660257-174660279 GGACCCAGGCAGTCTGGCCCTGG - Intronic
944581618 2:201137296-201137318 CTCCCAGGGCAGCCTGGCCCAGG + Intronic
946171433 2:217898288-217898310 AGCCAGGGCCAGACTGGCCCAGG + Intronic
946409505 2:219509126-219509148 GCCCCCTGGCAGCCTGGCCTAGG - Intergenic
946413468 2:219527197-219527219 CACCCCTGCCTGCCTGGCCCAGG + Intronic
947049902 2:226030815-226030837 CTCCCCCGCCAGCGTGGCCCAGG + Intergenic
947717437 2:232349028-232349050 AGCCCAGGCCTGGCTGGCCCAGG + Intergenic
947728857 2:232417247-232417269 GGCCCGGGTCAGCCTGGGCCAGG - Intergenic
947768225 2:232651101-232651123 GGCCCCGGTCAGTTGGGCCCAGG + Intronic
947909025 2:233789679-233789701 GGCCACGGGGGGCCTGGCCCAGG + Intronic
948124752 2:235556394-235556416 GGCCCAGGCCAGTCTCGTCCAGG + Intronic
948201376 2:236131943-236131965 GGCCTGGGGCAGCCTGGGCCTGG - Intergenic
948408260 2:237739278-237739300 GGCCCGGGCCGAGCTGGCCCTGG - Intronic
948599200 2:239098573-239098595 GGCAGCGGCCAGCCTGCCTCAGG + Intronic
948678387 2:239612363-239612385 AGCCATGGCCAGCGTGGCCCTGG - Intergenic
948704653 2:239781345-239781367 AGCCTCTGCCAGCCTGACCCAGG - Intronic
948806771 2:240456456-240456478 TGGCCCAGCCAGCCTGGCCTGGG + Intronic
948976433 2:241466439-241466461 GTCCCCGGCCTGCCTGGCAGTGG - Intronic
948997774 2:241592464-241592486 GTCCCTGGCCAGCTTGCCCCAGG - Intronic
949035507 2:241814186-241814208 GGCACCAACCAGCCTGGCCGAGG + Intronic
1168893700 20:1309766-1309788 GCCACCTGCCAGCCTGGCGCGGG - Intergenic
1169073703 20:2749366-2749388 GGCCCCAGCCAGGCTGGCCTCGG + Intronic
1169367165 20:5001205-5001227 CCCGCCGGCCACCCTGGCCCCGG - Intronic
1170914917 20:20613578-20613600 GGCCCTGAGCAACCTGGCCCCGG + Intronic
1171784415 20:29449149-29449171 GGCCAGGGCCAGGCTGGGCCAGG + Intergenic
1171784416 20:29449151-29449173 GGCCTGGCCCAGCCTGGCCCTGG - Intergenic
1171848387 20:30291631-30291653 CCGCCCGGCCAGCCTGGTCCGGG - Intergenic
1172028923 20:31968202-31968224 GGCCTCGGCCAGCCCGGACCCGG + Exonic
1172203066 20:33140401-33140423 GGTCACGGCCAGCCTGGGCGTGG + Intergenic
1172445435 20:34990834-34990856 GGCCCCAGCCAGGCCAGCCCTGG - Intronic
1172882967 20:38213554-38213576 GGCCCAGGCCTGCCCGGCTCAGG + Exonic
1173771803 20:45666216-45666238 GGACCCGCCAAGCCAGGCCCGGG + Intronic
1174040214 20:47694220-47694242 TGCCCCCGCCACCCTGGCCCAGG - Intronic
1174287706 20:49484025-49484047 GGCCCGGCTCAGCCCGGCCCCGG - Intergenic
1174404061 20:50292518-50292540 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
1175293789 20:57895256-57895278 GGACCCGGTGAGCCTGGCCATGG - Intergenic
1175367742 20:58467331-58467353 CGCCCCAGGCAGCCAGGCCCGGG + Exonic
1175396696 20:58669320-58669342 GGCCCTGCCGAGCCGGGCCCGGG + Exonic
1175607303 20:60321467-60321489 GGCCCCGGGAAGCCTCGCCAGGG - Intergenic
1175943425 20:62548156-62548178 GGCCACGGGCAGCACGGCCCTGG + Intergenic
1175997680 20:62818783-62818805 GGTCCCGGCCTGCCTGGCGCTGG - Intronic
1176022368 20:62968295-62968317 GGCCCTGCCCAGCATGGCCATGG + Exonic
1176062586 20:63178845-63178867 GGCTGCGGCCAGCCGGCCCCCGG + Intergenic
1176086047 20:63296007-63296029 CGCCCCGGCCTGTCAGGCCCTGG - Intronic
1176087938 20:63306579-63306601 GGCCCTGCCCAGCCGGCCCCAGG + Intronic
1176125227 20:63472079-63472101 CGCCGCAGCCAGCCTGGCCGGGG + Intronic
1176125228 20:63472081-63472103 GACCCCGGCCAGGCTGGCTGCGG - Intronic
