ID: 1071569688

View in Genome Browser
Species Human (GRCh38)
Location 10:86690228-86690250
Sequence CACTGGGAGGGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1935
Summary {0: 1, 1: 3, 2: 12, 3: 185, 4: 1734}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071569688_1071569702 -2 Left 1071569688 10:86690228-86690250 CCTCCTTCCCTCCCCTCCCAGTG 0: 1
1: 3
2: 12
3: 185
4: 1734
Right 1071569702 10:86690249-86690271 TGGGTCAGGAGCCAGGACCAGGG No data
1071569688_1071569701 -3 Left 1071569688 10:86690228-86690250 CCTCCTTCCCTCCCCTCCCAGTG 0: 1
1: 3
2: 12
3: 185
4: 1734
Right 1071569701 10:86690248-86690270 GTGGGTCAGGAGCCAGGACCAGG No data
1071569688_1071569703 6 Left 1071569688 10:86690228-86690250 CCTCCTTCCCTCCCCTCCCAGTG 0: 1
1: 3
2: 12
3: 185
4: 1734
Right 1071569703 10:86690257-86690279 GAGCCAGGACCAGGGAGACCTGG No data
1071569688_1071569698 -9 Left 1071569688 10:86690228-86690250 CCTCCTTCCCTCCCCTCCCAGTG 0: 1
1: 3
2: 12
3: 185
4: 1734
Right 1071569698 10:86690242-86690264 CTCCCAGTGGGTCAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071569688 Original CRISPR CACTGGGAGGGGAGGGAAGG AGG (reversed) Intronic
900088271 1:908783-908805 AGGTGGGAGGGGAGGGAATGAGG + Intergenic
900135576 1:1115736-1115758 CCCGGGGAGGGGTGGGGAGGGGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900568436 1:3346744-3346766 CACTGTGAGGTGAGGGTGGGTGG + Intronic
900587455 1:3440064-3440086 CACTGGGAGGGGTGGACAGGAGG - Intergenic
900588403 1:3445101-3445123 GACTGGGAGGGGCTGGAAGTAGG - Intergenic
900619914 1:3581926-3581948 TCCTGGGAGGGCAGGGAGGGAGG - Intronic
900660176 1:3778203-3778225 CTCTGGGAGGGTAGGCCAGGCGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900830126 1:4959882-4959904 GAAGGGGAGGGAAGGGAAGGGGG + Intergenic
900853357 1:5161569-5161591 CACTGGGAGGGGCTGCAGGGAGG + Intergenic
900895846 1:5482346-5482368 CACTGGGAGGGGTAACAAGGAGG + Intergenic
901017346 1:6239573-6239595 GGCAGGAAGGGGAGGGAAGGGGG - Intergenic
901136184 1:6997900-6997922 CACTGGGAGGCCAAGGAGGGCGG - Intronic
901304286 1:8221430-8221452 CTCTGGGAGGTGAAGGCAGGAGG - Intergenic
901460076 1:9386143-9386165 AATGGGGAAGGGAGGGAAGGTGG - Intergenic
901499478 1:9642845-9642867 CATTGGGAGGCCAAGGAAGGTGG + Intergenic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901737326 1:11320614-11320636 CATGGGCAGAGGAGGGAAGGTGG - Intergenic
901879078 1:12183309-12183331 CTCTGGGAGACGAGGGGAGGTGG + Intronic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902283026 1:15388291-15388313 CCTGGGGAGGGAAGGGAAGGAGG - Intronic
902283041 1:15388324-15388346 CCTGGGGAGGGGAGGGAGGGAGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902439737 1:16421610-16421632 GGCTGAGAGGGGAGGGCAGGGGG - Intronic
902450577 1:16494364-16494386 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
902513756 1:16979411-16979433 CAGGGAGAGGGGAGGGAAAGGGG + Intronic
902752640 1:18528047-18528069 CACTGGGCGGGGGGGGGGGGGGG + Intergenic
902764970 1:18607991-18608013 TTCTGGAAGAGGAGGGAAGGTGG - Intergenic
902765027 1:18608182-18608204 CACTGGGGGGGGCGGGGGGGCGG + Intergenic
902919595 1:19657978-19658000 CCCTGGGAGAGGGGAGAAGGCGG - Exonic
903000591 1:20262853-20262875 CACTCAGAGGGGAGGGCACGTGG - Intergenic
903220847 1:21868967-21868989 AACTAGGAGGGAAGGGCAGGTGG + Intronic
903528430 1:24011012-24011034 CGAGGGGAGGGGAGGGGAGGAGG - Intergenic
903580709 1:24368419-24368441 CACTGGGAGGGCTGGCCAGGTGG - Intronic
903643528 1:24876417-24876439 CCCTGGGGGGCCAGGGAAGGAGG + Intergenic
903681689 1:25101833-25101855 CACAGGAAGGAGAGGGGAGGAGG - Intergenic
903689800 1:25165056-25165078 CACAGGGAGGGGTGGAGAGGTGG + Intergenic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903792760 1:25906064-25906086 CGCAGGGAAGGGAGGGAGGGAGG + Intronic
903867625 1:26410678-26410700 GAGAGGGAGGGGAGGGGAGGGGG + Intergenic
903935264 1:26890812-26890834 CAAGGGGAGGGGACGGGAGGGGG + Exonic
903953862 1:27011903-27011925 CACGGGGTGGAGGGGGAAGGGGG + Intronic
903996419 1:27307806-27307828 GACTGGGGTGGGAAGGAAGGGGG - Exonic
904352446 1:29917429-29917451 GAAGGGGAGGGGAGGGGAGGGGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904378692 1:30097119-30097141 CCATGGGAGGGGAGGGGAGGGGG - Intergenic
904420633 1:30388911-30388933 AACTGGGAAGAGTGGGAAGGGGG - Intergenic
904499959 1:30908095-30908117 CACTGGGAGGTGGGGGAACAGGG + Intronic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
904669887 1:32155998-32156020 CTCTGGGAGGCCAGGGCAGGTGG - Intronic
904681208 1:32230594-32230616 CATTGGGAGGCTAAGGAAGGCGG + Intronic
904753467 1:32755054-32755076 AATGGGGAGGGGAGGGAAAGGGG + Intronic
904862146 1:33546431-33546453 CACAGGGAGGGGAAGCAAGAAGG + Intronic
905027590 1:34861450-34861472 CACGGGGCGGGGAGGCGAGGGGG + Intergenic
905196483 1:36282167-36282189 CACTGGGAGGCCAAGGTAGGAGG - Intronic
905226054 1:36480079-36480101 CCCTTGGATGGGAGGGAAGATGG + Intronic
905269638 1:36778989-36779011 GAAGGGGAGGGGAGGGAAGGGGG + Intergenic
905289379 1:36911113-36911135 CACTGGGGAGAGAGGGAGGGAGG + Intronic
905578081 1:39062052-39062074 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905636706 1:39558800-39558822 CACAGGGAGGAGAGGAAGGGAGG + Intergenic
905675443 1:39821471-39821493 GAAGGGGAGGGGAGGGGAGGGGG + Intergenic
905684143 1:39896748-39896770 CATTGGGAGTGGGAGGAAGGGGG + Exonic
905842823 1:41199283-41199305 AACTGGGAGGGGAGGGCACAGGG - Intronic
906187576 1:43872483-43872505 AACTGGGAGGGGAGAGAGAGAGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906567344 1:46810722-46810744 CCCTGGGAGGGCAGGGGAGAAGG - Intronic
906627827 1:47340009-47340031 GAAGGGGAGGGGAGGGAAGAGGG - Intronic
906684542 1:47755116-47755138 TGCTGGGAGGGGAAGGGAGGGGG + Intergenic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
906918726 1:50040583-50040605 CACTGGGAAGGGACATAAGGTGG + Intergenic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907042013 1:51269844-51269866 CCCTGGGAGGGGTAGGAAGCTGG - Intronic
907327717 1:53651630-53651652 CTCTGGGAGGTGAAGGCAGGAGG + Intronic
907457806 1:54586675-54586697 CTTTGGGAGGCGAGGGCAGGTGG - Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907560478 1:55382906-55382928 GGCTGGGAGGGGAGGGCTGGGGG + Intergenic
907916262 1:58872718-58872740 CATGGAGAGGGCAGGGAAGGTGG - Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908082750 1:60598453-60598475 AAAAGGGAGGGGAGGGGAGGGGG + Intergenic
908550697 1:65206150-65206172 CACTGGGGGTGGAGGGATAGGGG - Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909626051 1:77717108-77717130 CACTGGGAGGCCAAGGCAGGTGG - Intronic
910029592 1:82702637-82702659 CTCTGAGAGGGTAGGGCAGGAGG - Intergenic
910264184 1:85321270-85321292 CACCTCGAGGGGAGGGAGGGTGG + Exonic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
910777709 1:90892548-90892570 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
910828244 1:91432127-91432149 CACTGGGAGGCCAAGGCAGGAGG + Intergenic
911098917 1:94078551-94078573 GATGGGGAGGGGAGGGGAGGAGG - Intronic
911190269 1:94941540-94941562 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
911520187 1:98920215-98920237 CACTGGAAGTATAGGGAAGGTGG + Intronic
911599508 1:99833188-99833210 CTTTGGGAGGCCAGGGAAGGTGG + Intergenic
911620856 1:100065484-100065506 AAAGGGGAGGGGAGGGGAGGGGG - Intronic
911779897 1:101863215-101863237 CTTTGGGAGGGGAAGGCAGGCGG - Intronic
911871590 1:103107274-103107296 GATTGGGAGGGAAGGGGAGGGGG - Intronic
912121261 1:106474348-106474370 CACTGGGACAGGAGGGAGGCTGG + Intergenic
912215691 1:107608651-107608673 GACTGCCAGAGGAGGGAAGGTGG + Intronic
912541649 1:110420741-110420763 CTCTGGCAGGGTAGGGAAAGCGG + Intergenic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
912977854 1:114346259-114346281 CCCTGGGCCAGGAGGGAAGGGGG - Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913240396 1:116825237-116825259 CATTGGGAAAGGAGGAAAGGGGG - Intergenic
913575118 1:120164427-120164449 TACTAGAAGAGGAGGGAAGGAGG - Intronic
913608871 1:120491755-120491777 CAGAGGGAGGGGAGGACAGGGGG - Intergenic
914204958 1:145518696-145518718 CAGAGGGAGGGGAGGACAGGGGG + Intergenic
914250525 1:145918344-145918366 CACTGGGCGGTGATGGAATGAGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914370610 1:147021532-147021554 CAGAGGGAGGGGAGGATAGGGGG - Intergenic
914440369 1:147700308-147700330 GTCAGGGAGGGGAGGGATGGAGG - Intergenic
914484080 1:148091878-148091900 CAGAGGGAGGGGAGGACAGGGGG + Intergenic
914557423 1:148780068-148780090 TACTAGAAGAGGAGGGAAGGAGG - Intergenic
914582322 1:149030083-149030105 CAGAGGGAGGGGAGGACAGGGGG + Intronic
914606874 1:149263600-149263622 GGAGGGGAGGGGAGGGAAGGAGG - Intergenic
914615411 1:149350162-149350184 TACTAGAAGAGGAGGGAAGGAGG + Intergenic
914812596 1:151039992-151040014 CACTGGGAGGCCAAGGCAGGTGG - Intronic
914825981 1:151138245-151138267 CACTGGGAGAGGAGCTAAGGTGG + Intronic
914858035 1:151366241-151366263 TACTGGGAGGGGAGGGCCAGAGG + Intronic
915090225 1:153419069-153419091 GGCTGGGAGGGGAGAGGAGGAGG - Intronic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915436631 1:155911450-155911472 ACCTGGGAGGGGCGGGAAGAGGG - Intergenic
915447416 1:155981868-155981890 TGATGGGAGGGGAGGGCAGGTGG - Intronic
915449446 1:155994526-155994548 CACAGGGAAGGGAGGGAGGCAGG + Intronic
915529133 1:156493422-156493444 CCCTGGCAGCGGAGGGAGGGCGG + Intronic
915589597 1:156862935-156862957 GGCTGGGAAGGGAGGAAAGGAGG + Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915860701 1:159441175-159441197 TACTGTGTGGGGAGGGAAAGTGG + Intergenic
916127987 1:161588480-161588502 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916137905 1:161670310-161670332 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916666664 1:166973751-166973773 CACTGGGAGGCCAGGGGAGCGGG + Intronic
916758484 1:167795897-167795919 AACTGGGAGTGGAAGGCAGGAGG + Intergenic
916761747 1:167823469-167823491 GCCTCGGAGGGGAGGGGAGGAGG + Intronic
916798455 1:168190193-168190215 AACTGGGAGGGGAAGGGAGTTGG - Intronic
916825069 1:168435208-168435230 CACTGGGAGGGATGGTAAGCAGG - Intergenic
917348839 1:174056490-174056512 CACAGGAATGGGAGGGAGGGTGG + Intergenic
917359358 1:174159501-174159523 AACTGAGAGGGGAGGGGAGAAGG - Exonic
917521749 1:175753508-175753530 CTCGGGGAGGGGAAGGAAGGAGG - Intergenic
917576102 1:176323322-176323344 CCCTGGGAGCTGAGGAAAGGTGG - Intergenic
917788465 1:178484441-178484463 CACTGGGAGGGTGAGGCAGGAGG + Intergenic
917969345 1:180197098-180197120 GGGTGGGAGGGGAGGGAATGGGG - Exonic
918455718 1:184711341-184711363 CACTGGGAGGCCAAGGCAGGTGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
919059525 1:192613958-192613980 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
919202305 1:194370642-194370664 GAAGGGGAGGGGAGGGGAGGGGG + Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919425120 1:197420423-197420445 CACTGGCATTGCAGGGAAGGAGG + Intronic
919447510 1:197727290-197727312 CTTTGGGAGGGCAAGGAAGGTGG + Intronic
919751034 1:201038381-201038403 CACTGGGTCAGAAGGGAAGGAGG + Intergenic
919786684 1:201262533-201262555 GACGGGAAGGGGAGGGAAGAGGG - Intergenic
920013315 1:202886237-202886259 AACGGGGAGGGGAGGGGAGGTGG + Intronic
920117846 1:203633349-203633371 CACTGGGAGGCCAGGGCAGGAGG + Intronic
920154530 1:203937635-203937657 GAAGGGGAGGGGAGGGGAGGGGG + Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920428299 1:205896678-205896700 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
921060343 1:211579351-211579373 GCCTCGGAGGGGCGGGAAGGGGG + Intergenic
921422015 1:214959081-214959103 GACTTGGAGGGAAGGGCAGGAGG - Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921538136 1:216377950-216377972 AACAGGGGAGGGAGGGAAGGAGG + Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922479307 1:225928005-225928027 CACTGGGAGGCCAAGGAGGGAGG - Intergenic
922585742 1:226734006-226734028 AACTGGGAGGGATGGGACGGGGG + Intronic
922726372 1:227924838-227924860 CCCTGGGAGGGGGCGGGAGGAGG + Intronic
922882377 1:228990526-228990548 CCCTGGCAGGGGAGGGCCGGGGG + Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923003606 1:230027587-230027609 CCCTTGGAGAGAAGGGAAGGTGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923051636 1:230394569-230394591 CACAAGGAGAGGAGGGGAGGGGG - Intronic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
923387907 1:233483961-233483983 CACTGGGTGGAGAGGGATGTGGG - Intergenic
923398596 1:233591923-233591945 CTCTGGGAGGCCAGGGCAGGAGG - Intergenic
923534463 1:234838235-234838257 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
923602076 1:235412166-235412188 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602093 1:235412193-235412215 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602103 1:235412209-235412231 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923659373 1:235945177-235945199 CACTGGGATGGGATGGGAGTGGG + Intergenic
923742109 1:236664406-236664428 CACTGAGGGAGGAGGGAAGATGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
924595624 1:245442490-245442512 AACTGGGAAGGGAGTAAAGGAGG + Intronic
924632273 1:245752309-245752331 CTCTGTGAGGGCAGGGAGGGAGG - Intronic
1063045861 10:2392241-2392263 CACTGGGTGAGGAGGGGACGGGG + Intergenic
1063130426 10:3172929-3172951 CTCTGGGACGGGCGGGAGGGCGG + Intergenic
1063225671 10:4013145-4013167 GGATGGGAGGGAAGGGAAGGAGG - Intergenic
1063299713 10:4840600-4840622 CACAGGGATGGGAAGGAATGAGG - Intronic
1063588482 10:7374017-7374039 CTTTGGGAGGGCAAGGAAGGTGG + Intronic
1063621287 10:7651338-7651360 CTTTGGGAGGGCAGGGCAGGCGG + Intronic
1064030550 10:11880238-11880260 CACGGGCAAGGGAGGGAACGTGG - Intergenic
1064035135 10:11908543-11908565 CACTGGGGTGCGTGGGAAGGAGG - Intergenic
1064091857 10:12392361-12392383 GGCTGGGGGGAGAGGGAAGGAGG - Intronic
1064267700 10:13838335-13838357 CATTGGGAGGGCAAGGCAGGAGG - Intronic
1064626576 10:17267304-17267326 CTTTGGGAGGGCAGGGCAGGTGG - Intergenic
1064858333 10:19796718-19796740 CTTTGGGAGGCCAGGGAAGGAGG + Intergenic
1065104839 10:22372482-22372504 CACTGGGAGGTGGGTGAGGGAGG + Intronic
1065182870 10:23144587-23144609 CTCTGGGAGGCCAGGGCAGGTGG - Intergenic
1065716592 10:28575253-28575275 TACTAGAAGGGGAGGAAAGGAGG - Intronic
1066198980 10:33127983-33128005 GAAGGGGAGGGGAGGGGAGGGGG - Intergenic
1066273537 10:33846457-33846479 CACAGGATGGGGAGGGGAGGAGG - Intergenic
1066692200 10:38041258-38041280 CACTTGGAGGGGTGGGGAGGAGG - Intronic
1066746668 10:38608182-38608204 CACTGGTGGGGGAGGGGTGGGGG + Intergenic
1067000518 10:42607376-42607398 GACTTGGAGGGGTGGGGAGGTGG + Intronic
1067060121 10:43073982-43074004 CACAGGGAAGGGAGGGAGGAGGG - Intergenic
1067063808 10:43092305-43092327 AACTGGGAGAGGAGAGGAGGGGG + Intronic
1067203904 10:44197731-44197753 CCCTGGGAAGGGAGAGAGGGAGG - Intergenic
1067226212 10:44377832-44377854 CCCTGGGAGGAGAGGGATGCAGG + Exonic
1067317603 10:45182817-45182839 CTCTGGGAGGCGAAGGCAGGTGG + Intergenic
1067807890 10:49405841-49405863 GAGTGGGAGGGAAGGGAAAGAGG - Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068004177 10:51373592-51373614 GACTGTCAGGGGAGGGTAGGGGG - Intronic
1068080623 10:52314163-52314185 CGCTGGGAGGGGCTGGGAGGGGG - Intergenic
1068338057 10:55664084-55664106 GACTGGGAGGAGAGGGAAATAGG + Intergenic
1068545125 10:58335649-58335671 CCCCGGGAGGGCAAGGAAGGTGG + Intronic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068956706 10:62824945-62824967 CACTGTGAGGAGAGGAAAAGAGG - Intronic
1069291014 10:66779604-66779626 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1069372753 10:67764927-67764949 TTCTGGGATGGAAGGGAAGGTGG - Intergenic
1069453070 10:68532767-68532789 TACTTGGAGGGGAGAGAAGGAGG - Intergenic
1069489692 10:68850726-68850748 CACTGGGAGGCCAAGGCAGGTGG + Intronic
1069518191 10:69096730-69096752 CACTGGGAGGCCAAGGCAGGAGG + Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069754931 10:70768494-70768516 AACTGGGAGAGGAGAGAATGGGG + Intergenic
1069826661 10:71258879-71258901 CACTGGGCGGGGAGGACAAGAGG - Intronic
1070089468 10:73270523-73270545 GAAGGGGAGGGGAGGGGAGGGGG - Intronic
