ID: 1071568699

View in Genome Browser
Species Human (GRCh38)
Location 10:86684801-86684823
Sequence CTCCCTCACAGGCCCCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071568695_1071568699 -7 Left 1071568695 10:86684785-86684807 CCACCTTCCACACTGTCTCCCTC 0: 1
1: 0
2: 6
3: 121
4: 1202
Right 1071568699 10:86684801-86684823 CTCCCTCACAGGCCCCCGACAGG No data
1071568696_1071568699 -10 Left 1071568696 10:86684788-86684810 CCTTCCACACTGTCTCCCTCACA 0: 1
1: 0
2: 2
3: 68
4: 601
Right 1071568699 10:86684801-86684823 CTCCCTCACAGGCCCCCGACAGG No data
1071568691_1071568699 -3 Left 1071568691 10:86684781-86684803 CCCCCCACCTTCCACACTGTCTC 0: 1
1: 0
2: 4
3: 85
4: 661
Right 1071568699 10:86684801-86684823 CTCCCTCACAGGCCCCCGACAGG No data
1071568692_1071568699 -4 Left 1071568692 10:86684782-86684804 CCCCCACCTTCCACACTGTCTCC 0: 1
1: 0
2: 4
3: 71
4: 709
Right 1071568699 10:86684801-86684823 CTCCCTCACAGGCCCCCGACAGG No data
1071568693_1071568699 -5 Left 1071568693 10:86684783-86684805 CCCCACCTTCCACACTGTCTCCC 0: 1
1: 0
2: 4
3: 72
4: 687
Right 1071568699 10:86684801-86684823 CTCCCTCACAGGCCCCCGACAGG No data
1071568694_1071568699 -6 Left 1071568694 10:86684784-86684806 CCCACCTTCCACACTGTCTCCCT 0: 1
1: 3
2: 7
3: 92
4: 879
Right 1071568699 10:86684801-86684823 CTCCCTCACAGGCCCCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071568699 Original CRISPR CTCCCTCACAGGCCCCCGAC AGG Intronic
No off target data available for this crispr