1176139067 20:63537284-63537306 GGCCCAGGTGAGCCTGGTCCCGG + Exonic
1176178998 20:63740900-63740922 GGCCCCAGCGAGCCAGGCCAGGG - Intronic
1176230973 20:64032745-64032767 GGCCCCTGCAGACCTGGCCCTGG - Intronic
1176240293 20:64072813-64072835 TGCCCCAGCCAGCCTGCCTCTGG + Intergenic
1176287017 21:5023654-5023676 GGCACCCCCCACCCTGGCCCAGG + Intronic
1176429417 21:6566896-6566918 GACACCGGCCAGACTGGGCCAGG - Intergenic
1176547396 21:8207823-8207845 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1176549185 21:8214134-8214156 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1176555301 21:8252032-8252054 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1176557078 21:8258355-8258377 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1176566347 21:8390870-8390892 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1176568117 21:8397172-8397194 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1176574223 21:8435057-8435079 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1176576020 21:8441392-8441414 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1176857600 21:13984948-13984970 TGCCCTGCCCAGCCTTGCCCTGG + Intergenic
1178493869 21:33071011-33071033 GGTCCCGGCCAGCCTGGGCCTGG + Exonic
1179499284 21:41796909-41796931 GGCCCCGGCCAGCTTTGTCCGGG + Intergenic
1179704811 21:43174358-43174380 GACACCGGCCAGACTGGGCCAGG - Intergenic
1179792240 21:43762455-43762477 TGCCCCTGCCTGCCGGGCCCAGG + Intergenic
1179870164 21:44239821-44239843 GGCACCCCCCACCCTGGCCCAGG - Intronic
1179886349 21:44315837-44315859 TGCCCGGGCTAGCCTGGGCCAGG - Intronic
1179975638 21:44864322-44864344 GGTGCCAGCCAGGCTGGCCCAGG + Intronic
1179998841 21:44986113-44986135 GGCCCAGGCCAGCCCGGGCAGGG + Intergenic
1180043871 21:45293941-45293963 GGCACCGGCCAGTCTCACCCAGG - Intergenic
1180088841 21:45523733-45523755 GGCCCCAGCCAGGCTGGAACTGG - Intronic
1180125805 21:45789609-45789631 TGCTCCGGCCACACTGGCCCCGG - Intronic
1180150151 21:45943222-45943244 GGCCCAGGACAGCCTGCCCCAGG + Intergenic
1180214325 21:46314954-46314976 GGCTCAGGCCAGCCTGGGCCAGG + Intronic
1180224172 21:46379846-46379868 GGCGGTGGACAGCCTGGCCCTGG + Intronic
1180748807 22:18110738-18110760 GGGCCCGGCGCGCCTGTCCCCGG + Intronic
1180748852 22:18110879-18110901 GCCCGCAGCCCGCCTGGCCCCGG - Intronic
1180834967 22:18925306-18925328 TGGCCTTGCCAGCCTGGCCCTGG + Intronic
1180871523 22:19149635-19149657 TGCCCCGCCCAGCCTTTCCCCGG - Intronic
1180876382 22:19177062-19177084 GGCCCTTCCCACCCTGGCCCAGG + Intronic
1180947712 22:19705771-19705793 GGACCCTGCCTGCCTGGCACCGG + Intergenic
1181314486 22:21962632-21962654 GGCCCCGGCCACCCAGGCTGGGG - Intronic
1181491528 22:23263267-23263289 GGCCCTCGGCCGCCTGGCCCAGG + Intronic
1181513396 22:23398772-23398794 AGCCCCGCCCAGCCCAGCCCAGG - Intergenic
1181636003 22:24175207-24175229 GGCCTCAGCCAGCCTGGGGCAGG + Intronic
1181648664 22:24247191-24247213 GGCCCTGGCCAGAGTGCCCCTGG + Intergenic
1182089438 22:27584012-27584034 GGCCCCTCCCAGCCAGCCCCAGG + Intergenic
1182150397 22:28023358-28023380 TGCCCAGGCCAGCCTTGCACAGG + Intronic
1182241666 22:28920962-28920984 GGAACCTGCCAGCCTGGCCCTGG - Intronic
1182299155 22:29328390-29328412 GGACCCTGCCAACCTGGCCTGGG - Exonic
1182892642 22:33831849-33831871 AGCCCCTCCCAGCCTGGCCCAGG + Intronic
1183173358 22:36204204-36204226 GGCCACAACCAGGCTGGCCCCGG - Intronic