1070745521 10:78931428-78931450 GACCGCAAGGGGAGGGAAGGAGG - Intergenic
1070829535 10:79409980-79410002 GGCTGGGAGGGGAGGGGCGGAGG - Intronic
1070987477 10:80700972-80700994 CACAGAGAGGGCAGGGAAAGAGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071043396 10:81341802-81341824 CACTGGGAGGCCAAGGCAGGCGG + Intergenic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071602787 10:86967002-86967024 CTCTGGGAGAGGAGGGGCGGGGG + Intronic
1071611773 10:87038459-87038481 CACTGGCAGGGGAGGGGTTGGGG + Intergenic
1071619360 10:87104900-87104922 CACTGGGAGGCGGAGGCAGGCGG - Intronic
1071704280 10:87980490-87980512 CTCTGGGAGGCTAAGGAAGGTGG - Intergenic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1072079204 10:92012082-92012104 GAGGGGGAGGGGAGGGAGGGAGG - Intronic
1072110431 10:92314396-92314418 CACTGGGAGGCCAAGGCAGGCGG + Intronic
1072553701 10:96498226-96498248 CGCTAGGCGGAGAGGGAAGGAGG + Intronic
1072554070 10:96501366-96501388 GAATGGGAAGGGAGGGAAAGTGG - Intronic
1072631178 10:97147626-97147648 AGCTGGGAGGGGGGGGAAGGAGG + Intronic
1072690211 10:97567830-97567852 CCTGGGGAGGGGAGGGGAGGGGG + Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1073004441 10:100311966-100311988 GACTGTCAGGGGAGGGAATGGGG - Intronic
1073099874 10:101000739-101000761 CCCAGAGAGGGGAGGGGAGGGGG + Exonic
1073431537 10:103490626-103490648 AACAGGGAAGGAAGGGAAGGTGG + Intergenic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1073447577 10:103590572-103590594 CAGAGGGAGGGGAGGAGAGGAGG + Exonic
1073530441 10:104226774-104226796 CTTTGGGAGGGGAAGGCAGGTGG + Intronic
1073590060 10:104748607-104748629 CTTTGGGAGGCCAGGGAAGGTGG + Intronic
1073857803 10:107697518-107697540 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1073977726 10:109119499-109119521 GGAGGGGAGGGGAGGGAAGGGGG + Intergenic
1073988849 10:109240680-109240702 GAAGGGGAAGGGAGGGAAGGAGG + Intergenic
1074249707 10:111732402-111732424 AAGTGGGAGGGGAGGGACTGTGG - Intergenic
1074270908 10:111952612-111952634 CACTGGGGTGGGAGGGCTGGTGG - Intergenic
1074289598 10:112128346-112128368 CACAGGGAGGGGTAGGAAGACGG + Intergenic
1074326356 10:112455270-112455292 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1074580852 10:114717933-114717955 GAAGGGGAGGGGAGGGGAGGGGG + Intergenic
1074810402 10:117099225-117099247 CTCAGGGTGGGGAGGTAAGGAGG + Intronic
1074928864 10:118103167-118103189 CACTGGGAGGAAAGGAAGGGTGG + Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075126810 10:119707016-119707038 TAGGGGGAGGGGCGGGAAGGAGG + Intergenic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075759656 10:124846380-124846402 CACTGGGAGGGTGTGGCAGGAGG + Intergenic
1075785439 10:125046291-125046313 CACTGGGAGGCCAAGGAGGGTGG + Intronic
1075866831 10:125729679-125729701 AACTGGCAGGGGAAGGAGGGAGG - Intronic
1076281145 10:129247330-129247352 CACTCGCAGGCGAGAGAAGGTGG - Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076527155 10:131119057-131119079 CATTTGGAGAGGAGGTAAGGTGG + Intronic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076779693 10:132717311-132717333 CACTGGGTGGGGAAGTCAGGGGG + Intronic
1076932538 10:133542448-133542470 CACGGGAAAGGGTGGGAAGGGGG + Intronic
1077010645 11:377742-377764 CACTGCGAGGGGAGAGGAGGAGG - Intronic
1077082349 11:729638-729660 CACTGGGCGAGGAGGGAGGGCGG + Intergenic
1077087897 11:763679-763701 CACTGGGAGGGCAGGTGGGGTGG + Intronic
1077138885 11:1014839-1014861 AGCTGGGAGGGGAGGGCAGCTGG - Intronic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077322817 11:1949875-1949897 CAGTGGCAGGGGCGGGAACGGGG + Intronic
1077430412 11:2513418-2513440 CACTTTGAGGGCAGGGCAGGTGG - Intronic
1077544189 11:3161970-3161992 GAGAGGGAGGGGAGGGGAGGGGG + Intronic
1077553894 11:3216823-3216845 GAAGGGGAGGGGAGGGGAGGAGG - Intergenic
1077556793 11:3229915-3229937 CCTTGGGAGGGGATGGAGGGAGG - Intronic
1077643651 11:3904227-3904249 TACTGGGAGAGAAAGGAAGGAGG + Intronic
1077664823 11:4098373-4098395 GAGAGGGAGGGGAGGGAGGGAGG - Intronic
1077914690 11:6603696-6603718 CGGTGGGAGGGGAGGGACGGAGG + Intronic
1077923073 11:6655824-6655846 CGGGGGGAGGGGAGGGGAGGGGG - Exonic
1078198456 11:9156810-9156832 GAAGGGGAGGGGAGGGAAAGGGG + Intronic
1078200987 11:9182750-9182772 GACTGGGAAGGGTGGCAAGGAGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078760649 11:14248720-14248742 CACTGGGCGGCGAGGGAGGCTGG - Intronic
1078807986 11:14725585-14725607 AGAGGGGAGGGGAGGGAAGGGGG - Intronic
1079085356 11:17441040-17441062 ACCTGGTGGGGGAGGGAAGGTGG - Intronic
1079092653 11:17491891-17491913 CACTGGGCCGGGCAGGAAGGGGG - Intergenic
1079298027 11:19252107-19252129 CAGTGGGAGGTCGGGGAAGGGGG - Intergenic
1079512584 11:21228717-21228739 GGGAGGGAGGGGAGGGAAGGAGG - Intronic
1079995779 11:27293618-27293640 GAGGGGGAGGGGAGGGGAGGCGG + Intergenic
1080210798 11:29782598-29782620 GACTGGGAGGAGAGCGGAGGAGG - Intergenic
1080343381 11:31294634-31294656 GAAGGGGAGGGGAGGGAGGGGGG + Intronic
1080386546 11:31814129-31814151 CACAGGGGGCGGAGGGTAGGGGG - Intronic
1080432123 11:32208966-32208988 AGGAGGGAGGGGAGGGAAGGGGG + Intergenic
1080436790 11:32252316-32252338 CACTGGGAGGCCAGGGTGGGCGG - Intergenic
1080520351 11:33063106-33063128 CACTGGGAGGCCAAGGAGGGAGG - Intronic
1080774280 11:35371283-35371305 CACTAGGAAGGGAGGGAATGTGG - Intronic
1080804341 11:35638512-35638534 AACTGGGAGGTGAGGAAAGCTGG + Intergenic
1080826546 11:35853524-35853546 CACTGGGAGGCCAAGGTAGGCGG + Intergenic
1080892772 11:36423875-36423897 CACTGTGAGGGGCGAGAATGAGG + Intronic
1081392611 11:42546512-42546534 CACTGGGAGAGATGAGAAGGTGG - Intergenic
1081623765 11:44634726-44634748 CCTTGGGAGGGAGGGGAAGGAGG - Intergenic
1081775071 11:45671033-45671055 AACTGGCAGGGAAGGAAAGGAGG + Intergenic
1081825837 11:46050562-46050584 CTCTGGGAGGGGAATGAAGTAGG + Intronic
1081940233 11:46935487-46935509 CACTGGGAGGAAAAGGAAAGAGG - Intergenic
1082775411 11:57240912-57240934 CATTGAGAGGGGAGGGAATTGGG + Intergenic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083343196 11:61972135-61972157 CACTGTGGAGGGAGGGAGGGAGG + Intergenic
1083384851 11:62300036-62300058 CACGGCAATGGGAGGGAAGGCGG - Intergenic
1083388653 11:62332228-62332250 CACTGGGAGGTGGGGGGAGTAGG + Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083579784 11:63817784-63817806 CACTGCGAGGGGAGAGGGGGAGG - Exonic
1083663916 11:64264643-64264665 CACAGGCAGGGGAGGAGAGGAGG + Intronic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083701626 11:64482990-64483012 CACTGGGAGGTCAAGGCAGGAGG + Intergenic
1083896647 11:65623440-65623462 CACTGGAAGGTGAGGCAAGACGG + Intronic
1083925878 11:65805960-65805982 CTCTGGGAGGGCAAGGCAGGCGG + Intergenic
1084215620 11:67645501-67645523 CTCTGGCAGGGTAGGGGAGGGGG + Intronic
1084358029 11:68652360-68652382 CACTGGGAGGGTATGGGAGTCGG + Intergenic
1084455434 11:69265446-69265468 ACCTGGGAGGGCAGGGAAGAGGG + Intergenic
1084725157 11:70936949-70936971 CTCAGGGAGGGAAAGGAAGGTGG - Intronic
1084824193 11:71717069-71717091 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
1085005780 11:73088114-73088136 CACTGGGAGGGCAAGGCAGAAGG - Intronic
1085012772 11:73152824-73152846 CACTGGGAGGGGTGGGGAGTAGG + Intergenic
1085457280 11:76672197-76672219 GGCTGGGAGGGAAGGGAAAGAGG - Intergenic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1085562646 11:77486571-77486593 CACTGCCAGGGGATGGAAGAGGG - Intergenic
1086022707 11:82251170-82251192 CACTGGCAGCGGAGAGAAAGGGG + Intergenic
1086138060 11:83462593-83462615 GACTGGGAAGGGAAGGCAGGAGG + Intronic
1086157147 11:83679932-83679954 CTTTGAGAGGGTAGGGAAGGTGG - Intronic
1086320061 11:85636682-85636704 CTTTGGGAGGCCAGGGAAGGCGG + Intergenic
1086518748 11:87646064-87646086 GAAGGGGAGGGGAAGGAAGGGGG - Intergenic
1086743671 11:90399703-90399725 CACTGGAAGTGGAGGGGTGGGGG + Intergenic
1087137383 11:94734654-94734676 CCCTGGGAGAGGAGGGGAGGAGG + Intronic
1087474820 11:98622110-98622132 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1087613498 11:100461929-100461951 CACTGGGTGTGGAGGGTATGAGG + Intergenic
1088033383 11:105279798-105279820 TATTTGGAGGGGAGAGAAGGTGG + Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088310679 11:108457187-108457209 TACTGGGAGGGGAGATAAGCAGG + Intronic
1088570566 11:111219605-111219627 TAATTGGAGGGGAGGGGAGGGGG - Intergenic
1088671969 11:112150556-112150578 CACAGGGAAGGAAGGGAAGACGG - Intronic
1088823025 11:113472774-113472796 CACCCAGAGGGGAGGGCAGGAGG + Intronic
1089111659 11:116062302-116062324 CACAAGAAGCGGAGGGAAGGAGG + Intergenic
1089113864 11:116078356-116078378 CAAGGGCAGGGAAGGGAAGGAGG + Intergenic
1089134085 11:116235406-116235428 CCCTGTGCTGGGAGGGAAGGAGG + Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089237790 11:117047428-117047450 TAAAGGGAGGGTAGGGAAGGTGG + Intronic
1089381889 11:118039184-118039206 AACTGGGAGGCAAGAGAAGGTGG + Intergenic
1089504884 11:118956438-118956460 CTCTGGCAGGGGTGGGAAGGGGG + Intronic
1089701176 11:120244944-120244966 CACTAGGAGGGGAGGGGGTGGGG + Intronic
1089834338 11:121356962-121356984 CACTGGGAGGCCATGGCAGGAGG - Intergenic
1090044232 11:123316882-123316904 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1090236900 11:125154903-125154925 CACAGGGAGGGTGGGGAAGCTGG - Intergenic
1090263934 11:125342422-125342444 CACTGGGAGCTGGGGGGAGGAGG - Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090487472 11:127126942-127126964 CTCTGGCAGGTGATGGAAGGAGG + Intergenic
1090512699 11:127392634-127392656 CTCTGGGAGGCCAAGGAAGGCGG - Intergenic
1090580398 11:128152869-128152891 AGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1090580415 11:128152913-128152935 AGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090668063 11:128927947-128927969 CACTCAGAGGGGAGGAAAGCGGG - Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091023282 11:132120072-132120094 GACTGGGAGGGAAGGCAAGCGGG - Intronic
1091143187 11:133253811-133253833 GAATGGAAGGGAAGGGAAGGAGG - Intronic
1091323885 11:134669891-134669913 CACAGGGAGGGGGGAGGAGGAGG + Intergenic
1202805835 11_KI270721v1_random:5188-5210 CAGTGGCAGGGGCGGGAACGGGG + Intergenic
1091518800 12:1214512-1214534 GGCGGGGAGTGGAGGGAAGGAGG - Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091631054 12:2161278-2161300 CTCTGGGAGGGGAGAGACGGGGG + Intronic
1091728880 12:2865166-2865188 CCATGGAAGGGGAGGGAAGTGGG + Intronic
1091917012 12:4276999-4277021 GAGGGGGAGGGGCGGGAAGGAGG - Intronic
1091929829 12:4386692-4386714 TACTAGTAGGGGAGGGTAGGAGG + Intergenic
1091945722 12:4539549-4539571 CAGTGGGAGGTGAGGTTAGGGGG + Intronic
1091950143 12:4585968-4585990 CACTGGGAGGCCAAGGCAGGAGG + Intronic
1091982356 12:4876429-4876451 TACTGGGAGAGGAGGGAACGGGG + Intergenic
1092164854 12:6336521-6336543 CATGGGGAGGGGATGGATGGGGG - Intronic
1092223011 12:6728142-6728164 AAGTGGGAGGGAAGGGAAGGAGG + Intronic
1092223138 12:6729133-6729155 GAATGGGAGTGGAGGGCAGGTGG + Intronic
1092371958 12:7924009-7924031 CACTGGGAGGGTGAGGCAGGCGG - Intronic
1092461009 12:8686254-8686276 GGAGGGGAGGGGAGGGAAGGGGG - Intronic
1092696612 12:11178315-11178337 GAAGGGGAGGGAAGGGAAGGGGG + Intergenic
1092810306 12:12266592-12266614 TAGGGGGAGGGGAGGGACGGAGG - Intronic
1092817263 12:12322979-12323001 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1092817333 12:12323108-12323130 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1093619056 12:21265328-21265350 CACAGTGAAGGGATGGAAGGTGG + Exonic
1094719786 12:33052403-33052425 CTCAGGGAGGGGACGGAGGGGGG - Intergenic
1095535028 12:43235088-43235110 TAATAGGAAGGGAGGGAAGGAGG + Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095971680 12:47905723-47905745 CACGGGGCGGGGGGGGAAGGCGG - Intronic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096189214 12:49604261-49604283 CTCTGGGAGGGGAGTGTGGGTGG - Intronic
1096419561 12:51445409-51445431 CTCTGGGAGGCTAAGGAAGGAGG - Intronic
1096439957 12:51632912-51632934 CACAGTGAGGGGTGGGAAGGGGG - Intronic
1096668194 12:53180923-53180945 AAGGGGGAGGGGAGGGGAGGAGG + Intronic
1096773252 12:53949750-53949772 CACAGGGAGCACAGGGAAGGGGG + Intergenic
1096870299 12:54588515-54588537 CGCTGCGGCGGGAGGGAAGGCGG + Exonic
1096909426 12:54967175-54967197 CCCTGGGAGCGGAGGGTAAGTGG - Exonic
1096981919 12:55733001-55733023 CACTGGGAGGGTAAGGAGAGTGG + Intergenic
1097066509 12:56324537-56324559 AAATGGAAGGGGAAGGAAGGTGG - Intronic
1097310869 12:58117684-58117706 AAATGAGAGGGGAAGGAAGGAGG + Intergenic
1097320291 12:58218419-58218441 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
1097520354 12:60661308-60661330 TTCAGAGAGGGGAGGGAAGGAGG - Intergenic
1097957494 12:65501204-65501226 CGCTGGGAGGGCAGGGACAGGGG - Intergenic
1098559614 12:71857191-71857213 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1098871962 12:75826501-75826523 CTCTGGGATGGGTAGGAAGGAGG - Intergenic
1099325842 12:81213652-81213674 GAAGGGGAGGGGAGGGGAGGAGG - Intronic
1099448799 12:82783801-82783823 AACTGGGAAGGGTGGGGAGGAGG + Intronic
1100998622 12:100331362-100331384 CTTTGGGAGGGAAGGGTAGGTGG + Intronic
1101386005 12:104258680-104258702 CACTGGGAGGCCAGGGTAGTAGG + Intronic
1101436677 12:104670146-104670168 CACAGGGAGAGGGAGGAAGGGGG + Intronic
1101680103 12:106956142-106956164 CACTGGGAGGTGAGGGGCAGGGG - Intronic
1101964376 12:109272441-109272463 GGCTGGGAGGGGAGGGGAGTGGG - Intergenic
1102023640 12:109700811-109700833 AACTGGGAGGGTATGGATGGTGG - Intergenic
1102109717 12:110355832-110355854 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
1102146009 12:110655589-110655611 TTCTGGGAGGGCAGGGAAGGTGG - Intronic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102340427 12:112117196-112117218 CACTGGGAGGGGAAGTAACCAGG - Intergenic
1102353055 12:112209143-112209165 CACTGGGAAGTCAAGGAAGGAGG - Intronic
1102446827 12:113009485-113009507 CACTGGGAGAGGAGGGCTAGTGG - Intronic
1102456205 12:113072152-113072174 CACTTGGAGGAGTGGGAAAGAGG - Intronic
1102577111 12:113862849-113862871 GCCTGGTGGGGGAGGGAAGGAGG - Intronic
1102651204 12:114443828-114443850 CACTGGGAGGGGAGGGTCGCTGG + Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1102943101 12:116961358-116961380 CACTGGGCTGGGAGGTGAGGAGG + Intronic
1102991463 12:117319294-117319316 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1103214404 12:119190298-119190320 CCCTGGGAGAGGAGGCAACGAGG - Intronic
1103330131 12:120148467-120148489 CACTGGGAGGAGGGGAGAGGGGG + Intronic
1103350596 12:120280845-120280867 CTTTGGGAGGTCAGGGAAGGTGG + Intergenic
1103526064 12:121569382-121569404 CCATGGGAGGGTAGGGAGGGTGG - Intronic
1103546493 12:121705458-121705480 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
1103654342 12:122458236-122458258 CACTGGGAGGCTAAGGCAGGTGG - Intergenic
1104295240 12:127505854-127505876 ACCTGGGGGGGGAGGGAGGGAGG - Intergenic
1104399651 12:128464971-128464993 CACAGAGAGGGGAGAGAAGGAGG + Intronic
1104544466 12:129698652-129698674 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1104638539 12:130452673-130452695 CACTGTGTGGGGAGGAAAAGTGG - Intronic
1104647173 12:130505654-130505676 TAGTGGGAGGGGAGTGGAGGGGG - Intronic
1104675522 12:130709729-130709751 CGCTGGGTTGGGTGGGAAGGGGG - Intronic
1104842649 12:131832158-131832180 ATCTGGGGGGGAAGGGAAGGGGG + Intronic
1105007336 12:132729522-132729544 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105007347 12:132729544-132729566 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105420747 13:20249578-20249600 CTTTGGGAGGGCAAGGAAGGAGG - Intergenic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1105958387 13:25305636-25305658 CACTGTGAGGGGAATGGAGGTGG - Intronic
1105966292 13:25387818-25387840 CTTTGGGAGGGCAGGGTAGGTGG + Intronic
1106070585 13:26407276-26407298 CACCGGGAGGAGAGGGACAGAGG - Intergenic
1106077156 13:26470503-26470525 TACTTTTAGGGGAGGGAAGGAGG - Intergenic
1106473875 13:30080804-30080826 GGCTAGTAGGGGAGGGAAGGCGG + Intergenic
1106512280 13:30422000-30422022 ATGTGGGAGGGGAGAGAAGGAGG + Intergenic