1183360491 22:37380620-37380642 AGCCTTGGCCAGCCTGGCTCAGG - Intronic
1183362680 22:37390851-37390873 GACCCCAGCCAGGCTGGCCCAGG + Intronic
1183392256 22:37552318-37552340 GGCCCCGAACCACCTGGCCCAGG + Intergenic
1183457747 22:37931952-37931974 AGCCCAGGCCAGCCTGGTCTCGG - Intronic
1183486458 22:38089668-38089690 GTCCCCGCCCGGCCAGGCCCGGG - Exonic
1183545428 22:38452777-38452799 TTCCCCAGCTAGCCTGGCCCTGG + Intronic
1183545897 22:38454843-38454865 GGCGCCGGGCAGCCGGGACCCGG + Intronic
1183858434 22:40652360-40652382 GGGCCCGTGCAGCCTGGTCCCGG + Intergenic
1183988016 22:41579961-41579983 GCCCCCTGCCAGCCTTGGCCTGG + Intronic
1184098401 22:42328968-42328990 GGCTCCAGCCGGCCTGGGCCTGG - Intronic
1184129353 22:42508615-42508637 GTCCCCTGCCAGCCTGGGACAGG - Intergenic
1184139552 22:42570708-42570730 GTCCCCTGCCAGCCTGGGACAGG - Intronic
1184155189 22:42662545-42662567 CACCCCGGCCCGCCCGGCCCGGG - Intergenic
1184169865 22:42752474-42752496 TTCCCCTTCCAGCCTGGCCCTGG - Intergenic
1184417342 22:44359921-44359943 TGCCTCAGCCAGCCTGCCCCTGG - Intergenic
1184458422 22:44624271-44624293 GGCCTCCACCAGCCTGGGCCTGG - Intergenic
1184561197 22:45263808-45263830 AGCCCTGGCCAGCCTTGCTCTGG - Intergenic
1184653250 22:45928823-45928845 CTACCCGGCCATCCTGGCCCTGG + Intronic
1184676374 22:46045395-46045417 GCCCCTGGGCAGCCTGGCCTCGG - Intergenic
1184679170 22:46061326-46061348 GGCTCCGGCCGGGCGGGCCCGGG - Intronic
1184682685 22:46080434-46080456 GGCCTCGGCCACCCCGGCACAGG - Intronic
1184687830 22:46104470-46104492 GCCCCCGCCCAGTCTGGCCTTGG + Intronic
1184698228 22:46151155-46151177 GGCCCCGGACAGACCGACCCTGG + Intronic
1184930560 22:47678009-47678031 GAGCCCGGCCATCCTGGCTCTGG - Intergenic
1184974578 22:48051976-48051998 CGCCCCGGCCAGGCCAGCCCAGG + Intergenic
1185047592 22:48536878-48536900 GCCCCCGGACACCCTGGCACTGG + Intronic
1185079589 22:48702316-48702338 GTCCCAGCCCAGCCAGGCCCTGG - Intronic
1185088942 22:48755350-48755372 GGCCCAGGCGAGCCTGTCCCAGG + Intronic
1185113468 22:48917735-48917757 GGCCCGGGCCAGGCTGTCCCTGG - Intergenic
1185152077 22:49169549-49169571 GGCCGGGGCCAGCCTGGTGCAGG - Intergenic
1185259619 22:49854101-49854123 CGCCCCCGCCCGCCTGGCCCCGG - Intronic
1185269668 22:49923184-49923206 GGCCCAGGACAGCCCGGCCAGGG - Intronic
1185274141 22:49943169-49943191 GGCCCCAGCCTACCTGGCCCCGG - Intergenic
1185281263 22:49971104-49971126 GGCCCCGACCAGCCGGTCACAGG + Intergenic
1185320690 22:50198998-50199020 TGCCCCTGGCATCCTGGCCCTGG + Exonic
1185380693 22:50506400-50506422 GGCCCCTGCCTGCCTGCCCTGGG + Exonic
1203252269 22_KI270733v1_random:124108-124130 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1203254070 22_KI270733v1_random:130450-130472 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1203260326 22_KI270733v1_random:169194-169216 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1203262126 22_KI270733v1_random:175529-175551 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1203285056 22_KI270734v1_random:150605-150627 TGGCCTTGCCAGCCTGGCCCTGG + Intergenic
950153942 3:10708340-10708362 CCCCACAGCCAGCCTGGCCCTGG + Intergenic
950161492 3:10764294-10764316 CCCCCGGGCCAGCCAGGCCCGGG + Intergenic
950161494 3:10764296-10764318 AGCCCGGGCCTGGCTGGCCCGGG - Intergenic
950282455 3:11719646-11719668 GGCACCGGCCAACCTGAGCCGGG + Intronic
950441810 3:13014929-13014951 GGCCCCAGCGAGCCTGGGGCAGG + Intronic
950509843 3:13419715-13419737 GGCCCGAGCCGGCCTGACCCGGG - Intronic
950738921 3:15034150-15034172 GGCCGCTTCCAGCCTTGCCCTGG - Intronic
950831531 3:15879768-15879790 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
953025695 3:39143683-39143705 CACCCAGGCCTGCCTGGCCCTGG - Exonic
953099301 3:39809599-39809621 GGCTGCGGCCAGGCTGGCCCTGG + Exonic
953405972 3:42659953-42659975 GCCCCCAGACAGGCTGGCCCAGG + Intronic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
953717244 3:45326061-45326083 GCCCAGGGCCAGCCTGGGCCAGG - Intergenic
953931784 3:47009349-47009371 GCCCCCGGCAGGCCTGGCCCGGG + Exonic
953982662 3:47420419-47420441 GGCCCCTGGAAGCCTGGCTCTGG - Intronic
954035338 3:47848230-47848252 GGCAGCGGCCCGCCCGGCCCCGG - Exonic
954303623 3:49714198-49714220 CGCCCCCGCCTGCCTTGCCCAGG - Intronic
954464799 3:50648107-50648129 GGCCCTGGCCAGGAGGGCCCAGG + Exonic
954629411 3:52039981-52040003 GCCCCCACCCAGCCGGGCCCGGG - Intergenic
954634759 3:52065439-52065461 GGAGCCGGCTGGCCTGGCCCAGG + Intergenic
954634796 3:52065604-52065626 GGCCCCACCCAGCCTGACTCCGG + Intergenic
954733665 3:52686404-52686426 GGCCACGTGCAGACTGGCCCAGG + Intronic
960140062 3:114142961-114142983 GCCCCCAGCAGGCCTGGCCCTGG + Intronic
960972822 3:123151622-123151644 GCCCCCCGCCACCCTGACCCTGG + Intronic
961042797 3:123689175-123689197 GTCCCCAGCCACCCTGGCCAGGG - Intronic
961455059 3:127019939-127019961 GGCCCTGCCCAGCCTGCCCCTGG + Intronic
963169993 3:142241016-142241038 GGCCCTGGTCATCCTTGCCCAGG + Intergenic
966517135 3:180830229-180830251 GGCCACGGCCACCCCGACCCCGG + Intronic
966849383 3:184155374-184155396 GGCCGCGGCCCTCCCGGCCCAGG - Exonic
966931651 3:184679259-184679281 GCCCCTGGCCAGCCTTCCCCAGG + Intronic
967465847 3:189805614-189805636 GGCCTTGGCCAGCCTTGCCGAGG + Intronic
967465848 3:189805616-189805638 GGCCTCGGCAAGGCTGGCCAAGG - Intronic
967930418 3:194686731-194686753 GGCCCCTGCCAGGCTCGGCCCGG - Exonic
968230611 3:197002944-197002966 GGCCGCGGCCAGGCCGTCCCAGG - Exonic
968477363 4:818293-818315 GGTGGCGGCCAGCCAGGCCCAGG - Intronic
968551141 4:1223865-1223887 GGCCCCACACAGCCAGGCCCAGG - Intronic
968658696 4:1789823-1789845 GGCCCGGCCCAGCCCAGCCCTGG - Intergenic
968664781 4:1815151-1815173 AGCCCCGGAGACCCTGGCCCAGG - Intronic
968929564 4:3571552-3571574 GTCCCCGGCTAGCATGGCCTGGG + Intergenic
969056600 4:4406517-4406539 GAGCCCGGGCAGGCTGGCCCCGG + Intronic
969694431 4:8726548-8726570 TGCCCCAGCCAGCCTGAGCCTGG - Intergenic
969853865 4:9983467-9983489 AGCCCAGGCCCCCCTGGCCCAGG + Intronic
973646239 4:52953933-52953955 GAACCCAGGCAGCCTGGCCCAGG - Intronic
973981630 4:56313087-56313109 CGCCTCGCCCAGCCTGGCCCAGG - Intronic
977773882 4:100894221-100894243 TACCCCGGCCAAACTGGCCCTGG + Intergenic
977894032 4:102344653-102344675 AGCCCAGGCCAGGATGGCCCCGG - Exonic
979545262 4:121932966-121932988 GGCCCCTGACAGCCTGGCGCCGG + Exonic
979559616 4:122087612-122087634 GGCCCAGGTCAGACTGGCCCAGG - Intergenic
985497605 5:218437-218459 GGCCCCCGCCTGCCCCGCCCCGG - Intronic
985517623 5:354975-354997 GGCTGCGGCCAGCCGGGACCCGG - Intronic
985580531 5:693396-693418 AGCCCCGCCCAGCCCGGTCCCGG + Intergenic
985669706 5:1201085-1201107 GGACCCCTCCAGCCTGGCTCTGG - Intergenic
985737717 5:1594354-1594376 GGCCCCCGCCTGCCCCGCCCCGG + Intergenic