1106702060 13:32239962-32239984 CTCTGGGAGGCGAAGGCAGGAGG - Intronic
1106891526 13:34251210-34251232 CAATGAGATGGGAGGAAAGGTGG + Intergenic
1107054424 13:36087847-36087869 CAAGGGGAAGGCAGGGAAGGTGG + Intronic
1107058635 13:36131732-36131754 CACCGTCGGGGGAGGGAAGGAGG + Intergenic
1107337839 13:39374375-39374397 TACTATGAGGGGAGGGACGGAGG + Intronic
1107520708 13:41177662-41177684 CAATGTGAGGGGATGGGAGGTGG + Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107835827 13:44411874-44411896 GAAGGGAAGGGGAGGGAAGGGGG + Intergenic
1107838066 13:44428157-44428179 CACTGGCAGGAGATGGAAGTGGG - Intergenic
1108036791 13:46298333-46298355 GGCAGGGAGGGGAAGGAAGGGGG + Intergenic
1108376433 13:49818440-49818462 CACTGGGAGGCTAAGGTAGGCGG - Intergenic
1108462126 13:50677206-50677228 GGCTGGGACAGGAGGGAAGGAGG - Intronic
1108997144 13:56748285-56748307 CACTGCCAGGGGAAGGAAAGAGG + Intergenic
1109442628 13:62394909-62394931 CACTGTGGGTGGTGGGAAGGAGG + Intergenic
1109557413 13:63997851-63997873 CACTGAGTGGGAGGGGAAGGAGG - Intergenic
1109760582 13:66822751-66822773 CACTGGGAGGTGGAGGCAGGCGG - Intronic
1109768025 13:66930644-66930666 CCTTTGGAGGGGAGGGAAGAAGG + Intronic
1110143441 13:72159769-72159791 CACTCTGAGGGAAGGGAAGATGG - Intergenic
1110383419 13:74880082-74880104 AAATGGGAGGGGAGGAAATGAGG - Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1110693364 13:78458020-78458042 CATTGGGAGGTGAAGGAGGGAGG - Intergenic
1111178748 13:84635211-84635233 CAATGAGAGGGGACGGAGGGAGG + Intergenic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112422492 13:99265320-99265342 AACTGAGAAGGGAAGGAAGGAGG + Intronic
1112468665 13:99668339-99668361 CACTGGGAGGCCAAGGCAGGTGG + Intronic
1112503419 13:99958860-99958882 TGCGGTGAGGGGAGGGAAGGCGG - Intergenic
1112548777 13:100399871-100399893 CACTGGGAAGGGAGGTAGTGGGG - Intronic
1112696462 13:101954306-101954328 CACTGGGCGGGGTGGGGGGGTGG + Intronic
1113593533 13:111516771-111516793 GACAGGGGAGGGAGGGAAGGAGG - Intergenic
1113975641 13:114225552-114225574 AAGGGGGAGGGGAGGGAGGGGGG + Intergenic
1113994020 14:16052593-16052615 CTTTGGGAGGCAAGGGAAGGTGG - Intergenic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1114532516 14:23404628-23404650 CACAGGGAGGGGAGGGTTAGGGG + Intronic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115399567 14:32941191-32941213 GAAGGGGAGGGGAGGGGAGGGGG - Intronic
1115615312 14:35089345-35089367 CGTTGGGAGGCCAGGGAAGGAGG - Intronic
1115722312 14:36176567-36176589 TACTGGCAGGGGTGGGTAGGGGG - Intergenic
1115736059 14:36331338-36331360 CACAGGGAGTGGAGGGCAAGGGG - Intergenic
1116134291 14:40900874-40900896 CTCTGGGAGGCTAAGGAAGGTGG + Intergenic
1116475226 14:45331500-45331522 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
1116846407 14:49868296-49868318 AACTGGGAGGGGAGGGAGGCGGG + Intergenic
1117375616 14:55115783-55115805 CTCTGGGGGGGGGGGGAGGGGGG + Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117742528 14:58833671-58833693 GACAGGGTGGGGAGGGAAGCAGG + Intergenic
1118033497 14:61840926-61840948 CAATGGAAGGGGAGAGATGGAGG + Intergenic
1118234607 14:63990623-63990645 CACTGAGTGGGCAGTGAAGGGGG + Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119054710 14:71407511-71407533 CCCTGGGAGGGAGGGAAAGGAGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119338111 14:73851794-73851816 CCCTGGGAGGGGAGGGGGCGCGG + Intergenic
1119473221 14:74911947-74911969 CAGTGGCAGGGCAGGGAGGGCGG + Intronic
1119573363 14:75695871-75695893 GAAGGAGAGGGGAGGGAAGGGGG - Intronic
1119660253 14:76446030-76446052 CAATGGCGGGGGAGGGAAGAGGG + Intronic
1119711987 14:76829070-76829092 AACTGGGAGGAGAGAGAGGGTGG - Intronic
1119744355 14:77033607-77033629 AACAGGGAGGGGAAGAAAGGCGG + Intergenic
1119779021 14:77265975-77265997 AACTGCCAGGGAAGGGAAGGGGG - Exonic
1120325890 14:83025741-83025763 GGCAGGGAGGGGAGGGAAGGAGG + Intergenic
1120583831 14:86287085-86287107 GAAGGGAAGGGGAGGGAAGGAGG + Intergenic
1120583862 14:86287181-86287203 GAAGGGAAGGGGAGGGAAGGAGG + Intergenic
1121278999 14:92686729-92686751 CACTGGGAGGGGGCAGAGGGTGG - Intronic
1121342082 14:93111465-93111487 CTCTGGGAGGGCAAGGCAGGCGG + Intronic
1121442280 14:93956696-93956718 AACTGGGATGGCAGGGAGGGTGG - Intronic
1121469938 14:94144872-94144894 CACTGAGAGGGGACAGGAGGAGG - Intergenic
1121565135 14:94903674-94903696 GACTGGGAAGGGAGGACAGGTGG + Intergenic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1121767779 14:96502499-96502521 CACTGAGGCGGGAGGGAGGGGGG - Exonic
1121994765 14:98593338-98593360 GGCAGGGAGGAGAGGGAAGGAGG - Intergenic
1122102524 14:99424677-99424699 CAGAGGGAGGGGAGGAGAGGAGG + Intronic
1122745829 14:103896766-103896788 CACATGGCGGGGAAGGAAGGCGG - Intergenic
1122778425 14:104133352-104133374 CCCTGGGGGAAGAGGGAAGGAGG + Intergenic
1122781928 14:104147401-104147423 TGCTGGGAGGGGAGGGAGCGGGG - Intronic
1122898329 14:104771534-104771556 CCCTTGGAGGGCAGGGCAGGAGG + Intronic
1202877663 14_KI270722v1_random:21652-21674 CCCTGGGAGGGCGGGGAATGGGG - Intergenic
1123467330 15:20526774-20526796 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1123650784 15:22474268-22474290 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123741192 15:23283110-23283132 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123745805 15:23319448-23319470 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1124012574 15:25850632-25850654 GGCTGGGGGGGGAGGGAGGGAGG - Intronic
1124278077 15:28342765-28342787 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1124304626 15:28568843-28568865 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1124646922 15:31443824-31443846 CAATGGGACGGGAGGGAGGGAGG - Intergenic
1124804477 15:32867626-32867648 CACAGGGAGCGGGGGGCAGGGGG - Intronic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1125447757 15:39776166-39776188 CAGAGGGAGGGGAGGGGCGGAGG + Intronic
1125516292 15:40323235-40323257 CTCTGGGAGGGGACGGTAAGAGG - Intergenic
1125822884 15:42648760-42648782 TAATGGTAGTGGAGGGAAGGGGG - Intronic
1126022874 15:44419433-44419455 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
1126443628 15:48718403-48718425 CACGGGCAGGAGAAGGAAGGTGG + Intronic
1127090390 15:55461006-55461028 CTTTGGGAGGCCAGGGAAGGTGG - Intronic
1127259789 15:57319533-57319555 CCCTGCGGAGGGAGGGAAGGAGG - Intergenic
1127342989 15:58066183-58066205 GACGGGGATGGGAGGGAACGTGG - Exonic
1127401822 15:58594675-58594697 AACTGGGGAGGGAGGGATGGAGG + Exonic
1127507589 15:59610955-59610977 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507606 15:59610982-59611004 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507711 15:59611178-59611200 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127728406 15:61774787-61774809 CACTGGGAGGCCAAGGAAGGTGG - Intergenic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127812962 15:62580415-62580437 CAATGGGAAGGAAGGGAGGGAGG - Intronic
1127859587 15:62982089-62982111 CACTGGGAAGGGGGTGAAAGAGG - Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128087766 15:64897653-64897675 CACTGGTAGGGGTGGGGAAGTGG - Intronic
1128218108 15:65948131-65948153 CCCTGGGCAGGGAGGGATGGTGG - Intronic
1128233542 15:66051738-66051760 AACTCAGAGGGGAGGGAGGGAGG + Intronic
1128380492 15:67108365-67108387 CACAGGGTGGGGAGGCAAGCAGG - Intronic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128689767 15:69714562-69714584 CTCTCGGAGGGCAGGGAAGAGGG + Intergenic
1128704999 15:69832223-69832245 GAATAGGAGGGGAGGGGAGGGGG + Intergenic
1128990954 15:72260076-72260098 CTTTGGGAGGTGAAGGAAGGCGG + Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129596205 15:76966416-76966438 AACTGTGAATGGAGGGAAGGGGG + Intergenic
1129659769 15:77546691-77546713 CTTTGGGAGGGCAAGGAAGGTGG + Intergenic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1129933021 15:79428176-79428198 GAGAGGGAGGGGAGGGAGGGAGG - Intergenic
1130085378 15:80774244-80774266 CACTGGGAGGTGGAGGCAGGTGG + Intergenic
1130086236 15:80780122-80780144 CACTGGGAGGCGAGGGAAACTGG - Intronic
1130132723 15:81157727-81157749 GACTGGGAGGTGAGGGAAATGGG + Intergenic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130867486 15:87945072-87945094 CACTGGAAGGGGAGGCAGGGAGG + Intronic
1131016397 15:89061082-89061104 AAATGGGGAGGGAGGGAAGGAGG + Intergenic
1131370271 15:91875315-91875337 CAGTGGGAGGGGAGGGTCAGAGG - Intronic
1131399742 15:92114847-92114869 AGCTGGGAGGTGAGGGAGGGTGG - Intronic
1131418777 15:92285791-92285813 CACTTAGATGGGAGAGAAGGTGG - Intergenic
1131545669 15:93313690-93313712 AAAAGGGAGGGGAGGGAAGAGGG - Intergenic
1131680787 15:94720745-94720767 CACTGGGAGGGCTGGGAAAGAGG + Intergenic
1131827315 15:96331795-96331817 CGCCGGGAGGGGAGGGGAAGGGG - Exonic
1131829813 15:96347041-96347063 CACTGCCAGGCAAGGGAAGGGGG - Intergenic
1131838968 15:96416548-96416570 CAAGGGGCGGGGAGGGATGGAGG - Intergenic
1132101073 15:99024107-99024129 GGAGGGGAGGGGAGGGAAGGGGG - Intergenic
1132222126 15:100112819-100112841 CACAGGCAGGGCAGGGAAGATGG + Intronic
1132696948 16:1206300-1206322 CACTGGGCGGGCCGGGAGGGGGG - Intronic
1132702292 16:1227042-1227064 CACTGGGTGGAGGGGGAGGGCGG - Intergenic
1132706033 16:1243826-1243848 CACTGGGTGGAGGGGGAGGGCGG + Intergenic
1132726990 16:1343159-1343181 GATTGGGCGGGAAGGGAAGGGGG + Intronic
1132732085 16:1367559-1367581 AGATGGGAGGGGAGGGAGGGAGG - Intronic
1132764001 16:1525350-1525372 GGCTGGGATGGGAGGGAACGAGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133002513 16:2858350-2858372 CTCTGGAAGGGCAGGGGAGGGGG + Intergenic
1133026627 16:2991460-2991482 CGCAGGGAGGGGCGGGCAGGAGG + Intergenic
1133047387 16:3096372-3096394 AACTGGGAGTGGAGGGTGGGAGG - Intronic
1133172720 16:3991824-3991846 CTCTGGGAGGGTGGGGTAGGTGG + Intronic
1133324799 16:4936295-4936317 CAGAGGGTGGGGAGGTAAGGGGG + Intronic
1133496034 16:6318488-6318510 GGCAGGGAGGGGAGGGATGGAGG + Intronic
1133559874 16:6941229-6941251 GAATGGGAGGGGATGGAGGGAGG - Intronic
1133593147 16:7265690-7265712 CACTGGGAGGCTAAGGCAGGCGG - Intronic
1133667775 16:7986433-7986455 CACTTGGAGGTGAGGGAGTGGGG - Intergenic
1133923153 16:10172593-10172615 CAGTGGGAGGGCAGGGATCGTGG + Intronic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134062160 16:11205802-11205824 AACTGGGAGAGGATGGAGGGGGG + Intergenic
1134082191 16:11332665-11332687 CTTTGGGAGAGTAGGGAAGGAGG + Intronic
1134087122 16:11365007-11365029 GATGGGTAGGGGAGGGAAGGAGG + Intronic
1135049993 16:19185074-19185096 AAGCGGGAAGGGAGGGAAGGAGG - Intronic
1135135599 16:19884112-19884134 GACGGGGAGGGGTGGGGAGGAGG - Intronic
1135293580 16:21260764-21260786 AAGTGGGAGAGTAGGGAAGGAGG + Intronic
1135615553 16:23908118-23908140 CCCTGGGAGCTGGGGGAAGGAGG + Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1135850447 16:25958572-25958594 CTCTGGGAGGCCAAGGAAGGTGG - Intronic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136078275 16:27831900-27831922 CACAGGGAGGGAAGGCAATGGGG - Intronic
1136184219 16:28576245-28576267 CACTGGGCGGGGAGGGTAGGAGG + Intronic
1136554970 16:31002183-31002205 GGCTGGGAGGGGAGGGAGAGTGG - Intronic
1136736394 16:32471451-32471473 CACTGGTGGGGGAGGGGTGGGGG - Intergenic
1136775510 16:32869740-32869762 CTCTGGGAGGGGCTGGAAGCAGG - Intergenic
1136895107 16:33991772-33991794 CTCTGGGAGGGGCTGGAAGCAGG + Intergenic
1137438110 16:48474452-48474474 CACTTAGAGGGAATGGAAGGTGG + Intergenic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137488893 16:48914250-48914272 CACAGGGAGGAGAGGAAGGGAGG - Intergenic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1137781650 16:51102779-51102801 TGCTGGGAGGGAAGAGAAGGGGG + Intergenic
1137882193 16:52061559-52061581 CACAGGGAGGGGATGGCAGGGGG + Intronic
1138130077 16:54472024-54472046 CACTGGGATGGCAGAGGAGGAGG - Intergenic
1138347080 16:56326651-56326673 CCCTGGGAGGGCAAGGAAGCCGG + Intronic
1138353159 16:56357498-56357520 TTCTGGCAGGAGAGGGAAGGAGG + Intergenic
1138389143 16:56657726-56657748 AACTGGGAAGGGCGGGCAGGAGG + Exonic
1138552998 16:57757431-57757453 GACTGGGAAGGAAGGGGAGGCGG + Intergenic
1138628926 16:58277914-58277936 GGCTGGGAGAGGAGGGAAGGAGG + Intronic
1138642804 16:58398362-58398384 CACTGGGAGGTGGAGGCAGGAGG + Intronic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1138807859 16:60112473-60112495 GACTGGGAGGGGTGAGTAGGGGG - Intergenic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1139028520 16:62850240-62850262 GACAAGGAGGGGAGGGAAAGAGG + Intergenic
1139145068 16:64313758-64313780 GACTGGGAGGGGAAGGAAATGGG - Intergenic
1139182045 16:64760092-64760114 CACTGGGAGGCCAGGGTGGGAGG - Intergenic
1139256352 16:65546614-65546636 CATTGTGAGGGGAGGGTTGGGGG + Intergenic
1139320445 16:66109796-66109818 GAAGGGGAAGGGAGGGAAGGGGG + Intergenic
1139445828 16:66998044-66998066 CACGTGGAGGGGCGGTAAGGTGG + Intronic
1139460595 16:67119017-67119039 CTTTGGGAGGGCAGGGCAGGAGG - Intronic
1139471273 16:67179357-67179379 AGCTGGGAGGGGTGGGAAGGAGG - Intronic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1139916780 16:70433287-70433309 GACAGGGAGAGGAGGGAGGGAGG - Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140167926 16:72573387-72573409 CACTGGGAGGCCAAGGCAGGCGG - Intergenic
1140201134 16:72895576-72895598 CACTGGGAGGCCAAGGAAGGAGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140487434 16:75304816-75304838 CACTGCGGGTGGAGGGAAGGCGG - Intronic
1140497192 16:75399620-75399642 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1140566618 16:76049663-76049685 CACTGAGAGTGGATGGAGGGAGG - Intergenic
1140700332 16:77575388-77575410 GACGGGGAGAGGAAGGAAGGGGG - Intergenic
1140706638 16:77636666-77636688 CTCTGGGAGGCCAAGGAAGGAGG + Intergenic
1141093940 16:81149453-81149475 CTCTGGGAGGCGAAGGCAGGTGG - Intergenic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141110760 16:81269007-81269029 CTTTGGGAGGGGAAGGGAGGAGG - Intronic
1141181176 16:81754248-81754270 GATGGGGAGGGAAGGGAAGGAGG - Intronic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141345012 16:83236805-83236827 GAGTGGCAGGGGTGGGAAGGAGG + Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141499476 16:84433835-84433857 CACTGGGTGGGGAGAGAATTGGG - Intronic
1141635382 16:85311497-85311519 CATTGGGGAGGGAGGGAGGGAGG + Intergenic
1141685567 16:85567965-85567987 CACTGGGAGGCTGGGGCAGGAGG - Intergenic
1141824342 16:86468475-86468497 CACTGGCCTGGGAGAGAAGGGGG + Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141900335 16:86986869-86986891 ATCAGGGAGGGGAGGGGAGGGGG + Intergenic
1141900379 16:86986937-86986959 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141900389 16:86986953-86986975 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1142025362 16:87810096-87810118 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
1142033603 16:87850577-87850599 CTCTGGGAGAGAAGAGAAGGAGG + Intronic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142139530 16:88466586-88466608 CAGTGGGAGGGGATGGGCGGAGG + Intronic
1142246425 16:88972209-88972231 TACTGGGGAGGGAGGGAGGGAGG + Intronic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1142384838 16:89757203-89757225 CACTGGGAGGCCAAGGCAGGCGG - Intronic
1142388050 16:89779478-89779500 CACTGGGAGGGAAGGCAGTGGGG - Intronic
1203016676 16_KI270728v1_random:358127-358149 CACTGGTGGGGGAGGGGTGGGGG + Intergenic
1203035011 16_KI270728v1_random:631285-631307 CACTGGTGGGGGAGGGGTGGGGG + Intergenic
1203077928 16_KI270728v1_random:1131849-1131871 CTCTGGGAGGGGCTGGAAGCAGG - Intergenic
1142500917 17:332483-332505 CATCAGGAAGGGAGGGAAGGAGG - Intronic
1142501497 17:335738-335760 ACCTGGGAGGGGAGGGGAGTGGG - Intronic
1142514093 17:415752-415774 CACTGGGAGGCTGGGGCAGGTGG + Intronic
1142671280 17:1488389-1488411 CCCCGGGCGGGGAGGGAAGCGGG + Intronic
1142757219 17:2023686-2023708 CACGGGGAGGGGGTGGAGGGGGG - Intronic
1142766549 17:2067660-2067682 CATGGGGAGGGGAAGGAAGACGG + Intronic
1143021260 17:3918144-3918166 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