985812957 5:2103584-2103606 AGCCCAGGCCGGCCAGGCCCCGG - Intergenic
985892146 5:2724374-2724396 GGCCACGGCCGGTCTGGCACTGG - Intergenic
987079228 5:14411429-14411451 GGCCCGAGCCAGCAGGGCCCAGG + Intronic
988264154 5:28928194-28928216 TGCCGCGGCCGGGCTGGCCCCGG + Intergenic
990557556 5:56951613-56951635 GCCCCCGGCCCACCGGGCCCGGG - Intronic
990984113 5:61626133-61626155 GGCCCCGGACAGGCTGGCGCGGG + Intergenic
991609464 5:68435559-68435581 GCCCTGGGGCAGCCTGGCCCTGG - Intergenic
994098993 5:95874093-95874115 TGCCTCTGCCAGCCTGTCCCAGG - Intergenic
994353807 5:98773731-98773753 GGCCCCAGCCAGCGTGGGCTCGG - Intronic
994701712 5:103142296-103142318 GCAGCCGGCCAGCCTGGCCCTGG - Intronic
995199327 5:109409621-109409643 GGCCCTGTCCAGCCCGGACCCGG - Intronic
997310661 5:132878202-132878224 AGCCCAGCCCAGTCTGGCCCAGG + Exonic
997663086 5:135604296-135604318 GCCCAGGGCCAGCCTGGGCCAGG + Intergenic
998039689 5:138944462-138944484 GGCCCGGGTCAGCCCAGCCCAGG + Intergenic
998280491 5:140802505-140802527 GGCCACGGCCAGCGTGTCCGTGG + Exonic
999721823 5:154404190-154404212 GGCCGGAGTCAGCCTGGCCCGGG + Exonic
1000254938 5:159528660-159528682 GGTCCCTGCCAGCCTGCCCCTGG - Intergenic
1001052860 5:168426738-168426760 GTCCCCGGCCTGCCATGCCCTGG + Intronic
1001065177 5:168529972-168529994 GGCCGCGGCCATCCTGGGCGGGG + Exonic
1001495918 5:172187797-172187819 GGACCCGGCCAGCCTGGCTCCGG - Intronic
1001530679 5:172459363-172459385 GGCAACAGCAAGCCTGGCCCTGG - Intergenic
1002164160 5:177334249-177334271 AGCCCCGCCCTGCCTGGGCCTGG - Intronic
1002181131 5:177431639-177431661 GGCCCAGCCCAGCCGGGGCCAGG - Intronic
1002279051 5:178120330-178120352 GCCCCGGGCCAGCCAGGCCCGGG + Exonic
1002279053 5:178120332-178120354 TGCCCGGGCCTGGCTGGCCCGGG - Exonic
1002429303 5:179193876-179193898 GGCCCCTCCCAGGCTGCCCCTGG - Intronic
1002896304 6:1382339-1382361 GGCCCGGGGCTGCCTGGCACGGG + Intergenic
1002926781 6:1609717-1609739 CGCGCCGGCCGCCCTGGCCCGGG - Intergenic
1003122388 6:3328945-3328967 TTCCCCGGCCAGCCTGGACCAGG + Intronic
1003979826 6:11379120-11379142 GGCACAGGCCAGGCAGGCCCTGG + Intronic
1004151187 6:13121288-13121310 GGACCCAGGCAGCCTGGCTCTGG - Intronic
1004731839 6:18366516-18366538 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1006027836 6:31158576-31158598 GGCCGCGCCCCTCCTGGCCCCGG + Exonic
1006081852 6:31572418-31572440 ATCCCCGGCCTGCCTGGGCCTGG + Intronic
1006116154 6:31777124-31777146 AGCCCGGGCCAGCCCTGCCCAGG - Exonic
1006393527 6:33772588-33772610 GTTCCCGGTCAGCCTGTCCCAGG - Exonic
1006625609 6:35395640-35395662 GGTCCTGTCCTGCCTGGCCCTGG - Intronic
1006638863 6:35478596-35478618 GGCCTCATCCAGCGTGGCCCTGG - Intronic
1007111043 6:39313709-39313731 GGCCCCGCCCGGCCTGACCCGGG - Intronic
1007367581 6:41405923-41405945 GGCCACTGCCAGCCCTGCCCAGG + Intergenic
1007478928 6:42137410-42137432 GGCTGGTGCCAGCCTGGCCCTGG + Intronic
1008013308 6:46491136-46491158 CGCGCCGGCCAGGCTCGCCCAGG - Intronic
1011945010 6:92890368-92890390 GGCACCAGCCAGCCTGCCCAAGG - Intergenic
1013196377 6:107848365-107848387 GGGCCCGGCCAGGCTGGTCAGGG - Intergenic
1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG + Intergenic
1015845243 6:137513441-137513463 GGCCCCGGCCTGCTGGGCTCAGG - Intergenic
1018872825 6:167796299-167796321 GGCACCGGCCAGACTGGCAGTGG - Intronic