1143133502 17:4696082-4696104 CACTGGGAGGCCAAGGCAGGAGG + Intronic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143811308 17:9473982-9474004 CCCAGGGAGGGGAGGGAGGCTGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144722327 17:17480038-17480060 CGCTTGGAGGGGATGGGAGGTGG - Intronic
1144782181 17:17813810-17813832 CTCTGGGAGGGGCAGGATGGGGG + Intronic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1144825613 17:18104112-18104134 CACTGTGAGGGGAGGTCAGGAGG - Intronic
1144886096 17:18463204-18463226 TACTGGGAGGGGCGGGAGGGAGG + Intergenic
1145146111 17:20481165-20481187 TACTGGGAGGGGCGGGGGGGAGG - Intergenic
1145878872 17:28339747-28339769 CTCGGGGTGGGGAGGGCAGGAGG + Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146190044 17:30756949-30756971 CACTGGGAGGCCAGGGCGGGTGG + Intergenic
1146503418 17:33383878-33383900 CACAGGGAGGGATTGGAAGGGGG + Intronic
1146686770 17:34846358-34846380 CACTGGGATGGGAGGAAGAGAGG + Intergenic
1146933379 17:36793773-36793795 CATTGGGAGGCCAGGGTAGGAGG - Intergenic
1146937232 17:36819495-36819517 CTCTGGGAGGGCAGGGAACCTGG - Intergenic
1146964365 17:37012296-37012318 CACTGGGAGGCCAAGGCAGGCGG - Intronic
1147017092 17:37500934-37500956 CACTGGCTGGGGCGGGGAGGGGG - Intronic
1147119810 17:38329403-38329425 CCCTGGGAGGCAAGTGAAGGAGG - Exonic
1147248672 17:39139492-39139514 CCCGGGGAGGGGATGGAAGCAGG - Intronic
1147266199 17:39236505-39236527 GACGGGGAGAGGAGGGTAGGAGG - Intergenic
1147540275 17:41351424-41351446 CACTGGGAGGGGTGGAAAATAGG + Intergenic
1147589805 17:41675011-41675033 AACTGGGAGGGGATCAAAGGAGG + Intergenic
1147596765 17:41722889-41722911 CACTGGCAGAAGAGGGAGGGAGG + Exonic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1147782989 17:42957071-42957093 CACTGGGAGGGAGGCGGAGGTGG - Intronic
1148018630 17:44539573-44539595 CACTGGGAGGGGAAAGATAGAGG - Intergenic
1148026697 17:44593688-44593710 GGCTGGGATGGGAGGGCAGGGGG - Intergenic
1148040269 17:44701194-44701216 CACTGGGAGGCCAAGGCAGGAGG + Intergenic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148391323 17:47275246-47275268 CACTTGGTGAGGATGGAAGGGGG + Intronic
1148549883 17:48544023-48544045 CACTGGGAGGGCTTGGGAGGGGG - Intronic
1148603443 17:48910565-48910587 CAGGGGGAGGGGAGGGAGAGAGG - Intronic
1148690631 17:49524969-49524991 GGCTGGGAGTGGAGGGGAGGGGG - Intergenic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148860955 17:50604133-50604155 CCTGGGGAGGGGAGGGAGGGAGG - Exonic
1148863770 17:50618201-50618223 CTCTGGGGGAGGAGGGAAAGGGG - Exonic
1148875240 17:50683388-50683410 GACTGGGAGGGGAAGGACAGGGG + Intronic
1148905931 17:50912053-50912075 GAAGGGAAGGGGAGGGAAGGGGG + Intergenic
1149103767 17:52937409-52937431 CTCTGGGAGGCCAAGGAAGGTGG + Intergenic
1149493942 17:57105309-57105331 CTCTTGGAGGGCAGGGAAGGCGG + Intronic
1149530026 17:57387812-57387834 CACTAGTGGGGAAGGGAAGGTGG + Intronic
1149589034 17:57813930-57813952 CACTGGGAGGTCAAGGCAGGAGG + Intergenic
1149596715 17:57868578-57868600 CTAGGGGAGGGGCGGGAAGGCGG - Intronic
1149866972 17:60156539-60156561 CACTGAGCAGGGAGAGAAGGTGG - Exonic
1149875461 17:60228257-60228279 CACTGGGAGGCCAAGGCAGGTGG - Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150293110 17:63993122-63993144 AGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1150627228 17:66849327-66849349 CACTGGGACGGGAGGGGCAGAGG + Intronic
1150649026 17:66997915-66997937 CCCTGAGAAGGAAGGGAAGGAGG + Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151185238 17:72359397-72359419 CAATGGGAGGTGAGGGAGGCTGG - Intergenic
1151327657 17:73388921-73388943 GAAAGGGAGGGGAGGGAAGGGGG - Intronic
1151407174 17:73896012-73896034 CACTGGCAGGGGATAGAAGCAGG - Intergenic
1151623613 17:75262476-75262498 GCCTGGGAGGGGGGGAAAGGAGG - Exonic
1151694026 17:75705038-75705060 CAATTGGCGGGGAGGAAAGGGGG - Intronic
1151767088 17:76138220-76138242 CTCTGGCAGGGGAGAGGAGGGGG + Intronic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152069626 17:78128333-78128355 CACGGGGAGGGGAGGGGAGGGGG - Intronic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152261200 17:79268288-79268310 AAATGGGAGGTGAGGCAAGGTGG - Intronic
1152348758 17:79771274-79771296 CTCTGGGAGGTGAAGGCAGGAGG + Intergenic
1152518255 17:80838685-80838707 CACGGGGAGGCCAGGGATGGGGG + Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152577515 17:81149376-81149398 CACAGGCCGGGGAGGGCAGGAGG - Intronic
1152684501 17:81687422-81687444 CACTGGGTGGGCAGGGCAGGTGG + Intronic
1152699956 17:81813802-81813824 CACTGGGGGTGGGGGGTAGGTGG - Exonic
1152828346 17:82481483-82481505 CACTGGGAGGCCAAGGCAGGTGG + Intronic
1152903608 17:82958596-82958618 CAATGGGATGGGGGGGATGGGGG + Intronic
1153310302 18:3671076-3671098 GGAGGGGAGGGGAGGGAAGGTGG - Intronic
1153330377 18:3867466-3867488 CACGGGGTGGGGAAGGAAGGAGG + Intronic
1153757704 18:8300715-8300737 CACTGGAAGGGATGGGATGGAGG - Intronic
1153841339 18:9010873-9010895 CATTTGGTGGGGAGGGAGGGAGG + Intergenic
1154063414 18:11084522-11084544 CCGTGGGAGGTGAGGAAAGGGGG - Intronic
1154333308 18:13447334-13447356 GACTGGGAGGGGAGGGTGTGAGG - Intronic
1155484929 18:26331124-26331146 CACTGGGAAGAGCAGGAAGGTGG + Intronic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155707675 18:28837156-28837178 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1156320508 18:36017060-36017082 CTCTGGGAGGCGAGGGCAGGTGG + Intronic
1156474581 18:37397548-37397570 CCATGGGTGGGGAGGGATGGAGG + Intronic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1156776205 18:40792411-40792433 GAAGGGGAGGGGAGGGAGGGAGG - Intergenic
1156843775 18:41639211-41639233 GGAGGGGAGGGGAGGGAAGGGGG + Intergenic
1157096016 18:44685999-44686021 CACAGGGAGGGGAGGCGAAGTGG + Intronic
1157190937 18:45581046-45581068 CATGGGGAAGGGAGGGAATGTGG + Intronic
1157239688 18:45997655-45997677 GACGGGGGGGGGAGGGGAGGAGG - Intronic
1157270301 18:46269999-46270021 CTCTGGAAGGGGAGGTATGGAGG + Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157490535 18:48120703-48120725 CACTGGGGGAGGAGGGAAAGTGG + Intronic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1158130662 18:54149181-54149203 CACTGGGGGTGGAGGGCTGGGGG - Intergenic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1158311071 18:56159232-56159254 CACGGGAAAGGGTGGGAAGGAGG + Intergenic
1158582168 18:58693175-58693197 CTCTGGGAGGCCAGGGCAGGAGG + Intronic
1159109833 18:64043243-64043265 CACGGGGAGGGGAGGGGGTGGGG - Intergenic
1159449593 18:68583402-68583424 CACTGGTAGGGGAGGGTGGTAGG + Intergenic
1159545989 18:69839713-69839735 CCCTGGGAGAGAGGGGAAGGAGG + Intronic
1159812966 18:73038990-73039012 CTCTGGGAGAAGAGGGATGGGGG - Intergenic
1159841901 18:73407738-73407760 CTCTAGAAAGGGAGGGAAGGAGG - Intergenic
1159884986 18:73895309-73895331 CACTTGGTGGGCAGGGCAGGGGG + Intergenic
1159945893 18:74444731-74444753 AATAGGGAGGGGAGGGCAGGAGG - Intronic
1160009847 18:75098185-75098207 CGCTGGGAGTGGTGGGATGGGGG + Intergenic
1160248225 18:77178058-77178080 GGATGGGAGGGGAGGGGAGGGGG - Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160322061 18:77905518-77905540 AGGTGGAAGGGGAGGGAAGGGGG + Intergenic
1160393947 18:78558574-78558596 CACTTGGGGAGGAGGGAGGGCGG - Intergenic
1160423448 18:78765020-78765042 CACTGTGTGGGGTGGAAAGGGGG - Intergenic
1160445354 18:78923110-78923132 GACTCGGAGGGGAGGGTAGGCGG - Intergenic
1160465058 18:79069378-79069400 AAGTGGGAGGGGCGGGAAAGGGG + Exonic
1160499287 18:79394386-79394408 GATTTGGAGGGGAGGGGAGGGGG + Intergenic
1160580905 18:79884245-79884267 CACAGGGAGGGGCGGGAGGAGGG - Intronic
1160657311 19:280236-280258 CACTGGGCGGGGAGGGCGGGGGG - Intergenic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1160715693 19:575597-575619 CACTGGGGTGGGTGGGGAGGAGG + Intronic
1160790141 19:919304-919326 GACTGGGAGAGGAGGGCAGGAGG - Intronic
1160824794 19:1074571-1074593 CACTGGGTGGGGAGGGATGGAGG - Intronic
1160866985 19:1260424-1260446 CGCTGGGCGGGGTGGGAAGGAGG + Intronic
1160874589 19:1291148-1291170 CCCTGGGAGGGGCAGGAAGGTGG + Intronic
1160880016 19:1315479-1315501 CGCTGTGAGGTGAGGGAAGGAGG + Intergenic
1160989674 19:1855412-1855434 CACAGGGAGGGGAGGGGGCGGGG + Intronic
1161007008 19:1941862-1941884 CACTGGGTGGGGGAAGAAGGCGG - Intronic
1161030705 19:2056624-2056646 GACCGAGAGGGGAGGAAAGGAGG - Intergenic
1161131563 19:2592740-2592762 GAAGGGGAGGGGAGGGGAGGGGG + Intronic
1161399452 19:4060885-4060907 CCCAGGGAGAGCAGGGAAGGAGG + Intronic
1161438776 19:4279211-4279233 CAGGGGGAGGGGAGGGGCGGGGG + Exonic
1161449807 19:4338771-4338793 CACTGGAAGGAGAGGCCAGGCGG - Exonic
1161505015 19:4639310-4639332 CACTGCGACGGGGGGGAAGTGGG - Intergenic
1161529854 19:4781683-4781705 ATCTGGCTGGGGAGGGAAGGAGG - Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161800224 19:6413299-6413321 TACAGGGAGGGAAGGAAAGGGGG + Intergenic
1161803619 19:6429830-6429852 CACTGGGAGAGGAGAGAGGAGGG + Exonic
1161821539 19:6533551-6533573 CTCTGGAGGGGGAAGGAAGGGGG - Intronic
1161821587 19:6533667-6533689 CTCTGGAGGGAGAGGGAAGGGGG - Intronic
1162012120 19:7823561-7823583 GAAGGGGAGGGGAGGGGAGGAGG + Intergenic
1162418654 19:10553267-10553289 TCCTGGCAGGGTAGGGAAGGAGG + Exonic
1162497081 19:11029313-11029335 CACTGGGATGGGTGGGAACCAGG - Intronic
1162842022 19:13363641-13363663 CACTGGGTGGAGAGGGTGGGTGG + Intronic
1163097131 19:15067298-15067320 CTTTGGGAGGTGAGGGCAGGAGG + Intergenic
1163144748 19:15372960-15372982 GACTGGGAGAAGAGGGACGGAGG + Exonic
1163160008 19:15458645-15458667 CACTGGGGGGTCTGGGAAGGGGG + Exonic
1163206029 19:15803407-15803429 GAATGGAAGGGAAGGGAAGGGGG + Intergenic
1163235897 19:16030292-16030314 GACAAGGAGGGCAGGGAAGGAGG + Intergenic
1163363925 19:16865688-16865710 GGAGGGGAGGGGAGGGAAGGGGG - Intronic
1163458452 19:17422483-17422505 AGTTGGGAGGGCAGGGAAGGTGG - Intronic
1163507593 19:17717494-17717516 CACAGGGAAGGGAGCCAAGGGGG + Intergenic
1163719819 19:18893784-18893806 TGCTGGGAGGGGAGTGAGGGGGG + Intronic
1163765794 19:19162638-19162660 CCCAGGGAGAGGTGGGAAGGAGG - Intronic
1164022582 19:21321620-21321642 GATGGGGAGGGGAGGGGAGGGGG + Intronic
1164393553 19:27845469-27845491 CTCTCGGAGGGGAAGTAAGGGGG + Intergenic
1164424662 19:28130612-28130634 CACTGGGAGTGGATGGCATGTGG + Intergenic
1164447207 19:28328131-28328153 CAAGGGAAGGGAAGGGAAGGGGG - Intergenic
1164450508 19:28358859-28358881 CTAGGGGAGGGGAGGGGAGGGGG + Intergenic
1164499969 19:28810479-28810501 CTCTGGGAGGCCAGGGAGGGTGG + Intergenic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1164771092 19:30809589-30809611 CACTGGGAGTGATTGGAAGGGGG - Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1164988636 19:32668405-32668427 CATTGGGAGGCCAGGGCAGGAGG - Intronic
1165078910 19:33296700-33296722 GGCTGTGAGGGGAGGGAAGCTGG - Intergenic
1165082698 19:33318449-33318471 TACTGGGGGGAGAGGAAAGGGGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165151933 19:33766160-33766182 GACAGGGAGAGGAGAGAAGGAGG - Intronic
1165204618 19:34172841-34172863 CGGAGGGAGGGGAGGGAACGAGG - Intronic
1165309743 19:35022929-35022951 TGCAGGGAGGGGAGGGCAGGGGG - Intronic
1165331389 19:35142787-35142809 CACGGCGGTGGGAGGGAAGGAGG + Intronic
1165334145 19:35157210-35157232 CACAGGGATGGGCGGGGAGGGGG + Intronic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1165735514 19:38173258-38173280 CCCGGGGAAGGGAGGGTAGGGGG - Intronic
1165763451 19:38336010-38336032 AGCTGGGAGAGGAGGGAAAGAGG + Intronic
1165828479 19:38718996-38719018 CTCTGGGAAGGGATGGGAGGTGG - Intronic
1165837803 19:38770229-38770251 CACTGTGACGGGAGGGGAAGCGG - Intergenic
1165841763 19:38792468-38792490 CACTGTGACGGGAGGGGAAGCGG + Intergenic
1165959826 19:39524671-39524693 GTCTGGGAGGGGAAGGAAGCTGG + Intergenic
1166130662 19:40743901-40743923 CACTGGGCGGTGAGTGCAGGTGG - Exonic
1166145550 19:40832295-40832317 CACTGGGAGGCCAAGGAGGGTGG + Intronic
1166167755 19:41004180-41004202 CACTGGGAGGGGGCGGGTGGGGG + Intronic
1166176782 19:41078829-41078851 CACTGGCAAGAGATGGAAGGGGG + Intergenic
1166255267 19:41599812-41599834 CCCTGGGAGTGGATGGGAGGAGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166312838 19:41972766-41972788 AAAGGGGAGGGGAGGGGAGGGGG + Intronic
1166350264 19:42194787-42194809 GACAGGAAGGGGAGGGAGGGAGG + Intronic
1166350506 19:42195761-42195783 GACAGGAAGGGGAGGGAGGGAGG - Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166720401 19:44992954-44992976 GACAGGGAGGGGAGGCGAGGGGG - Exonic
1166823619 19:45595931-45595953 CCCAGAGAGGGGACGGAAGGAGG + Intronic
1166888111 19:45973575-45973597 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1167153227 19:47722267-47722289 CATGGGGCGGGGAGGGAAGAAGG - Intronic
1167225709 19:48238132-48238154 CACTGGGAGGCGAGGGCAGGTGG - Intronic
1167603544 19:50467903-50467925 CAGAGGGAGGGGTGGCAAGGTGG - Intronic
1167742809 19:51334408-51334430 TTCTGGGAGGGGAGGGACAGTGG - Intronic
1168073150 19:53963590-53963612 CGCAGGGAGGAGTGGGAAGGAGG - Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168290245 19:55354086-55354108 GGCTGGGAGGGGCGGGACGGAGG - Exonic
1168607223 19:57769818-57769840 CTCTGGGCGGGGGGGGAACGCGG - Exonic
1168632153 19:57965500-57965522 CACTGGGAGGCCAAGGTAGGCGG + Intronic
1202673015 1_KI270710v1_random:11292-11314 CCCTGGGAGGGCGGGGAATGGGG + Intergenic
925313150 2:2902246-2902268 AACTGCCAAGGGAGGGAAGGAGG + Intergenic
925418420 2:3690343-3690365 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
925418458 2:3690403-3690425 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925642988 2:6005318-6005340 CAGTGGGATGGGAGAGACGGTGG - Intergenic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
925899774 2:8500433-8500455 CACAGGGAGGGAAGGCAAGGAGG + Intergenic
925918793 2:8625492-8625514 AACTAGGGGGTGAGGGAAGGTGG + Intergenic
926879925 2:17533668-17533690 CACTGGGAGGTGAAAGCAGGAGG + Intergenic
926911011 2:17852433-17852455 GACTGGGAGGGAAGGCAGGGGGG + Intergenic
927087479 2:19686290-19686312 AGCTGGGAGGGGAGGGAGGGAGG + Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927416555 2:22886498-22886520 CACTGCGGGGGAAGGGGAGGAGG - Intergenic
927676487 2:25110225-25110247 CCCTGGGAGGGTAAGGCAGGTGG - Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928087322 2:28353899-28353921 GACTGGGAAGGGAGGGAGGGGGG + Intergenic
928167650 2:28982348-28982370 CGCTGGGAGGGGAGGGACTGGGG + Intronic
928467607 2:31537371-31537393 CCATGGGAGGAGGGGGAAGGAGG - Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929228692 2:39537456-39537478 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
929300840 2:40302138-40302160 CACTGGGAGGCTAAGGCAGGTGG - Intronic
929300858 2:40302226-40302248 GACTTGGAGGGAAGGGTAGGAGG - Intronic
929436499 2:41932527-41932549 CGCTGGGGAGGGAGGGAGGGAGG + Intergenic
929497363 2:42457705-42457727 CACTGGGAGGGCAAGGCAGAAGG + Intronic
929508299 2:42546088-42546110 ACCTGGTAGGGAAGGGAAGGAGG + Intronic
929646971 2:43637489-43637511 CGCCGGGAGGAGCGGGAAGGCGG + Intronic
929712749 2:44281265-44281287 CACTGGGAGGCTAAGGTAGGAGG - Intronic
930000304 2:46856700-46856722 CAAGGGGAGGTGAGAGAAGGAGG + Intronic
930054918 2:47244428-47244450 CACTGATTGGGGAGGGAAGGGGG + Intergenic
930105045 2:47632914-47632936 CACAGGGAGGGGAAGGCATGTGG - Intergenic
930399763 2:50868386-50868408 GACTGGGAAGGGTGGGATGGAGG + Intronic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930768131 2:55105723-55105745 CTTTGGGAGGGGAAGGAAGCAGG + Intronic
930886424 2:56332057-56332079 CACTGGGGTGGGATGGGAGGTGG + Intronic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931249382 2:60516487-60516509 CACTGGGAGAGGAGCCAAGAGGG + Intronic
931254153 2:60555472-60555494 CGCTCCGAGGAGAGGGAAGGAGG - Intergenic
931353458 2:61513242-61513264 CACTGGGAGGCCAAGGCAGGCGG - Intronic
931391673 2:61849962-61849984 CACCAGGTGGGGAGGGAGGGAGG + Intronic
931668648 2:64627539-64627561 GCCTGAGAGGGGAGGGAGGGAGG + Intergenic
931763894 2:65437834-65437856 CTTTGGGAGGAGGGGGAAGGAGG + Intergenic
931999278 2:67869163-67869185 CACAGTGTGGAGAGGGAAGGAGG - Intergenic