1019060473 6:169254052-169254074 GGCCCCTGCCAGACAGGCCTGGG + Intergenic
1019172014 6:170138045-170138067 GGCCTCGCCCGGCCCGGCCCTGG + Intergenic
1019289306 7:242556-242578 GGCCCCCTCCATCCTGGCCAGGG + Intronic
1019347401 7:537788-537810 GGTCCCTGGCAGGCTGGCCCCGG - Intergenic
1019389308 7:776776-776798 GGCCCCCGCCACCCAGGCCATGG + Intronic
1019438488 7:1033945-1033967 GCCCCCGGCCAGCCTGATGCTGG - Intronic
1019504732 7:1385254-1385276 CGCCCCGGCCTGCCCTGCCCCGG - Intergenic
1019514968 7:1435485-1435507 GGCCCAGGCCCTCCTGTCCCAGG - Intronic
1019525160 7:1477449-1477471 GGCCCCTGCAAGGCTCGCCCAGG + Intronic
1019563012 7:1667254-1667276 CTCCCTGGGCAGCCTGGCCCCGG - Intergenic
1019577652 7:1745289-1745311 GGCCGCGGCGGCCCTGGCCCAGG - Exonic
1019697133 7:2452171-2452193 GGCCTCAGCCAGCGTGGTCCTGG - Intergenic
1019735169 7:2646876-2646898 CGCCCTGGCCTGCCTCGCCCTGG + Exonic
1021106557 7:16645459-16645481 CCCCCCGGCCAGGCTGGCCGCGG + Intronic
1021106559 7:16645461-16645483 GGCCGCGGCCAGCCTGGCCGGGG - Intronic
1021659621 7:22907163-22907185 GGCCCGAACCAGCCTGGGCCAGG - Intergenic
1022112397 7:27239658-27239680 GGGCCAGGCCAGCCCAGCCCCGG + Intergenic
1022522501 7:31017182-31017204 TGCCCCGCTCTGCCTGGCCCAGG - Intergenic
1023684922 7:42724046-42724068 GGCCCCGGCCAGGCAGGGCTGGG + Intergenic
1023982278 7:45077078-45077100 GGCTCCGGACAACCTGACCCAGG - Intergenic
1024005816 7:45224420-45224442 TGCTCCTGCCAGCTTGGCCCTGG + Intergenic
1024246115 7:47471710-47471732 GGCCTCAGCCAGGCTTGCCCAGG + Intronic
1024533804 7:50413518-50413540 GACCACAGCCAGCCTGTCCCTGG + Intergenic
1024555906 7:50603531-50603553 AGCCCCAGCCAAGCTGGCCCAGG + Intronic
1024965610 7:55019958-55019980 GGCGCCCGCCAGCCTGGCCCCGG + Intronic
1026896592 7:74013221-74013243 GCCAGCGGCCAGCATGGCCCAGG + Intergenic
1026979201 7:74516768-74516790 CGCCCCTGCCCGCCTTGCCCTGG + Intronic
1027361791 7:77416572-77416594 CGCCCCGGCGGGCCTGGTCCTGG - Intergenic
1027419356 7:78004700-78004722 GGCCTCTGCCAGTCTGGGCCAGG - Intergenic
1027472382 7:78589410-78589432 GGACCCAGCCAGCCTGGCTCTGG + Intronic
1028713705 7:93939988-93940010 TGCCTCGACCAGCCTGCCCCAGG + Intergenic
1029207734 7:98879188-98879210 GGCCCAGGCCGGGCTGGCGCCGG - Intronic
1029363019 7:100100841-100100863 GGCCCCGGCCTGCCCGCCCCCGG + Intronic
1029456625 7:100675193-100675215 GGCCCCAGGCGGCCTGGCCGCGG - Intronic
1032018183 7:128392789-128392811 CTCCCAGGGCAGCCTGGCCCCGG + Exonic
1032368271 7:131321410-131321432 GGCCCCACCCCGACTGGCCCCGG - Intronic
1034197919 7:149262277-149262299 GGACCCGGCCTGTCGGGCCCGGG - Exonic
1034227927 7:149497451-149497473 GGCCCCAGGCGGCCCGGCCCCGG - Intronic
1034338346 7:150337569-150337591 GGCCAGCGACAGCCTGGCCCAGG + Exonic
1034491006 7:151392967-151392989 AGCCAGGGACAGCCTGGCCCAGG - Intronic
1034715811 7:153240239-153240261 GGCCCAGCCCAGCCTGCCACCGG - Intergenic
1035187715 7:157139167-157139189 GGCGCCCGCCCGCCCGGCCCGGG - Exonic
1035315826 7:157997254-157997276 AGCCCAGGCCAGGCGGGCCCAGG - Intronic
1035344971 7:158191853-158191875 CTCCCCGGCAAGCCTGCCCCGGG - Intronic
1035527758 8:327014-327036 GGCTCCGGAGAGGCTGGCCCTGG - Intergenic
1036432427 8:8702836-8702858 CGCCCCGGCCAGCCCGGTCACGG + Exonic
1036644453 8:10602977-10602999 GGGCCCGTCTAGCCTGGCCAGGG - Intergenic
1036999830 8:13705090-13705112 GGCCCGGGGAAGCCTGGACCTGG - Intergenic