932032879 2:68208689-68208711 CTCTGGGAGGCCAAGGAAGGTGG + Intronic
932306083 2:70705161-70705183 GACTAGGAGGGGTGGCAAGGGGG - Intronic
932310995 2:70740941-70740963 CTCTGGGAGGCGAAGGCAGGTGG - Intronic
932401857 2:71486269-71486291 AAGAGGGAGGGGAGGCAAGGTGG - Intronic
932408966 2:71534063-71534085 TACAGGGAGGAGGGGGAAGGTGG + Intronic
932430654 2:71672013-71672035 CACTGGGAGGGAAGGCCAGAGGG + Intronic
932460183 2:71876954-71876976 AAGTTGGAGGGGAGGGAGGGAGG + Intergenic
932476999 2:72012685-72012707 CAGTGGGAGGGGTGGGTTGGTGG + Intergenic
932572305 2:72944486-72944508 CATGGGGAGGGGAGAGAAGGTGG - Exonic
932577886 2:72972677-72972699 ACCTGGGAGGGGTGGGCAGGTGG + Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
932771995 2:74505644-74505666 AGCAGGGAGGGGAGGGAAGAGGG + Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
932814298 2:74849516-74849538 ATCTGGGAGAGGAGGAAAGGAGG - Intronic
933016413 2:77132898-77132920 CATTGGGAGGGAAGTGGAGGAGG + Intronic
933643363 2:84787927-84787949 CACTGGGAAGTGGGGGAAGGAGG + Intronic
933728360 2:85438770-85438792 CCCAGGGAGGGGAGGAATGGAGG - Intergenic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934046788 2:88179093-88179115 AACTGTGAGGAGAAGGAAGGTGG + Intronic
934086841 2:88517004-88517026 CACTGGGAGGGAGAGGAAGCAGG - Intergenic
934159530 2:89235050-89235072 CATTGGGTGGGGGGTGAAGGGGG + Intergenic
934187557 2:89760572-89760594 CACTGGTAGGGGAGGGGTGGGGG - Intergenic
934207748 2:89947381-89947403 CATTGGGTGGGGGGTGAAGGGGG - Intergenic
934220421 2:90077025-90077047 CAATGTCAGGGGAGTGAAGGAGG + Intergenic
934557069 2:95293145-95293167 CTCAGGGAGAGTAGGGAAGGGGG - Intergenic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
934655387 2:96114640-96114662 CCTTGGGAGGGGTGGGCAGGGGG - Exonic
934962072 2:98684991-98685013 CTCTGGGAGGCCAGGGCAGGAGG + Intronic
935268802 2:101416167-101416189 CACTGGGGGTGGAGGGAGTGTGG + Intronic
935284194 2:101549353-101549375 CACAGGGAGGGGAAGCCAGGCGG - Intergenic
935695314 2:105766251-105766273 CTCTGGGAGGGCCTGGAAGGTGG + Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
936068406 2:109349401-109349423 GACTGAGTGGGGAGGGAGGGAGG - Intronic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
937027612 2:118712303-118712325 GAAGGGGAGGGGAGGGGAGGAGG + Intergenic
937120803 2:119438956-119438978 CACGGGGAGGGGATGTATGGAGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937275043 2:120678940-120678962 CACTGAGAGGGGAGGGTATAAGG - Intergenic
937278592 2:120702299-120702321 CTCTGAGAGGGGAGTGAGGGTGG + Intergenic
937293767 2:120797715-120797737 TACTGGGAGGGGAGAGAGGGAGG + Intronic
937315710 2:120930892-120930914 CACTGGCAAGGGAAGGAAGCAGG - Intronic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937321023 2:120960840-120960862 CACTGGGAGACCAGGGAGGGTGG - Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937509808 2:122582958-122582980 ACCAGGGAGGGGAGGGGAGGTGG + Intergenic
937569859 2:123343562-123343584 CATTGGGAGGCCAAGGAAGGCGG - Intergenic
937885925 2:126899913-126899935 CTATGGGAGGGGAGGGACAGGGG - Intronic
937901100 2:127019778-127019800 CTCTGGGAGGGAAGAGAAGGAGG + Intergenic
938087702 2:128412208-128412230 CACTGGGTGGTCAGGGGAGGTGG + Intergenic
938537648 2:132258277-132258299 CTTTGGGAGGCGAGGGAAGGTGG + Intergenic
938569228 2:132546886-132546908 CAAATGAAGGGGAGGGAAGGAGG + Intronic
938657095 2:133445711-133445733 CACAGGGAGAGTAAGGAAGGGGG + Intronic
938657309 2:133447539-133447561 GAAAGGAAGGGGAGGGAAGGGGG - Intronic
939063518 2:137453761-137453783 GGCTGGAAGTGGAGGGAAGGGGG - Intronic
939207924 2:139132022-139132044 TACTAGGTGGGGAGGGAAGGAGG - Intergenic
939411739 2:141835494-141835516 TGGGGGGAGGGGAGGGAAGGTGG + Intronic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
939833317 2:147098728-147098750 GGAGGGGAGGGGAGGGAAGGAGG - Intergenic
940072563 2:149705326-149705348 GGCTGGGAAGGGAAGGAAGGAGG - Intergenic
940464864 2:154014470-154014492 CACTGAGAGTGGACGGAAGGAGG - Intronic
940646038 2:156393977-156393999 CACCGGCGGGGGCGGGAAGGGGG + Intergenic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
941272561 2:163448692-163448714 CAAGGGGAGGGGAGGGGAGGGGG + Intergenic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
942279022 2:174342532-174342554 GACTGGAAGAGGAGGGAAAGGGG - Intergenic
942360724 2:175168572-175168594 CGGTGTGAGGGGAGGAAAGGTGG + Intergenic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944247280 2:197544313-197544335 CACTGGGAGGCCAAGGCAGGTGG - Intronic
944252061 2:197588457-197588479 CTCTGGGAGGCCAAGGAAGGCGG - Intronic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
945060328 2:205903426-205903448 CTTTGGGAGGGCAAGGAAGGTGG - Intergenic
945514294 2:210743605-210743627 CACTGGGCTGGGAAGGTAGGTGG + Intergenic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946015851 2:216603232-216603254 CACTGGGAGGGTGGGGGAGGAGG + Intergenic
946040742 2:216781167-216781189 GAGAGGGAGGGGAGGGGAGGGGG - Intergenic
946112635 2:217433585-217433607 CACTGGAAGGGGAGAAAAGGAGG - Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946165943 2:217863923-217863945 CACTGGGCTGGGAGGCAGGGAGG - Intronic
946180671 2:217947158-217947180 CATTGGGGTGGGAGGGAGGGAGG - Intronic
946207973 2:218124516-218124538 CACTGGGAAAGGAGTGAAGCTGG - Intergenic
946290240 2:218738942-218738964 CACTGGCATGTGAGGCAAGGAGG - Exonic
946387956 2:219397200-219397222 GGGTGGGAGGGGAGGGGAGGGGG - Intronic
946620278 2:221554567-221554589 CACTGGGGGGAGTGGGGAGGAGG + Intronic
946976337 2:225156457-225156479 CACTGGGAGGCCAAGGCAGGGGG - Intergenic
947286682 2:228524560-228524582 TACTGGGAAGGGTGGGAGGGTGG + Intergenic
947516656 2:230811324-230811346 TACTGGGAGTGGAGGGCAGGGGG - Intronic
947535779 2:230939842-230939864 CCCTGGGTGGGGAGGGATGGTGG - Intronic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947828533 2:233123039-233123061 CACTGAGAGGAGAGTGAAGGAGG + Intronic
947831700 2:233146141-233146163 ACCTGGGAGAGGAGGGAAAGAGG - Exonic
947986460 2:234451794-234451816 AACTGGGAGGAGAGTGAAGGTGG + Intergenic
948120723 2:235528360-235528382 CAGTGGGAGGGGAGGGGGCGGGG - Intronic
948186363 2:236024473-236024495 GGGTGCGAGGGGAGGGAAGGAGG - Intronic
948242576 2:236449783-236449805 CACTAGCTGGGGAGGGGAGGTGG - Intronic
948359241 2:237407153-237407175 CATTGGGAGGCCAGGGCAGGAGG - Intronic
948374653 2:237513365-237513387 CACTGGAAGGGAAGGCACGGGGG - Intronic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948517628 2:238514084-238514106 CAATGGGAGGGGACGCAAAGGGG - Intergenic
948547955 2:238745970-238745992 CACTGGGGTGGGAGTTAAGGGGG + Intergenic
948621998 2:239241255-239241277 AACTGGGAGGGGAAGGGAGTGGG + Intronic
949007350 2:241657216-241657238 CTCTGGGAGGCGAAGGCAGGTGG - Intronic
949032878 2:241805281-241805303 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032894 2:241805320-241805342 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032909 2:241805359-241805381 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032925 2:241805398-241805420 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033069 2:241805741-241805763 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033146 2:241805932-241805954 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033189 2:241806035-241806057 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033205 2:241806074-241806096 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033281 2:241806257-241806279 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033297 2:241806296-241806318 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033313 2:241806336-241806358 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033408 2:241806565-241806587 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033424 2:241806604-241806626 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033470 2:241806717-241806739 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033517 2:241806830-241806852 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033533 2:241806869-241806891 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033549 2:241806908-241806930 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033564 2:241806947-241806969 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033640 2:241807134-241807156 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033656 2:241807173-241807195 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033687 2:241807251-241807273 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033716 2:241807329-241807351 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033810 2:241807562-241807584 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033877 2:241807726-241807748 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033892 2:241807765-241807787 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033993 2:241808007-241808029 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
1168793505 20:595957-595979 CTCTGGGAGGAGAGTGAGGGTGG + Intergenic
1168829376 20:836353-836375 CACTGGGGGGAGAGGCAATGGGG - Intronic
1168962070 20:1876785-1876807 GAGGGGGAGGGGAGGCAAGGAGG - Intergenic
1168970878 20:1929984-1930006 GACTGTGGGAGGAGGGAAGGGGG - Intronic
1169150390 20:3285010-3285032 GAATGGGAGTGGAGGGCAGGAGG - Intronic
1169206592 20:3744123-3744145 GACTGGGATGGGAGGTAAGAGGG + Intronic
1169324071 20:4661162-4661184 GACTGGGGAGGGAGGGAGGGAGG + Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169469471 20:5871716-5871738 GGAAGGGAGGGGAGGGAAGGGGG + Intergenic
1169929478 20:10816880-10816902 AATTGGGAGGGGTGGGAGGGAGG + Intergenic
1170463758 20:16603817-16603839 CATTGGGAGGCCAGGGCAGGAGG + Intergenic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1170773229 20:19352122-19352144 CGGTGGGAGGGGCGGGGAGGGGG + Intronic
1171192806 20:23171342-23171364 GACTTGGGGGGAAGGGAAGGAGG - Intergenic
1171199880 20:23232342-23232364 CATGGGGAGGGAGGGGAAGGGGG - Intergenic
1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG + Intergenic
1171336408 20:24389467-24389489 CACTGGGAAGGGAGGATGGGAGG + Intergenic
1171546625 20:26006935-26006957 CTTTGGGAGGGCAAGGAAGGTGG + Intergenic
1171768410 20:29302218-29302240 CTTTGGGAGGCAAGGGAAGGTGG + Intergenic
1171811108 20:29744465-29744487 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1171866559 20:30490060-30490082 CTTTGGGAGGCGAGGGAAGGTGG + Intergenic
1171908565 20:30921258-30921280 CTTTGGGAAGCGAGGGAAGGTGG - Intergenic
1172062206 20:32194189-32194211 AACTGAGAGTGTAGGGAAGGTGG + Exonic
1172154979 20:32818114-32818136 GACTGGCAGGGGAGGCAAAGGGG - Intergenic
1172157780 20:32841057-32841079 CACTGGGAGGCCAAGGCAGGTGG - Intronic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172169575 20:32920838-32920860 CTCTGGGAGGGGAGGTAGGGAGG + Intronic
1172698131 20:36836080-36836102 CACTGGGTTGGGAGGGGTGGGGG - Intronic
1172840309 20:37898965-37898987 CTCAAGGAGGGGAGGGAGGGTGG + Intergenic
1172992761 20:39048425-39048447 CACAGGGAAGGGAGGGGAAGTGG - Intergenic
1173155271 20:40603227-40603249 GAAAGGGAAGGGAGGGAAGGAGG + Intergenic
1173169416 20:40711852-40711874 CAATGGGAGGGGGCGGGAGGGGG - Intergenic
1173201538 20:40958797-40958819 CACTGTGGGGGGTGGGAAAGCGG - Intergenic
1173351097 20:42246309-42246331 AGATGGGAGGGGAGGGTAGGAGG - Intronic
1173593968 20:44247218-44247240 CACGGAGCGGGGAGGGAGGGAGG + Intronic
1173654473 20:44690177-44690199 CACTTGTGGGGGAGGGGAGGAGG + Intergenic
1174047603 20:47744645-47744667 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1174104232 20:48150768-48150790 CACTGGTAGGGGTGGGGATGGGG + Intergenic
1174123498 20:48285631-48285653 CAGTGGGAGAGGAAGCAAGGCGG + Intergenic
1174232421 20:49057080-49057102 CACTGGGAGGCCAAGGCAGGAGG + Intronic
1174327369 20:49790035-49790057 CTCTGGTCGGGGAGGGAAGTAGG - Intergenic
1174369931 20:50079733-50079755 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
1174646590 20:52091252-52091274 CACTGGGAGGCCAAGGCAGGAGG + Intronic
1174805187 20:53598966-53598988 CCCTGGGAGGGGGAGGAGGGGGG + Intronic
1175569811 20:60010176-60010198 CACTGGGTGGGGCGGGGCGGGGG + Intronic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1175926470 20:62473962-62473984 CACTGGCAGGGGAGGGATGAAGG + Intronic
1175948233 20:62568588-62568610 CCCTGGGAGGGGTGAGAATGTGG + Intronic
1176024428 20:62978564-62978586 CCCTGGGGGAGGAAGGAAGGAGG - Intergenic
1176081263 20:63274314-63274336 CACTGGGCGGGGGGGGGGGGGGG - Intronic
1176091748 20:63321356-63321378 CACTGTCAGGGTTGGGAAGGGGG + Intronic
1176125443 20:63472774-63472796 GACGGGGAGGGGAGGGGAGGGGG + Intergenic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176182312 20:63756162-63756184 CACTGGGAGGGGACAGAGGAAGG - Intronic
1176201974 20:63865181-63865203 CACTGGTGGGGGCGGGAAGAAGG + Intergenic
1176244973 20:64093132-64093154 CACAGGGAGGGGAGGGGAGGGGG + Intronic
1176638949 21:9279088-9279110 CCCTGGGAGGGCGGGGAATGGGG - Intergenic
1177223348 21:18222023-18222045 CAATGGGATGGGTGGCAAGGTGG + Intronic
1177304083 21:19289913-19289935 CACTTGGAAGGGTGGGAAGGTGG + Intergenic
1177305385 21:19308520-19308542 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178282288 21:31293941-31293963 TGTTGGGAGGGGAGGGAGGGTGG - Intronic
1178323305 21:31622614-31622636 CACTGAGTGGGCAGGAAAGGAGG + Intergenic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1178511305 21:33207197-33207219 CCATGGGAGGGAAGGGCAGGTGG - Intergenic
1178602251 21:34004809-34004831 CAGTGGGAGGGGAGGTATGGGGG - Intergenic
1178988416 21:37330233-37330255 CTCTGGGAGGCCAGGGAAGGTGG + Intergenic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179135829 21:38678930-38678952 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1179150601 21:38805731-38805753 AAGCGGGAGGAGAGGGAAGGGGG - Intronic
1179233044 21:39522760-39522782 CACTGGGACAGGAGTGAAGCTGG - Intergenic
1179460410 21:41531042-41531064 CACTGGGAGGGGAGCAAGTGGGG - Intronic
1179498428 21:41790629-41790651 GATGGGGAGGGGAGGGAATGGGG + Intergenic
1179502569 21:41819479-41819501 AACTGGGAGTGTGGGGAAGGTGG - Intronic
1179653114 21:42827563-42827585 TAGTGGGAGGGTAGGGGAGGTGG - Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714397 21:43280112-43280134 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714521 21:43280388-43280410 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714598 21:43280566-43280588 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714693 21:43280782-43280804 GAGGTGGAGGGGAGGGAAGGTGG + Intergenic
1179714754 21:43280923-43280945 TAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179818940 21:43925337-43925359 GACTGGGAGGGGCAGGAGGGTGG - Exonic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179956273 21:44740936-44740958 AGCTGGGAGGGGAGGCCAGGCGG - Intergenic
1180156154 21:45978125-45978147 GAGGGGGAGAGGAGGGAAGGGGG + Intergenic
1180177825 21:46098690-46098712 GACTGGGCGGGGAGGGGACGCGG + Intronic
1180197149 21:46204047-46204069 CTCTGGGAGGCCAAGGAAGGTGG + Intronic
1180313248 22:11254922-11254944 CTTTGGGAGGCAAGGGAAGGTGG + Intergenic
1180341997 22:11627443-11627465 CTTTGGGAGGCGAGGGAAGGTGG - Intergenic
1180372257 22:12051930-12051952 CCCTGGGAGGGCGGGGAATGGGG - Intergenic
1180390216 22:12223724-12223746 CCCTGGGAGGGCAGGGAATGGGG + Intergenic
1180415718 22:12710743-12710765 CCCTGGGAGGGCAGGGAATGGGG - Intergenic
1180422994 22:12886595-12886617 CCCTGGGAGGGCGGGGAATGGGG - Intergenic
1180700621 22:17779641-17779663 CCCTGGGAGGGGAGAGAGGGAGG + Intergenic
1180790339 22:18572337-18572359 GAGTGGGAGGGGACTGAAGGGGG - Intergenic
1180800106 22:18627721-18627743 CACAGGCTGGGGCGGGAAGGGGG - Intergenic
1180851339 22:19023286-19023308 CACAGGCTGGGGCGGGAAGGGGG - Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1180918515 22:19506195-19506217 CACTGTGATGGCTGGGAAGGAGG + Intronic
1180994611 22:19959441-19959463 CACTGGGCCGGGAGGGACGCGGG - Intronic
1181031902 22:20152395-20152417 CACCGGGAGAGGAGGGAACGGGG - Intergenic
1181221609 22:21367545-21367567 CACAGGCTGGGGCGGGAAGGGGG + Intergenic
1181231399 22:21422978-21423000 GAGTGGGAGGGGACTGAAGGGGG + Intronic
1181247251 22:21511890-21511912 GAGTGGGAGGGGACTGAAGGGGG - Intergenic
1181562573 22:23714465-23714487 CACAGGGTGGGGCGGGAAGGTGG + Intergenic
1181581745 22:23832539-23832561 CACAGAGAGGGGAGGGGAAGTGG + Intronic
1181732703 22:24859243-24859265 TACTGGGCGGGGAGTGTAGGGGG + Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181876801 22:25946018-25946040 AGGTGGGAGGGGAGGGGAGGTGG - Intronic
1181876810 22:25946035-25946057 AGGTGGGAGGGGAGGGGAGGTGG - Intronic
1181876819 22:25946052-25946074 GGTGGGGAGGGGAGGGAAGGTGG - Intronic
1181932595 22:26414705-26414727 CTCTGGGAGGCGAAGGCAGGTGG + Intergenic
1181977230 22:26738528-26738550 GAGGGGGAGGGGAGGGGAGGTGG - Intergenic
1182110525 22:27719861-27719883 CACAGGGAGGGGTGGGAAATGGG + Intergenic
1182237914 22:28890998-28891020 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1182351908 22:29704266-29704288 AGGTGGGAGGGGAGGGGAGGGGG - Intergenic
1182455668 22:30448625-30448647 CACTGGGAGGCCAAGGTAGGAGG + Intronic
1182486344 22:30641309-30641331 GACTAGGGAGGGAGGGAAGGAGG - Intronic
1182519077 22:30875220-30875242 CTCTGGAAGGGGAGTGCAGGGGG - Intronic
1182567998 22:31213659-31213681 CTTTGGGAGGGCAGGGCAGGAGG + Intronic
1182679843 22:32070240-32070262 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1182733258 22:32512262-32512284 CACAGGGAAGGGAGAGAGGGAGG - Intergenic
1182833524 22:33322877-33322899 CTTTGGGAGGCGAAGGAAGGCGG + Intronic
1182864558 22:33592087-33592109 GGAGGGGAGGGGAGGGAAGGGGG + Intronic
1182939554 22:34262263-34262285 CATAGGGAGTGGAGGGAAAGGGG + Intergenic
1182972854 22:34593866-34593888 AAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1183035350 22:35136916-35136938 CATTGAGAGGTGAGGGCAGGTGG - Intergenic
1183059328 22:35326638-35326660 CACTAGGAGGAGAGAGAGGGTGG + Intronic
1183243012 22:36672399-36672421 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1183247351 22:36703828-36703850 CACCAAGGGGGGAGGGAAGGGGG - Intergenic
1183314072 22:37127679-37127701 GACGGGGAGGGGAGGGAAGGAGG + Exonic
1183353517 22:37346393-37346415 GCCTGGGTTGGGAGGGAAGGAGG - Intergenic
1183483050 22:38075341-38075363 AGCCGGGAGGGGAGGGAGGGTGG - Exonic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183512892 22:38246142-38246164 CACAGGGACGGGAGGGCAGGTGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1184164056 22:42717079-42717101 CACTGGTCTGGAAGGGAAGGGGG + Intronic
1184186547 22:42868872-42868894 AACGGGGTTGGGAGGGAAGGTGG - Intronic
1184229953 22:43153021-43153043 GAAGGGGAGGGGAGGGAGGGAGG - Intronic
1184250326 22:43256530-43256552 TAATGAGAGGGGAGGGAAGGTGG + Intronic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184340899 22:43885346-43885368 GGCTGGGAGGAGAGGGATGGCGG - Intronic
1184425328 22:44405925-44405947 CACAGGGAGGGGAAGGAATGAGG - Intergenic
1184474442 22:44712907-44712929 CACTGGGAAGGGAGGGGTTGGGG + Intronic
1184609568 22:45594200-45594222 CACAGGGAGGCAAGGGAAGGAGG - Intronic
1184686280 22:46097851-46097873 GACTGGGGAGGGAGTGAAGGTGG - Intronic
1185032316 22:48450568-48450590 CACAGGGAGGGCAGTGAATGTGG - Intergenic
1185101049 22:48841013-48841035 CACGGGGAGGCCAGGGCAGGAGG - Intronic
1185184113 22:49382368-49382390 CACTGGGAGAGAAGCGAGGGTGG - Intergenic
1185341564 22:50293484-50293506 GGCTGGGAGGGGAGGGCAGCAGG - Intronic
1185402845 22:50627498-50627520 CATTGGGAGGAAAGGGATGGAGG + Intronic
949144875 3:687171-687193 AACTGGCAGGGGAAGGAAGGAGG - Intergenic
949386644 3:3509921-3509943 CAGGGGGTGGGGAGAGAAGGGGG + Intergenic
949553479 3:5132130-5132152 CACTGGGAGGCCAAGGAAGGAGG - Intronic
949775328 3:7626185-7626207 TTCTGGGAGGGGAGGGACGAGGG - Intronic
950038260 3:9902741-9902763 CACTTGGAGGGGAAGGAATGTGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950436014 3:12980647-12980669 CACGGGGAGGGGAGATCAGGAGG + Intronic
950541632 3:13616643-13616665 GCCTGGGTGGGGTGGGAAGGAGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950916821 3:16654482-16654504 CCCTGGGAGAGGAGGGAGAGAGG + Intronic
951038014 3:17954972-17954994 TACTGGCAGGGGATGGAGGGTGG - Intronic
951176022 3:19600949-19600971 TAATGGGAGGTGGGGGAAGGTGG + Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
951955610 3:28249932-28249954 CAGTGAGCGGGGAGGGATGGGGG + Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952865104 3:37849966-37849988 AGCTGGGAGGAAAGGGAAGGGGG + Intergenic
952949917 3:38514755-38514777 CAGGGGGAGGGGGGGGAGGGTGG - Intronic
953023975 3:39134358-39134380 CCCTGGGAAGGGAGGAAGGGAGG - Intronic
953288489 3:41637202-41637224 TACTGAGGGGTGAGGGAAGGAGG - Intronic
953772303 3:45787189-45787211 CAGCGGCAGGGAAGGGAAGGTGG - Intronic
953871383 3:46630130-46630152 CACTGGGAGGCGCCGGAGGGAGG - Intergenic
954295987 3:49674662-49674684 CACTGGGGTGGGAAGGAAGGGGG + Intronic
954336824 3:49923323-49923345 CTCTGGGAGGGAAGGAAGGGAGG + Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954593064 3:51800809-51800831 CACTGAGAGGTGAAGGAGGGAGG + Intergenic
954611932 3:51949104-51949126 AACAGGGATTGGAGGGAAGGGGG - Intergenic
954634842 3:52065782-52065804 CACGGGGAGGGGCAGGGAGGTGG - Intergenic
954759248 3:52862017-52862039 CACTGGGAGGCCAGGGCTGGAGG - Intronic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955287467 3:57656711-57656733 CTCTGGGAGGGCAAGGCAGGTGG + Intronic
955349293 3:58182173-58182195 GAGGGGGAGGGGAGGGGAGGAGG + Intergenic
955407542 3:58634930-58634952 CTTTGGGAGGGTAAGGAAGGAGG + Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955874209 3:63473234-63473256 TAATTGCAGGGGAGGGAAGGGGG - Intronic
956165764 3:66397173-66397195 GACTGAGTGAGGAGGGAAGGTGG - Intronic
956600031 3:71010828-71010850 CACTGGGTGGGGGGGGAGGGGGG - Intronic
956717330 3:72089743-72089765 CTTTGGGAGGCCAGGGAAGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956785297 3:72637355-72637377 CACATGGAGGGGAAGGAAGCTGG - Intergenic
957079380 3:75623536-75623558 CACTGGGGGGGGGGGGGAGCGGG - Intergenic
957101907 3:75837989-75838011 CCCTGGGAGGGCGGGGAATGGGG + Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
958800328 3:98747880-98747902 TACTGGGAGGAGAGGAATGGGGG + Intronic
959132681 3:102377177-102377199 CACAGGAAGGGCAGGGAAAGGGG + Intronic
959254511 3:103992012-103992034 CACGAGGAGAGGAGGTAAGGAGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959733472 3:109630648-109630670 CACTTGGAGGCAAGGGCAGGTGG - Intergenic
959849581 3:111071433-111071455 CATTGGAAAGGCAGGGAAGGGGG + Intronic
960042803 3:113167445-113167467 CACTGAGAGTGTAGGGAGGGAGG + Intergenic
960050684 3:113236506-113236528 CACTTGGAAGGGTGGGAGGGTGG + Intronic
960530526 3:118758995-118759017 CTCTGGGAGGCCAAGGAAGGTGG - Intergenic
960567632 3:119151466-119151488 AACTGTGAGGGAAAGGAAGGGGG - Intronic
960601653 3:119464661-119464683 CACTGGGAGGCCAAGGCAGGAGG + Intronic
960907975 3:122620721-122620743 GCCTGGGAGGGGAGGGTGGGAGG + Intronic
960982470 3:123243238-123243260 TTCTGGGAGGGGTGGGGAGGGGG + Intronic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
961454738 3:127018285-127018307 CACTGGCAGGTGCGGGCAGGTGG + Exonic
961940861 3:130636754-130636776 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
961940876 3:130636782-130636804 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
961988058 3:131158406-131158428 CAATGGCAGGGGAGGTGAGGTGG - Intronic
962076618 3:132088746-132088768 AAGCGGGAGGGAAGGGAAGGGGG + Intronic
962251911 3:133840826-133840848 CCCTGGGAAGGTAGGCAAGGGGG - Intronic
962340053 3:134575158-134575180 GACAGGGAGGGAGGGGAAGGGGG - Intergenic
962354672 3:134683817-134683839 AACTGGTAGAGGTGGGAAGGGGG - Intronic
962381137 3:134898950-134898972 CACTTGGAGGGCAGGGAGTGGGG + Intronic
962396265 3:135017655-135017677 CACAGGGAGGGGAGCATAGGAGG - Intronic
962926583 3:139999253-139999275 TACTGGAAAGGGAGGGAGGGAGG - Intronic
963115601 3:141726462-141726484 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
963843623 3:150132777-150132799 GAGAGAGAGGGGAGGGAAGGGGG + Intergenic
963850099 3:150202379-150202401 CGCTGGAAGGGTAGGAAAGGGGG + Intergenic
964002810 3:151796148-151796170 AAAGGGGAGGGGAGGGGAGGGGG + Intergenic
964002832 3:151796186-151796208 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
964269974 3:154945270-154945292 CACTGGGACGGGATGGACAGTGG + Intergenic
965186882 3:165476459-165476481 GACAGGGAGGGAAGGGAAGAAGG + Intergenic
965299598 3:166993496-166993518 CTCTGGGAGGCCAGGGAGGGTGG + Intergenic
965454441 3:168880198-168880220 GACTGGCAGGGGTGGGATGGAGG - Intergenic
965456374 3:168905990-168906012 CTTTGGGAGGCCAGGGAAGGTGG - Intergenic
965474994 3:169146407-169146429 CACACGGAGGGAGGGGAAGGAGG + Intronic
965491990 3:169349072-169349094 CACTGGGGGAGGGGGGAAAGGGG - Intronic
965600913 3:170453993-170454015 CACTCTGAGGGGAGAGATGGCGG - Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
966005319 3:175004128-175004150 CACTGGGAGGCCAAGGCAGGAGG + Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966246437 3:177813254-177813276 CATTTTGAGGGGAGGGGAGGGGG - Intergenic
966594974 3:181717748-181717770 CAATAGGTGGGGAGAGAAGGAGG - Intergenic
966864509 3:184249831-184249853 CTCTAGGAGGGCACGGAAGGAGG - Exonic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967015655 3:185479290-185479312 GACAGGGAGGTGAGGGATGGAGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967226637 3:187298312-187298334 AAGTGGGAGGGGAGAAAAGGAGG + Intergenic
967283570 3:187846338-187846360 CTCTGGGAGGCCAGGGAAGGAGG - Intergenic
967395598 3:189005119-189005141 GGCTGGGAGGGGTGAGAAGGTGG + Intronic
967757755 3:193189250-193189272 CATTGGATGGGGAGGTAAGGAGG + Intergenic
967986948 3:195102080-195102102 GAAAGGGAGGGGAGGGGAGGGGG + Intronic
968234671 3:197024484-197024506 CTCTAGGAGGGGAGGGGAGTGGG + Exonic
1202747946 3_GL000221v1_random:125931-125953 CCCTGGGAGGGCGGGGAATGGGG + Intergenic
968455066 4:693511-693533 CGCTGGACGGGGAGGGGAGGAGG - Intergenic
968456493 4:703286-703308 GACTGGGTGGGCAGGGAGGGCGG + Intergenic
968517039 4:1019718-1019740 TGCAGGGAGGGTAGGGAAGGAGG + Intronic
968518202 4:1023599-1023621 CACAGGGAGGGCAGGTGAGGGGG - Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968669902 4:1843654-1843676 GCCTGGGAGGGGTGGGAAGGGGG + Intronic
968673407 4:1864298-1864320 TCCAAGGAGGGGAGGGAAGGAGG - Intergenic
968712150 4:2126934-2126956 CATGGGGAGGGGAGTGCAGGGGG + Intronic
968740859 4:2331072-2331094 CGCTGGGATGGGCTGGAAGGAGG + Intronic
968794630 4:2694508-2694530 CTCTGGGAGGCCAAGGAAGGTGG - Intronic
968819411 4:2838237-2838259 CACTGTGAGGGGAGGGCACTTGG - Exonic
968919269 4:3514368-3514390 CCCTGGGATGTGAGGGGAGGAGG - Intronic
968937139 4:3617346-3617368 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
969006770 4:4026477-4026499 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
969370429 4:6727866-6727888 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969542925 4:7804946-7804968 CACTGCGAAGAGTGGGAAGGAGG - Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969642739 4:8408888-8408910 CACTGGGGGGGGGGGGTGGGGGG + Intronic
969731421 4:8959919-8959941 CACTGGGAGGGCAGGGCAGGGGG + Intergenic
969850152 4:9949664-9949686 CACCATGAGGGAAGGGAAGGTGG - Intronic
970574150 4:17411546-17411568 GGAGGGGAGGGGAGGGAAGGAGG + Intergenic
971020144 4:22526860-22526882 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
971157335 4:24097097-24097119 AATGGGGAAGGGAGGGAAGGTGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971423057 4:26491427-26491449 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
971439453 4:26664686-26664708 CAATGGGAGGGGACGCAAAGGGG + Intronic
972147313 4:36043825-36043847 GAAGGGGAGGGGAGGGGAGGGGG + Intronic
972151680 4:36099042-36099064 CATGGGGAGGGGAGGGTAGGGGG - Intronic
972215367 4:36891565-36891587 CACTGAGAGTGGATGGAGGGAGG - Intergenic
972353158 4:38256076-38256098 CTCTGGGAGGCCAGGGTAGGAGG + Intergenic
972415787 4:38839109-38839131 CAAAGGGAGGGGAGGAAGGGAGG + Intronic
972415801 4:38839135-38839157 GGGAGGGAGGGGAGGGAAGGGGG + Intronic
972775563 4:42236728-42236750 CCCTGGGAGGGGAAGGGAGTGGG + Intergenic
972780851 4:42285865-42285887 CAATGGGAGGGGACGCAATGGGG + Intergenic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
973269579 4:48248538-48248560 CACTGGGAGGGGAATGATGCAGG + Intronic
973554061 4:52064426-52064448 GACTTGGAGGGAAAGGAAGGAGG - Intronic
973619442 4:52712442-52712464 CGCGGGGCGGGGAGGGAAGCAGG - Intergenic
974831355 4:67193314-67193336 CCCTGGTAGGGGAGGGCAAGAGG + Intergenic
975129230 4:70816067-70816089 GACTGCCAGGGGAGGGAAGAAGG + Exonic
975488280 4:74959466-74959488 CATGGTGAGGGGAGGAAAGGTGG - Intronic
975673288 4:76802791-76802813 CACAGGGAGGGGAGGGGAAGTGG + Intergenic
975775527 4:77782582-77782604 CACTGGGAGGCCAAGGCAGGAGG - Intronic
975839509 4:78458544-78458566 CACTGGGGAGGGAGGGAGTGGGG + Intronic
976600862 4:86935944-86935966 GAATGAGAGGGGAGAGAAGGTGG + Intronic
976616791 4:87086417-87086439 TCCTGGGTGGGAAGGGAAGGAGG - Intronic
976624941 4:87169616-87169638 CTCTGGGAGGGCAAGGCAGGAGG + Intronic
976666017 4:87593100-87593122 CACTGGGAAGGGTGGGATGTAGG + Intergenic
977179503 4:93856913-93856935 CATTGGGAGGAGAAGGTAGGTGG + Intergenic
978127457 4:105151589-105151611 TTCTGGGAGGGGAAGGCAGGAGG + Intronic
978243841 4:106548910-106548932 GAAGGGGAGGGGAGGGGAGGGGG - Intergenic
978604379 4:110463542-110463564 CACTGGGAGGCCAAGGCAGGTGG - Intronic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
979302790 4:119106694-119106716 CACTAGGAGGAGAAGGATGGAGG - Intergenic
979559114 4:122082189-122082211 CCCTGGGTGGGAAGGGAAGGAGG - Intergenic
979952498 4:126910804-126910826 GACTTGGATGGGAGGGAAGCTGG + Intergenic
981033765 4:140151279-140151301 ACCTGGGAGGGGAGGGAGGAGGG + Intronic
981106515 4:140887766-140887788 CTCTGGGAGGGGTGGGGAAGAGG + Intronic
981291536 4:143082198-143082220 GAAAGGGAGGGGAGGGGAGGGGG + Intergenic
981616361 4:146648262-146648284 CGCTGGGAGGGGCGGGGAGGAGG - Intergenic
981682915 4:147420933-147420955 CACTGGGAGGCTAAGGCAGGAGG + Intergenic
982097600 4:151936951-151936973 CATGGGGAGGGGGGGAAAGGAGG - Intergenic
982157168 4:152535091-152535113 CGCTGCCAGGGGAGGGGAGGCGG + Exonic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
983552347 4:169030868-169030890 CACTGGGAGCCAAGGGATGGGGG - Intergenic
984096041 4:175435953-175435975 CACTGGGAGGCCAAGGAGGGCGG + Intergenic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984825428 4:183919845-183919867 CACTGGGAGGCCAAGGCAGGAGG - Intronic
985026470 4:185744010-185744032 AAATGGGAGAGGAGGGAAAGGGG - Intronic
985094702 4:186401987-186402009 GACTGGGAGAGTAGGGCAGGGGG - Intergenic
1202753841 4_GL000008v2_random:37498-37520 CCCTGGGAGGGCGGGGAATGGGG - Intergenic
985772812 5:1823787-1823809 CACTCTGAGAGGAGGGGAGGAGG - Intergenic
985791019 5:1926799-1926821 CCATGGGGGAGGAGGGAAGGAGG - Intergenic
985970186 5:3370781-3370803 CACTGGGAGCCCAAGGAAGGCGG - Intergenic
985997580 5:3605459-3605481 CACCAGGTGGGGAGGGAATGTGG + Intergenic
986095828 5:4553410-4553432 CACTGAGAAGGGAGCAAAGGTGG - Intergenic
986195356 5:5532957-5532979 CACTGGGAGGGGAGGTCATGTGG - Intergenic
986424561 5:7617746-7617768 CACCAGGAGAGGAAGGAAGGTGG + Intronic
986530101 5:8726991-8727013 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
987373956 5:17217563-17217585 CACTGGGCAGGAAGGGGAGGGGG + Exonic
987738457 5:21874574-21874596 CAATGGGAGGGGACTGAAAGGGG - Intronic
988394172 5:30675781-30675803 AAATGGGAAGGGAGGGAAAGTGG + Intergenic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988889447 5:35599009-35599031 CACTGAGGGGGAAGGGGAGGTGG - Intergenic
989099974 5:37814125-37814147 CAGTGGGTGGGCAGGGATGGAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990407233 5:55503809-55503831 GAAGGGGAGGGGAGGGAAGAGGG + Intronic
990407280 5:55503923-55503945 GAATGGGAGAGGAGGGAGGGAGG + Intronic
990797968 5:59565597-59565619 CACTGGGAGGTGTGGGTAGTGGG + Intronic