1038492672 8:27981902-27981924 GGCCCCAGCCAGCCCCTCCCAGG + Intronic
1039745604 8:40423338-40423360 GGCTCTGGCCAGACGGGCCCTGG + Intergenic
1039885927 8:41653924-41653946 ACCCCCGGCCAGGCAGGCCCCGG - Intronic
1039979191 8:42392045-42392067 GGCCCCGGCCCCCCGCGCCCCGG - Intronic
1041196452 8:55406516-55406538 GGCCCGGGTCTGCCTGGCCCCGG + Intronic
1041839178 8:62248973-62248995 GTCCCCGCCCGGCCCGGCCCAGG - Exonic
1047275539 8:123402302-123402324 CTCCCAGGGCAGCCTGGCCCAGG - Intronic
1047288210 8:123506460-123506482 GGTCGGGGGCAGCCTGGCCCAGG + Exonic
1047288212 8:123506472-123506494 GGACCTGGTCAGCCTGGGCCAGG - Exonic
1047765010 8:127983219-127983241 TGGCCCTGCCAGCCTGGCCATGG + Intergenic
1048967119 8:139623444-139623466 GGCTCCAGCCAGCCTGTACCAGG + Intronic
1049109678 8:140635341-140635363 GGCCCCGGCTCGCCCGCCCCCGG + Intronic
1049361451 8:142214166-142214188 GGGTGCGGCCCGCCTGGCCCTGG + Intronic
1049471062 8:142775205-142775227 CACCCCGGCCACCCTGGCCCTGG - Intronic
1049588966 8:143446954-143446976 TCCCCAAGCCAGCCTGGCCCTGG + Intronic
1049592515 8:143469021-143469043 GGCCCTGGGGAGCCTGGCCAGGG - Intronic
1049615426 8:143573807-143573829 GGCCCAGTCCAGCCAGCCCCGGG - Intergenic
1049616029 8:143576080-143576102 GGCGCTGGCCCGACTGGCCCAGG - Exonic
1049655534 8:143795371-143795393 GGCCTCGGGCTCCCTGGCCCTGG + Intronic
1049670908 8:143869461-143869483 GGCCAAGGCCAGCATCGCCCAGG - Exonic
1049721205 8:144116304-144116326 GGCCTCAGCCCGCCTGGCTCTGG + Exonic
1049757186 8:144315922-144315944 GGCTCCAGCCAGGATGGCCCAGG - Exonic
1049803489 8:144528748-144528770 TGCCCCCGCCCACCTGGCCCTGG + Exonic
1051170625 9:14315500-14315522 GGCCCCGCCCCGCCTGCACCCGG - Intronic
1051780650 9:20684724-20684746 GGCCGCGTCCTGCCTGGCCTGGG + Intronic
1052941158 9:34132963-34132985 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1053004128 9:34593179-34593201 GGCCCCGGCCAAGCCGCCCCGGG - Intergenic
1053287442 9:36859160-36859182 GCCCCCGGCAAGCCAGGCCTGGG + Intronic
1054977502 9:71165108-71165130 GGACCCAGTCAGCCTGGCTCCGG - Intronic
1056643310 9:88388715-88388737 GGCCCAGGCCCGCCCAGCCCGGG - Intronic
1057211866 9:93204881-93204903 GACCCTGTCCTGCCTGGCCCTGG + Intronic
1057279950 9:93702036-93702058 GGCCCCATCCAGCGGGGCCCTGG - Intergenic
1057336207 9:94157080-94157102 GGCCTCGGGCAGCCTGGCCACGG - Intergenic
1057571058 9:96204398-96204420 GGCCCAGGCCTGCCTAGCCCTGG - Intergenic
1057838995 9:98469898-98469920 GGCCACGGTCAGCATGGCACTGG - Intronic
1058334041 9:103803459-103803481 GGCCCAGCCCAGCAAGGCCCAGG - Intergenic
1059208448 9:112487372-112487394 GGCTCCGGTCCGCCTGCCCCGGG + Intronic
1059351276 9:113666895-113666917 GACCCCAGACAGTCTGGCCCTGG - Intergenic
1060110650 9:120904276-120904298 GGCACCTGCCACCCTGGGCCTGG - Exonic
1060778455 9:126393775-126393797 GGCCCCTGCCAGCCCTGGCCAGG - Intronic
1060785597 9:126449615-126449637 GGCCCAGGCCAGCCCTGTCCAGG - Intronic
1060824999 9:126682962-126682984 ATCCCAGGCCAGCCTGGCCAGGG - Intronic
1061108851 9:128552734-128552756 GGCCCCGGGCAGCCGACCCCCGG + Intronic
1061123157 9:128656617-128656639 GGCCCTGGCCGCCCCGGCCCCGG + Exonic
1061242839 9:129384186-129384208 GGCCCCGTCCATACTGGCCTCGG - Intergenic
1061322320 9:129839063-129839085 AGCCCCGGCCAGCCTGGCATGGG - Intronic
1061464473 9:130766763-130766785 GGCCCCACCCTGCCTTGCCCCGG + Intronic