990953832 5:61324209-61324231 GAAGGGGAGGGGAGGGAAGTGGG + Intergenic
991645385 5:68795814-68795836 AGGTGGGAGGTGAGGGAAGGTGG - Intergenic
992024361 5:72655980-72656002 TTCTTGGAGGGGAGGGAGGGAGG - Intergenic
992047497 5:72908816-72908838 TACTGGGAGGGGCGGGAGGGAGG + Exonic
992193104 5:74313328-74313350 AACTGGAAGTGGAGGGCAGGGGG - Intergenic
992301258 5:75383091-75383113 GAATGGGAGGAGAGGGAATGGGG + Intronic
993757779 5:91752399-91752421 CACTGGGAGAGGGGTGGAGGTGG - Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994753056 5:103763131-103763153 CATTTGTAGGGAAGGGAAGGGGG + Intergenic
995625767 5:114075011-114075033 CACAGGGATGGGAAGGAAGAAGG - Intergenic
996173488 5:120325335-120325357 GACTGGGAAGGGAAGGAAAGAGG + Intergenic
996387593 5:122925251-122925273 AAGGGGGAGGGGAAGGAAGGAGG - Intronic
996408436 5:123129955-123129977 GAAGGGGAAGGGAGGGAAGGAGG - Intronic
997131255 5:131278725-131278747 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
997348658 5:133213244-133213266 CTCTGGGAGGCCAGGGCAGGTGG - Intronic
997584676 5:135037318-135037340 CACGAAGAGAGGAGGGAAGGGGG + Intronic
997695365 5:135857020-135857042 CCCTGGAAGGGGAGGAAATGGGG + Intronic
997719920 5:136070100-136070122 CTCTGGGCTGGGAGGAAAGGGGG + Intergenic
997782541 5:136674842-136674864 CACTGAGGAGGGAGGCAAGGTGG + Intergenic
997963489 5:138339195-138339217 AAATGGAAGGGGAAGGAAGGCGG + Intronic
998134222 5:139666311-139666333 CACAGGGATGGGGGTGAAGGGGG - Intronic
998256710 5:140594054-140594076 TACTGGGAGGTCATGGAAGGTGG - Intergenic
998600685 5:143581861-143581883 GACTGGGAGGAGAGTGAGGGAGG + Intergenic
998823403 5:146077180-146077202 CCTTGTGAGGGGAGGGCAGGTGG - Intronic
998865095 5:146491228-146491250 CTCTGGGAGGGCAAGGCAGGAGG - Intronic
999079087 5:148826480-148826502 CGAGGGGAGGGGAGGGAAAGGGG + Exonic
999238488 5:150114112-150114134 CACGGGGAGGGTTGGGAAGGGGG - Exonic
999796431 5:154993733-154993755 GAAGCGGAGGGGAGGGAAGGGGG - Intergenic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1001049352 5:168402146-168402168 CAGAGGGAGGGGAAGAAAGGAGG - Intronic
1001426413 5:171625526-171625548 CACTGGTAGGGGCCGGCAGGAGG - Intergenic
1001456648 5:171866749-171866771 TATTGGGAGGGGAGGTCAGGGGG + Intronic
1001544469 5:172562186-172562208 CACAGGGAGGGGAGGAATTGGGG + Intergenic
1001813315 5:174647219-174647241 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
1001937521 5:175715815-175715837 CACTGGACGAGGAGGGAATGAGG - Intergenic
1002046086 5:176542634-176542656 GGCTGGGAAGTGAGGGAAGGAGG - Exonic
1002160858 5:177313178-177313200 AATAGAGAGGGGAGGGAAGGTGG + Intergenic
1002181978 5:177435409-177435431 CACAGGGAGGGCAGGGACTGGGG - Intronic
1002461456 5:179375905-179375927 AACTGGGGGAGGGGGGAAGGGGG + Intergenic
1002816708 6:687781-687803 CACTGGGATGGGTGAGAAGTTGG + Intronic
1002886993 6:1306273-1306295 CACAAGGAGGGGAGGGAAGAAGG - Intergenic
1002978315 6:2109180-2109202 CACTGGGACTGAAGTGAAGGAGG + Intronic
1003104805 6:3207185-3207207 CACTGGGAGGGCAAGGTGGGAGG + Intergenic
1003398023 6:5769949-5769971 CACTGGAAGGGGAGGTGAAGGGG + Intronic
1003491593 6:6627144-6627166 CCCTGGGAGGGGAGAGCAGCTGG - Intronic
1003812225 6:9796898-9796920 TAAGGGGAGGGGAGGGGAGGAGG + Intronic
1003888180 6:10539838-10539860 CACTGGGAGGCCAAGGCAGGAGG + Intronic
1004159101 6:13197780-13197802 CTCTGGGAGGGCTGGGAAGGAGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004364878 6:15003526-15003548 CAATGGGATGTGAGTGAAGGTGG - Intergenic
1004408759 6:15360746-15360768 CACTGGGAGGCTAAGGTAGGAGG - Intronic
1004463046 6:15856779-15856801 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
1004495209 6:16156436-16156458 CAATGGCAGGAGAGTGAAGGTGG + Intergenic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1004934853 6:20497161-20497183 GGAAGGGAGGGGAGGGAAGGAGG + Intergenic
1005152689 6:22771144-22771166 CTTTGGGAGGCGAGGGCAGGTGG + Intergenic
1005319831 6:24642132-24642154 GAGGGGAAGGGGAGGGAAGGAGG + Intronic
1005348022 6:24909495-24909517 CCCGGGTAGGGGAGGGAAGGAGG + Intronic
1005348351 6:24911170-24911192 TGCTGGGAGGGGAGGGCGGGTGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005657514 6:27956618-27956640 GACTGGGGGGAAAGGGAAGGAGG + Intergenic
1005677760 6:28173197-28173219 CATTGGGAGGACAGGGCAGGAGG + Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005693972 6:28334661-28334683 CAATGGGATGGGAGGAAGGGAGG + Intronic
1005743881 6:28817930-28817952 GAAGGGGAGGGGAGGGAAAGGGG + Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006028576 6:31162795-31162817 CCTGGGGAGGGAAGGGAAGGGGG - Exonic
1006322633 6:33329193-33329215 CCCTGGGAGGGGAGGGACCCTGG + Intronic
1006438967 6:34041504-34041526 GACACGGAGGGGAGGGGAGGAGG - Intronic
1006482184 6:34304913-34304935 CTTTGGGAGGCGAGGGCAGGAGG - Intronic
1006576475 6:35050049-35050071 CACGGGGTGGGGATGGGAGGTGG - Intronic
1006589020 6:35140950-35140972 CCCTGGGGGCGGCGGGAAGGGGG + Intronic
1006594841 6:35185544-35185566 CACTGGGAGGTCAGGCCAGGAGG - Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006774285 6:36580021-36580043 CACTGAGTGGGAAGGGAGGGTGG + Intergenic
1006937101 6:37726070-37726092 CACTGGGAGGGAAGGCACAGGGG + Intergenic
1007178665 6:39913113-39913135 CTCTTGGAAGGGAGGGACGGGGG + Intronic
1007267751 6:40610032-40610054 AAGTGGGAGGGGAGGCAGGGAGG - Intergenic
1007353595 6:41293992-41294014 CACTGAGAGTGGATGGAGGGAGG + Intergenic
1007369921 6:41420048-41420070 CACTGGGAGTCCAGGGCAGGGGG + Intergenic
1007387208 6:41528096-41528118 AACTGGGCGGGGAGGGAAGTGGG - Intergenic
1007577834 6:42937650-42937672 CACTGGGAGACGAGGGTGGGAGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008273367 6:49515919-49515941 GAGAGGGAGGGGAGGGAGGGAGG - Intronic
1008385122 6:50880372-50880394 TACAGGAAGGGGAGGGGAGGAGG - Intergenic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008635700 6:53408357-53408379 CAGAGAGAGGGGAGAGAAGGTGG + Intergenic
1008954025 6:57194947-57194969 GGCAGGGAAGGGAGGGAAGGTGG + Intronic
1009808658 6:68634799-68634821 CACTGGGAGGCGAGGCAGGGGGG - Intergenic
1009828881 6:68904028-68904050 AACAAGGAAGGGAGGGAAGGAGG + Intronic
1010597441 6:77781139-77781161 CATTGGGAGGCTAAGGAAGGAGG - Intronic
1011101572 6:83728169-83728191 CCCTGGGAAGGGAAGGAAAGAGG + Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011534434 6:88360789-88360811 GACAGGGAGGGAAGAGAAGGAGG - Intergenic
1011543740 6:88462471-88462493 TACTAGGAGGGGAGGGAGGGAGG + Intergenic
1011686813 6:89830111-89830133 CACCGGGGGCGGAGGGAACGTGG - Intronic
1011765078 6:90611288-90611310 GACGGGGAGCGGAGGGATGGGGG - Intergenic
1012425095 6:99105278-99105300 TAATGGAGGGGGAGGGAAGGAGG + Intergenic
1012431481 6:99168311-99168333 GAAGGGGAGGGGAGGGAAGAAGG + Intergenic
1012501313 6:99890778-99890800 CTCTGGGAGGCGAAGGCAGGTGG - Intergenic
1012575288 6:100788848-100788870 AACTGGGAGTGGTGGGAAAGAGG + Intronic
1013294801 6:108749493-108749515 TACTGGGTGGGTGGGGAAGGGGG + Intergenic
1013490837 6:110644797-110644819 CAGGGGGAGGGGAGGCAGGGGGG + Intronic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014703251 6:124715403-124715425 CACAGGGAGGGGAGAGGAGAAGG - Intronic
1014719455 6:124898344-124898366 AAGTGGGATGGGAAGGAAGGTGG - Intergenic
1015242184 6:131036915-131036937 CACTGAGAGGGGCAGGAAAGAGG + Intronic
1015558471 6:134487691-134487713 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
1015805273 6:137102210-137102232 CATTAGATGGGGAGGGAAGGAGG - Intergenic
1015840653 6:137473415-137473437 CAGAGGGAGGGGAGGGGCGGAGG + Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1015891953 6:137978351-137978373 GACTAGGAAGGGAGGGAACGTGG + Intergenic
1015973101 6:138762522-138762544 CATGGGGAGGGGAGGAAGGGGGG - Intronic
1016361946 6:143276717-143276739 TACTAGGAAGGGAGGGAGGGAGG + Intronic
1016741316 6:147532290-147532312 CTCAGGGAGGTGGGGGAAGGTGG - Intronic
1016952904 6:149598477-149598499 CACTGGGAGGGTGAGGCAGGAGG + Intronic
1017074714 6:150607025-150607047 AAGTTGGAGGGAAGGGAAGGGGG - Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017084528 6:150701600-150701622 CACTGTGGGGTGAGGGGAGGGGG - Intronic
1017158287 6:151341806-151341828 GCCTGGGACGGGAAGGAAGGAGG - Intronic
1017517026 6:155165554-155165576 CACTGGGAGGGCAAGGCAGGAGG + Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017720619 6:157240909-157240931 CCCTGGGGAGGGAGGGAGGGAGG + Intergenic
1017721299 6:157245071-157245093 CTCTGGGAGGCCAGGGAGGGCGG + Intergenic
1017802526 6:157910623-157910645 CTGGGGGAGGGGAGGGAATGTGG - Intronic
1017931918 6:158963417-158963439 AAGGGGGAGGGAAGGGAAGGGGG - Intergenic
1018363726 6:163097885-163097907 GACTGGGAGGGTATGGAATGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018742055 6:166737001-166737023 GGCTGGGAGGGGAGAAAAGGGGG + Intronic
1018937175 6:168281104-168281126 CCACGGGTGGGGAGGGAAGGCGG + Intergenic
1018984890 6:168628935-168628957 CCCTGAGAGGGAAGGGCAGGGGG + Intronic
1019103640 6:169651067-169651089 CACTGGGAGGGGTGGGAGTTGGG + Intronic
1019192538 6:170261488-170261510 CACTGGGAGGCCAAGGCAGGAGG + Intergenic
1019268326 7:131565-131587 GAAAGGGAGGGGAGGGGAGGAGG + Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019522176 7:1466010-1466032 CCCTGGGAGGGGAGGGAGCCAGG - Intergenic
1019562332 7:1665147-1665169 AACGGGGAGGGAAGGGAGGGAGG + Intergenic
1019698894 7:2463077-2463099 CAGGGGCAGGGGAGGGAATGGGG + Intergenic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1019941756 7:4297668-4297690 GACTGTGGGGGGCGGGAAGGCGG - Intergenic
1020104141 7:5413369-5413391 GATGGGGAGAGGAGGGAAGGAGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020262286 7:6537030-6537052 AAGAGGGAGGGGAGGGATGGAGG + Intronic
1020441364 7:8220537-8220559 TACTGGGAGAGAAGGGAACGAGG + Intronic
1020446672 7:8276139-8276161 CACTGGGAAGGGTGAGAGGGTGG - Intergenic
1020748770 7:12112253-12112275 CTTTGGGAGGGGAAGGAAGCAGG - Intergenic
1020773404 7:12424153-12424175 TACTGGGAGGCGCGAGAAGGTGG + Intergenic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1021989574 7:26128996-26129018 CCATGGGAGGGGAGGAAAGTGGG + Intergenic
1022119595 7:27295089-27295111 GACTGGATGGGGAGGGAAAGGGG - Intergenic
1022249603 7:28594090-28594112 CACTGGGAGGTGGGGGCAGGGGG - Intronic
1022274440 7:28841852-28841874 GAAGGGGAAGGGAGGGAAGGGGG + Intergenic
1022363534 7:29685677-29685699 GGCTGGGGGAGGAGGGAAGGTGG - Intergenic
1022427753 7:30284848-30284870 GGCTGGGGGAGGAGGGAAGGTGG + Exonic
1022443417 7:30451717-30451739 CACTGGAACGGGAGGAAGGGAGG + Exonic
1022660011 7:32358129-32358151 CACTGCGTGGGAAGGGGAGGAGG - Intergenic
1022697840 7:32728067-32728089 GGCTGGGGGAGGAGGGAAGGTGG + Intergenic
1022945326 7:35278295-35278317 GTCTGGAAGGGAAGGGAAGGTGG + Intergenic
1023433586 7:40119309-40119331 CACTGGGAGGCCAAGGCAGGAGG + Intergenic
1023562712 7:41492474-41492496 CACAGGGAGTGGTGGGAAGGAGG + Intergenic
1023609592 7:41959326-41959348 CACTGGGTGCTGAGGAAAGGTGG + Intergenic
1023738335 7:43254614-43254636 CAATGGTGGGGGAGGCAAGGGGG - Intronic
1023852542 7:44158455-44158477 CACTGGGAGGGGCCGGCTGGTGG + Intronic
1024126434 7:46302271-46302293 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
1024231481 7:47367142-47367164 CACTGGGAGGCTACAGAAGGTGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025227436 7:57177660-57177682 CACAGGGTGGGATGGGAAGGTGG + Intergenic
1025928847 7:65979673-65979695 CACAGGGTGGGGCGGGAAGGTGG + Intronic
1026312045 7:69194826-69194848 CTATGGGAGGGGAGGGAGAGGGG + Intergenic
1026446821 7:70492076-70492098 CACTGGGAGGGGTGGGGTGGAGG - Intronic
1026512090 7:71035874-71035896 CACTGCTAGAGGTGGGAAGGAGG - Intergenic
1026517290 7:71084094-71084116 AAAAGGGAGGGGAGGGGAGGAGG - Intergenic
1026580760 7:71614870-71614892 AACAGGGAGGGAAGGGAGGGAGG + Intronic
1026948926 7:74334379-74334401 CCCTGGGAGGGGAGGGAGTCGGG + Intronic
1027133173 7:75605777-75605799 CACTGGGAGGCCAAGGCAGGGGG - Intronic
1027219149 7:76202795-76202817 CCCTGGGAGGGAGGGGGAGGCGG - Intronic
1027237841 7:76308555-76308577 CACTGGGAGGCCAAGGCAGGAGG + Intergenic
1027414808 7:77963631-77963653 CTCTGGGAGGCCAGGGCAGGAGG - Intergenic
1027991522 7:85369064-85369086 CATTGAGAGTGGATGGAAGGAGG - Intergenic
1028244698 7:88462934-88462956 CACAGGGAGGGGGAGGAAAGGGG - Intergenic
1028316104 7:89404961-89404983 AAGGGGGAGGGGAGGGACGGAGG + Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028635668 7:92986461-92986483 CACTAGGAGGAAAGGGTAGGTGG - Intergenic
1028809637 7:95069428-95069450 AAATGGAAGGAGAGGGAAGGAGG + Intronic
1028815666 7:95140961-95140983 CTTTGGGAGGGCAGGGCAGGCGG - Intronic
1028920337 7:96303727-96303749 CACTGACATGGGAGGGCAGGAGG - Intronic
1029162293 7:98561247-98561269 GAAGGGGAGGGGAGGGGAGGGGG - Intergenic
1029351597 7:100016646-100016668 GAAAGGGAGGGGAGGGATGGAGG - Intronic
1029527134 7:101101691-101101713 CTTTGGGAGGCGAAGGAAGGAGG + Intergenic
1029536651 7:101161194-101161216 AGCTGGGAGGGGTGGGGAGGGGG + Exonic
1029852185 7:103474470-103474492 CACATGGAGGGGATGGGAGGGGG - Intronic
1029984091 7:104905476-104905498 CTCTGGGAGGCTGGGGAAGGTGG + Intronic
1030018155 7:105244972-105244994 CAGGGAGAGGGCAGGGAAGGGGG - Intronic
1030863409 7:114667178-114667200 TTTTGGGAGGGGAGGGCAGGAGG + Intronic
1031329948 7:120452471-120452493 CACTGGGAGTGGACAGAGGGAGG + Intronic
1031363690 7:120877855-120877877 CACTGGGAGATGATGGAATGGGG + Intergenic
1031456786 7:121990761-121990783 CTTTGGGAGGTGAGGGCAGGCGG - Intronic
1031518816 7:122737452-122737474 CACTGGGAGGCCAAGGCAGGCGG - Intronic
1031968387 7:128045262-128045284 CACTGGGTGGGGTGGGGAGGAGG - Intronic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032058244 7:128701324-128701346 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1032125572 7:129189918-129189940 CATTTGGAGGGAAGGGTAGGGGG + Intronic
1032172492 7:129597093-129597115 CACTGGGAGGCCAAGGCAGGCGG + Intergenic
1032177782 7:129646695-129646717 GACTGGAAGGGGAGAGAAGAAGG - Intronic
1032348555 7:131139338-131139360 GAATGAGAGGGGAGGGACGGGGG - Intronic
1032378429 7:131448877-131448899 AACTAAGTGGGGAGGGAAGGAGG - Intronic
1032676027 7:134130281-134130303 CTCTGGGGGGGGGGGGAAGCTGG - Intronic
1032900223 7:136299085-136299107 CACTGTGATGGGATGGAATGTGG - Intergenic
1033045496 7:137958419-137958441 CTCTGGGAGGCCAGGGCAGGAGG + Intronic
1033092853 7:138402872-138402894 GAAGGGGAGGGGAGGGGAGGGGG + Intergenic
1033156575 7:138961989-138962011 CACTGAGACAGGTGGGAAGGGGG - Intronic
1033217377 7:139502997-139503019 CACTGGGAGGGCGAGGCAGGTGG + Intergenic
1033537986 7:142329226-142329248 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033551527 7:142452009-142452031 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033653682 7:143360171-143360193 CACAGGGAGGTGAGGGCCGGCGG - Intronic
1034102329 7:148460356-148460378 CTCTGGGAGGCCAGGGCAGGTGG + Intergenic
1034313817 7:150111873-150111895 CGCCGGGAGTGGTGGGAAGGGGG - Intergenic
1034503443 7:151467292-151467314 CAGTAGGAGGGCAGGGCAGGCGG - Intronic
1034744948 7:153515715-153515737 CACTTGGAGTGGGGAGAAGGGGG + Intergenic
1034793081 7:153988919-153988941 CGCCGGGAGTGGTGGGAAGGGGG + Intronic
1034959825 7:155358305-155358327 CACGAGGAAAGGAGGGAAGGTGG + Exonic
1034975950 7:155449393-155449415 CCGTGCGAGGGGAGGGGAGGGGG - Intergenic
1035021640 7:155804148-155804170 CGCCGGGGCGGGAGGGAAGGAGG - Intronic
1035041299 7:155929651-155929673 CACTGGATGAGGAGGGAGGGAGG + Intergenic
1035341773 7:158166868-158166890 CACTGGGAGGGGCTGGACAGAGG + Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036432153 8:8701838-8701860 CGGTGGGCGGGGAGGGAAAGAGG - Intergenic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036696128 8:10976311-10976333 CCATGGCAGGGGAAGGAAGGAGG - Intronic
1036796049 8:11757558-11757580 AACAGGGAGGGTGGGGAAGGAGG + Intronic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037057042 8:14455974-14455996 CAGTTGGAGGGGAGGGGATGCGG + Intronic
1037286997 8:17311928-17311950 AACTCAGAGGGGAGGGAAGAGGG - Intronic
1037315958 8:17599808-17599830 CACTGGTAGATCAGGGAAGGAGG - Intronic
1037658276 8:20905989-20906011 CACGTGGAGGGAAGGGAAGGAGG + Intergenic
1037798579 8:22017794-22017816 CACTGGGAGGAGAGGAAAACGGG + Intergenic
1037802529 8:22043336-22043358 GACCGGGTGGGCAGGGAAGGGGG + Intronic
1037820822 8:22133774-22133796 AACCTGGAGGGGAGGGGAGGTGG - Intergenic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1037892290 8:22629713-22629735 TGCTGGGTGGGGTGGGAAGGGGG + Intronic
1037953424 8:23034481-23034503 CATTGGGAGGTCAGGGCAGGAGG + Intronic
1038267169 8:26046180-26046202 TAGTGGGCGGGGAGGGACGGGGG + Intergenic
1038334185 8:26633247-26633269 CTCTTGGAGGGGAGGGACTGGGG - Intronic
1038372350 8:27006825-27006847 GTCTGGGAGGGGTGGGGAGGAGG + Intergenic
1038399090 8:27269403-27269425 GACTGGGAGGGAAGGAAAGGGGG + Intergenic
1038593563 8:28864097-28864119 CACTGGGAGGTCAAGGCAGGAGG + Intronic
1038612613 8:29069860-29069882 CCCTGGCAGAGGAGGGATGGGGG + Exonic
1038645812 8:29361277-29361299 CACAGGCAGGGTGGGGAAGGTGG - Intergenic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1038756113 8:30342414-30342436 CACTGGGAGGGTGAGGAGGGAGG - Intergenic
1039212724 8:35235408-35235430 CGCTCGGAGGGGAGGGGAAGGGG + Intergenic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1039469402 8:37803928-37803950 CCCTGGCAGGGGAAGGGAGGAGG - Intronic
1039473099 8:37826120-37826142 AAGTGAGCGGGGAGGGAAGGGGG + Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039505073 8:38046144-38046166 CACTGGGAGGCCAAGGCAGGTGG - Intronic
1039535580 8:38309222-38309244 CTCTGGGAGGGCAAGGCAGGTGG + Intronic
1039658791 8:39439538-39439560 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
1039936713 8:42051998-42052020 CGGGGGGAGGGGAGGCAAGGCGG + Intergenic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1040017528 8:42711843-42711865 GAAGGGGAAGGGAGGGAAGGAGG - Intronic
1040030037 8:42815528-42815550 CTCTGGGAGGGCAAGGCAGGAGG - Intergenic
1040337452 8:46423254-46423276 CACAGGGTGGCGAGGGCAGGGGG + Intergenic
1040580642 8:48696156-48696178 CACAGGGAGGGGAGGGCGTGGGG - Intergenic
1040732039 8:50459673-50459695 CACTGAGGCAGGAGGGAAGGAGG - Intronic
1040960291 8:53024769-53024791 GACTGGGGAGAGAGGGAAGGAGG - Intergenic
1041073600 8:54148794-54148816 CAATGGGAGGGGATGCAAAGGGG + Intergenic
1041330577 8:56719577-56719599 GCCTGGGAGGGGAGGGGAAGTGG + Intergenic
1041720025 8:60967403-60967425 CACTGGGCGGTGAAGGATGGTGG + Intergenic
1041944264 8:63424180-63424202 CACTGGGACTGGTTGGAAGGTGG + Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042119876 8:65475133-65475155 AACTGGGAAGGGAGGGAGGAAGG + Intergenic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043061289 8:75507500-75507522 CACTGGGAGGCCAAGGCAGGTGG - Intronic
1043383816 8:79729742-79729764 CACAGGGAGGTGAGTGAAGCTGG - Intergenic
1043417297 8:80064055-80064077 GGAAGGGAGGGGAGGGAAGGAGG + Intronic
1043961787 8:86424834-86424856 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044243867 8:89918407-89918429 CACTGGGAGGCTAAGGCAGGAGG - Intronic
1044437241 8:92178716-92178738 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044987599 8:97769015-97769037 CACTGGGAGGGCAAGGCAGGCGG - Intergenic
1045026611 8:98093015-98093037 CATTGGGAGGCCAAGGAAGGCGG - Intronic
1045257114 8:100535543-100535565 GACTGGCATGGGAGGGAAGCAGG - Intronic
1045480280 8:102586272-102586294 TACTGAGAGAGGAAGGAAGGAGG + Intergenic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1045651287 8:104343775-104343797 CACATGGCGGGGAGAGAAGGTGG - Intronic
1046465992 8:114604059-114604081 CACTGGGAGGCCAAGGAGGGAGG - Intergenic
1046868265 8:119174907-119174929 CACTGGGATGGGAGGCAGGGTGG + Intronic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047197901 8:122738129-122738151 TCCTGGGAGGGGAAGGAAGTGGG - Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047411167 8:124625908-124625930 AACTGAGAGGGGAGGGAGAGAGG - Intronic
1047525938 8:125634089-125634111 CACAGTGAGGGGAGGGCGGGTGG - Intergenic
1047696211 8:127406219-127406241 GAAGGGGAGGGGAGGGGAGGGGG + Intergenic
1047750729 8:127878554-127878576 CAGTGGCAGGGAAGGGAAAGAGG - Intergenic
1047816567 8:128470673-128470695 TACTGGAAGGTGAGGGAAGGTGG - Intergenic
1047894965 8:129356498-129356520 AACAGGGAGGGGAAGGAGGGAGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048456902 8:134586734-134586756 CACTGAGACAGGAGTGAAGGGGG - Intronic
1048979667 8:139696626-139696648 CACAGAGGAGGGAGGGAAGGAGG + Intronic
1049020583 8:139955195-139955217 AACGGGGAGGTGAGGGTAGGAGG - Intronic
1049115972 8:140687895-140687917 GCCTGGGAGGGAAGGAAAGGGGG - Intronic
1049122921 8:140756079-140756101 CACTGGGAGGCCGGGGCAGGTGG + Intronic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049246550 8:141565808-141565830 CTCTGTGAGGGTGGGGAAGGAGG + Intergenic
1049284468 8:141767147-141767169 AGCGGGGAGGGGAGGGGAGGGGG - Intergenic
1049414974 8:142490996-142491018 CCCTGGGAGGGGGTGGGAGGCGG - Intronic
1049653323 8:143786794-143786816 AACTTGGAGGGGAGGGAATGAGG + Intergenic
1049688789 8:143949859-143949881 CACTGGGACAGGAGAGGAGGCGG + Intronic
1049796170 8:144498199-144498221 CACAGGGAGCTGTGGGAAGGTGG + Intronic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1050006005 9:1131144-1131166 CACTGGGAGGCCAAGGCAGGAGG - Intergenic
1050309610 9:4339783-4339805 AACTGTAGGGGGAGGGAAGGGGG + Intronic
1050309620 9:4339799-4339821 AAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050309639 9:4339828-4339850 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050312341 9:4366403-4366425 TCCTGGGATGGGAGGAAAGGAGG + Intergenic
1050471102 9:5991477-5991499 CACTGGGAGGCCAAGGCAGGTGG + Intronic
1050837698 9:10104156-10104178 GGCTGGGAGAGGAGGGAAGGAGG + Intronic
1051249944 9:15149370-15149392 CACTGGGAGGCCAAGGCAGGTGG - Intergenic
1051287824 9:15514023-15514045 CTCTGGGAGGCCAGGGCAGGTGG + Intergenic
1051374912 9:16392966-16392988 CACAGGAGCGGGAGGGAAGGAGG + Intergenic
1051413986 9:16819879-16819901 CTCTGGGAGGGCAAGGCAGGAGG + Intronic
1051566318 9:18503199-18503221 CACTGGGAGAGAGGGGAATGGGG - Intronic
1051642749 9:19238590-19238612 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052524452 9:29595868-29595890 GCCATGGAGGGGAGGGAAGGAGG + Intergenic
1052843683 9:33315641-33315663 CTCTGGGAGGCCAGGGCAGGTGG + Intronic
1052990164 9:34514373-34514395 CACTGGTCGGGGAGGGAACGGGG - Exonic
1053061856 9:35038020-35038042 CACTGGGAGGCCAAGGCAGGTGG + Intergenic
1053337276 9:37286908-37286930 AGGTGGGAGGGGAGGGAGGGAGG - Intronic
1053471780 9:38351789-38351811 CTCTGGGAGGCCAAGGAAGGAGG + Intergenic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053674313 9:40407809-40407831 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054385421 9:64547876-64547898 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054454005 9:65420326-65420348 GGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1054510308 9:65968481-65968503 CAGTGGGAGGAGAGGAAAAGGGG - Intergenic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055337987 9:75252116-75252138 CATTGGGAGTGAATGGAAGGAGG - Intergenic
1055439727 9:76325959-76325981 CAAAGGGAGGGGAAGGAATGTGG + Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055656267 9:78453039-78453061 CACTGTGAGGAAAGGGATGGGGG - Intergenic
1055789653 9:79910205-79910227 CACTGGCAGGGGATTAAAGGTGG - Intergenic
1056482065 9:87015928-87015950 AAGTGGGAGGGGAGGGGTGGGGG + Intergenic
1056533461 9:87507605-87507627 GGTGGGGAGGGGAGGGAAGGAGG + Intronic
1056737697 9:89223930-89223952 CACTGTGGAGGGAGGGAGGGAGG - Intergenic
1056958463 9:91101418-91101440 CTCTGGAAGGGGAGGGCAAGGGG + Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057767434 9:97934434-97934456 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1057823140 9:98349595-98349617 CTTTGGGAGGCCAGGGAAGGCGG - Intronic
1057834379 9:98432448-98432470 CACTGAGGTGGGTGGGAAGGTGG + Intronic
1057879599 9:98783120-98783142 GAAGGGGAGGGGAGGGGAGGGGG + Intronic
1057896656 9:98914614-98914636 GACTGGGAAGGGTGGGTAGGTGG - Intergenic
1057937718 9:99254718-99254740 CATGGGGTGGGGAGGGATGGAGG - Intergenic
1058343647 9:103930287-103930309 CACGGGGAAGGGAGGGAGGCAGG - Intergenic
1058408020 9:104698967-104698989 GAAGGGGAGGGAAGGGAAGGGGG + Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059405702 9:114097435-114097457 ACCTGGGAGGGGAGGGAGGAGGG + Exonic
1059594216 9:115698854-115698876 CACTGGCTGGGAAGGGTAGGAGG + Intergenic
1059656931 9:116365837-116365859 CACAGAGAGAGGAGAGAAGGAGG - Intronic
1059701043 9:116775644-116775666 GACAGGAAGGGAAGGGAAGGAGG + Intronic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1059992450 9:119878085-119878107 CACTGGGTGGGGAAATAAGGAGG - Intergenic
1060008669 9:120024134-120024156 GGCTGGGAGGGGATGGGAGGAGG + Intergenic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060210460 9:121707040-121707062 CACAGGGAGGGGAGGAAGGGAGG - Intronic
1060220753 9:121762927-121762949 AACTGGCTGGAGAGGGAAGGTGG - Intronic
1060303857 9:122393112-122393134 CACTGAGAGGGCAAGGAAGTGGG + Exonic
1060400920 9:123349212-123349234 CACTGGGAGGCCAAGGTAGGAGG + Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060813621 9:126623693-126623715 GCCTGGGAGGGGTGGGGAGGGGG + Intronic
1060859747 9:126944577-126944599 AATTGGGTGGGGAGGGAGGGTGG + Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1060933560 9:127503536-127503558 CCCAGGGAGGGGAGGGGACGAGG + Intergenic
1060949575 9:127593059-127593081 CACTGGGAGGCCAAGGCAGGCGG - Intergenic
1061026835 9:128055308-128055330 GAAGGGGAGGGGAGGGGAGGGGG + Intergenic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1061492112 9:130951091-130951113 CGCTGGAAGGGGAGTGGAGGGGG - Intergenic
1061498554 9:130989679-130989701 CCATGGGAGAGGAGGGCAGGGGG - Intergenic
1061697379 9:132387192-132387214 CACTGGGAGGCCAAGGCAGGAGG - Intronic
1061798744 9:133103070-133103092 CACTGGAGGGTGAGGGTAGGAGG - Intronic
1062030345 9:134359398-134359420 GCCTGGGAAGGGAGGGGAGGTGG - Intronic
1062048979 9:134437575-134437597 CGCGGGGATGGGAGGGGAGGAGG + Intronic
1062118606 9:134822178-134822200 TCCTGGGAGGGCAGGGAGGGTGG + Intronic
1062144036 9:134979018-134979040 GGCAGGGAGGGGAAGGAAGGAGG + Intergenic
1062343131 9:136102538-136102560 GGCTGGGAGGGAAGGGGAGGTGG + Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062477879 9:136738277-136738299 CACTTGGAGGGGAGGGACAGAGG + Intronic
1062722848 9:138053532-138053554 CACAGGGAGGGGCCGGAAGCAGG - Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1203361741 Un_KI270442v1:222382-222404 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1203716583 Un_KI270742v1:156013-156035 CCCTGGGAGGGCGGGGAATGGGG + Intergenic
1203534630 Un_KI270743v1:22222-22244 CCCTGGGAGGGCGGGGAATGGGG - Intergenic
1203650812 Un_KI270751v1:119575-119597 CCCTGGGAGGGCGGGGAATGGGG + Intergenic
1185484409 X:471242-471264 CACTGGCAGCGGATGGAATGAGG + Intergenic
1185502468 X:608407-608429 GAACGGGAGGGGAGGGGAGGGGG - Intergenic
1185581381 X:1213262-1213284 AAGGGGGAGGGGAGGGAAGGGGG - Intergenic
1185581390 X:1213278-1213300 GGAAGGGAGGGGAGGGAAGGGGG - Intergenic
1185592516 X:1286935-1286957 CGGGGAGAGGGGAGGGAAGGAGG + Intronic
1185598694 X:1324487-1324509 GGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1185756940 X:2659782-2659804 GAATGGGAGGGAAGGGGAGGGGG - Intergenic
1186207162 X:7213047-7213069 CTTTGGGAGGTCAGGGAAGGAGG - Intergenic
1186207271 X:7213836-7213858 CTTTGGGAGGTCAGGGAAGGAGG + Intergenic
1186260878 X:7778021-7778043 AACTGGGTGGGGAGGGGAAGAGG - Intergenic
1186286257 X:8046837-8046859 CACTGGTAGGCCAGGGATGGTGG - Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186979118 X:14939936-14939958 CAGTGGGAGGGGGAGGAGGGAGG - Intergenic
1186997377 X:15138364-15138386 CACTGGTAGGGGAGAGGAGAAGG + Intergenic
1187007480 X:15246810-15246832 CACTGGGTGAGGGGGGATGGGGG + Intronic
1187036171 X:15542267-15542289 CACTGGTAGGGAAGGCAAGAAGG + Intronic
1187147537 X:16651180-16651202 TGGTGGGAGGGGAGGGAGGGAGG + Intronic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187435993 X:19269676-19269698 CTTTGGGAGGCGAGGGAGGGTGG - Intergenic
1187586084 X:20663400-20663422 CACTGGGAGTGGAGGATGGGGGG - Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188009216 X:25039710-25039732 CACTGGTGGGGCGGGGAAGGGGG - Intergenic
1188053767 X:25517796-25517818 CACTGGGAAGGAAGGGAGGGAGG + Intergenic
1188303464 X:28533039-28533061 CAATGGGAGGGGAAGAAGGGTGG + Intergenic
1188755347 X:33954687-33954709 GACTGGGAGGGGGTGGAAGCTGG - Intergenic
1189102766 X:38208305-38208327 CACTGGGAGGGGCCACAAGGGGG - Intronic
1189232656 X:39464501-39464523 GACTGGGAGGGGAGGTAAGGTGG + Intergenic
1189324614 X:40105170-40105192 CACGGGGAGGGGCGGGGAGGCGG - Intronic
1189364812 X:40380313-40380335 CAGCTGGAGGGGAGGCAAGGTGG + Intergenic
1189649848 X:43177452-43177474 ACCTGGGAGGGGAGGGGAGCAGG - Intergenic
1189954294 X:46262124-46262146 CAAAGGGAGGGGACGGAAAGAGG + Intergenic
1190091316 X:47439787-47439809 CACTTAGATAGGAGGGAAGGTGG + Intergenic
1190363339 X:49669125-49669147 CACGGGGATGGGAAGGTAGGAGG - Intergenic
1190368305 X:49718182-49718204 GACTGGGTGGGGAGGGCACGAGG + Intergenic
1190436143 X:50427664-50427686 AACTGGGAGGGGGTGGGAGGGGG + Intronic
1190681462 X:52830339-52830361 CAGGGGGAGGGGGGAGAAGGAGG - Intergenic
1191965619 X:66754013-66754035 CAAGGGGAAGGGTGGGAAGGGGG - Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192183973 X:68933955-68933977 CTTTGGGAGGTGAAGGAAGGAGG + Intergenic
1192193944 X:69016325-69016347 CGCTGGCTGGAGAGGGAAGGAGG - Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192263537 X:69523575-69523597 AACTGGGAGGGGAAGGGAGCAGG - Intronic
1193131041 X:77920152-77920174 TACTGGGTGGGGAGGGAGTGGGG - Intronic
1193186102 X:78514587-78514609 CCCTGGGAAGGGAGAGAGGGAGG + Intergenic
1193189617 X:78554113-78554135 CATTGGGAAGGGTGGGAGGGGGG + Intergenic
1193344828 X:80393377-80393399 CAATGGGAGGGGAGAGAAACGGG - Intronic
1193917585 X:87383919-87383941 CAAGGGGAAGGGTGGGAAGGAGG + Intergenic
1194010358 X:88553954-88553976 CACTGGGGGTGCAGGTAAGGAGG + Intergenic
1196534422 X:116825164-116825186 CAATGGAAGAGGAGGGGAGGGGG + Intergenic
1196650077 X:118159352-118159374 GAGGGGGGGGGGAGGGAAGGAGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197334964 X:125202652-125202674 CACTGGGAGAGTAGGGGCGGGGG - Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1197761409 X:130030880-130030902 GACTGGGAGAGAAAGGAAGGTGG - Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1198813336 X:140559234-140559256 GACTGGGAAGGGTGGGTAGGTGG - Intergenic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1199010840 X:142756731-142756753 CACAGAGAGGGGAGGGCTGGAGG - Intergenic
1199516695 X:148685228-148685250 CACTGGGACAGGAGGAAAAGGGG + Intronic
1199677304 X:150199347-150199369 GCCTGTGAGGGGAGGGAAGGTGG + Intergenic
1199728401 X:150606961-150606983 TTTTGGGAGGGGAGGGGAGGGGG - Intronic
1200092766 X:153643558-153643580 CCCGGGGAGGGGCGGGGAGGCGG + Intronic
1200101069 X:153689267-153689289 CGAGGGGAGGGGAGGGCAGGGGG - Intronic
1200112317 X:153747328-153747350 CACTGGCGGGGGAGGGGTGGGGG + Intergenic
1200213699 X:154358164-154358186 CACAGGCAGGGGAGGCAGGGGGG - Intronic
1200734829 Y:6782919-6782941 CACTGGGAGGAGAGCAGAGGAGG + Intergenic
1201021969 Y:9669153-9669175 CATTGGGAGGCCAAGGAAGGAGG - Intergenic
1201074764 Y:10178782-10178804 GACAAGGAGGAGAGGGAAGGAGG - Intergenic
1201170778 Y:11260966-11260988 CCCTGGGAGGGTGGGGAATGGGG + Intergenic
1201173532 Y:11293616-11293638 CAATGGAAGGGAAGGGAATGGGG - Intergenic
1201274716 Y:12286679-12286701 CTCTTGGAGGGGAAGTAAGGGGG + Intergenic
1201515211 Y:14812978-14813000 AGGTGGGAGGGAAGGGAAGGAGG - Intronic
1201549995 Y:15209429-15209451 GAAGAGGAGGGGAGGGAAGGAGG + Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201795203 Y:17889669-17889691 CACTGGGAGTGCTGGGAAGTGGG + Intergenic
1201806352 Y:18016315-18016337 CACTGGGAGTGCTGGGAAGTGGG - Intergenic
1202344580 Y:23908035-23908057 CACTGAGAGGGGAGGATAGGTGG + Intergenic
1202526188 Y:25762048-25762070 CACTGAGAGGGGAGGATAGGTGG - Intergenic