1061490231 9:130940192-130940214 GGCCGCGTCCAGCCTGGGCTGGG + Intergenic
1061502953 9:131014073-131014095 GGCCAAGGCCAGCTGGGCCCAGG - Intronic
1061571841 9:131482590-131482612 GGCCCCTTCCACCCAGGCCCTGG - Intronic
1061628978 9:131859571-131859593 GGGCCTGGCCAGGCTGGCTCTGG + Intergenic
1061777580 9:132975911-132975933 GTCCCCAGCCAGCCTCACCCAGG - Intronic
1062022784 9:134327026-134327048 GGCTCCGGCCTCCCTGGCCTGGG + Intronic
1062117800 9:134818593-134818615 GGCTCCAGGCACCCTGGCCCAGG - Intronic
1062342761 9:136101039-136101061 GGCCCAGGGCAGTCCGGCCCAGG - Intergenic
1062358486 9:136176365-136176387 TGCCCAGGACAGCCTGGCCCTGG - Intergenic
1062370057 9:136234060-136234082 TGTCCCGGCCAGGCTGCCCCAGG - Intronic
1062474631 9:136720911-136720933 GGCCCGGCCCAGCCTTCCCCAGG - Intronic
1062525041 9:136974796-136974818 GGCCCCGGCCAGCATCCTCCGGG - Intergenic
1062532015 9:137006198-137006220 GGACCAGGCCAGGCTGGACCTGG - Intergenic
1062534941 9:137017301-137017323 GGCCGAGGCCAGCTTGGCCTTGG + Exonic
1062626071 9:137441908-137441930 AGCCCCACCCAGCCCGGCCCTGG - Intergenic
1062655755 9:137604154-137604176 GGCCTCTCCCAGCCTGGCCCGGG + Intergenic
1062696705 9:137879374-137879396 GGCACAGGGCAGACTGGCCCAGG - Intronic
1062722534 9:138051891-138051913 GGCCCGGGCCAGGCAGCCCCTGG + Intronic
1203772005 EBV:54223-54245 CGCCCCGCCCAGGCTGGCCTCGG - Intergenic
1203772816 EBV:58114-58136 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772823 EBV:58129-58151 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772830 EBV:58144-58166 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772837 EBV:58159-58181 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772844 EBV:58174-58196 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203468674 Un_GL000220v1:107259-107281 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1203470471 Un_GL000220v1:113594-113616 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1203476495 Un_GL000220v1:151231-151253 GGGTCGGGCCCGCCTGGCCCTGG + Intergenic
1203478292 Un_GL000220v1:157566-157588 GCCCCCGGCGCGCCGGGCCCGGG + Intergenic
1186849829 X:13569633-13569655 CGCCCTGGCAAGCCTGGCCGAGG - Exonic
1186874044 X:13799532-13799554 GGTCTTGACCAGCCTGGCCCAGG + Intronic
1189361783 X:40358965-40358987 TTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1189658990 X:43277901-43277923 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1191252716 X:58267132-58267154 CGTCCCCCCCAGCCTGGCCCAGG + Intergenic
1192177408 X:68894657-68894679 CGCCCCGGCCAGGCTGGCACAGG + Intergenic
1192177429 X:68894726-68894748 CGCCCCGGCCAGGCTGGCACAGG + Intergenic
1192225810 X:69226969-69226991 GGCCTGGGCCAGCTTGGCTCTGG + Intergenic
1192266065 X:69538784-69538806 GGTCCCGTCCAGCCAGGCCCGGG + Intergenic
1197754614 X:129984623-129984645 GGCTCCTCCCAGCCTTGCCCCGG - Intronic
1197884365 X:131202989-131203011 GACCCCAGGCAGCCTGGCTCTGG + Intergenic
1198750329 X:139932260-139932282 GCCCCCGGCCTGCCTGACCCGGG + Intronic
1199715229 X:150503339-150503361 GCCCCCGTCCTGCCAGGCCCTGG + Intronic
1199721321 X:150544577-150544599 GGCCTCGGTGAGCCAGGCCCTGG - Intergenic
1200090275 X:153632757-153632779 GCCTGTGGCCAGCCTGGCCCTGG + Intergenic
1200093524 X:153646959-153646981 GGCCGGCGCCAGCCTGGCCTCGG - Intronic
1200133739 X:153864767-153864789 GGCCCCGGCCAGCCGGGTCCAGG - Intronic