ID: 1071570240

View in Genome Browser
Species Human (GRCh38)
Location 10:86692692-86692714
Sequence TGTCAGCTGGAGCCCTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071570240_1071570246 20 Left 1071570240 10:86692692-86692714 CCTGCAAAGGGCTCCAGCTGACA 0: 1
1: 0
2: 3
3: 17
4: 211
Right 1071570246 10:86692735-86692757 GAGTCAGTGAGGTGGGCACCTGG 0: 1
1: 0
2: 0
3: 28
4: 282
1071570240_1071570243 9 Left 1071570240 10:86692692-86692714 CCTGCAAAGGGCTCCAGCTGACA 0: 1
1: 0
2: 3
3: 17
4: 211
Right 1071570243 10:86692724-86692746 GGCAGCATCGTGAGTCAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 122
1071570240_1071570244 12 Left 1071570240 10:86692692-86692714 CCTGCAAAGGGCTCCAGCTGACA 0: 1
1: 0
2: 3
3: 17
4: 211
Right 1071570244 10:86692727-86692749 AGCATCGTGAGTCAGTGAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 97
1071570240_1071570245 13 Left 1071570240 10:86692692-86692714 CCTGCAAAGGGCTCCAGCTGACA 0: 1
1: 0
2: 3
3: 17
4: 211
Right 1071570245 10:86692728-86692750 GCATCGTGAGTCAGTGAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071570240 Original CRISPR TGTCAGCTGGAGCCCTTTGC AGG (reversed) Intronic
901878492 1:12180585-12180607 ACTCTGCTGGAGCCCTTAGCTGG - Intronic
905704209 1:40041948-40041970 TGTCAGTTGAAGCTCTTTGTGGG + Intronic
906251922 1:44317304-44317326 TGGCAGTTGGTGCCTTTTGCGGG - Intronic
907630478 1:56076578-56076600 AGTTAGCTGGAGCCCTATCCTGG + Intergenic
911410867 1:97504815-97504837 AGTCAGCAGGTTCCCTTTGCAGG + Intronic
912688397 1:111785212-111785234 TGTCAGCTCTAGCCCCTTGGGGG + Intronic
916751219 1:167724309-167724331 TGTAAGCTGGTGCCCTTGGCAGG - Intronic
917714648 1:177722038-177722060 TGTCAGCTGGAGGACATTGATGG - Intergenic
921947009 1:220892987-220893009 TTTCAGCTGGAGACCCTTGACGG - Intergenic
922608001 1:226902807-226902829 TGGCAGCTGTAGGCCCTTGCTGG - Intronic
923272854 1:232373193-232373215 TGTCAGCTGGAGCAACTTCCAGG + Intergenic
924644036 1:245860477-245860499 TGTCTCCGGGAGGCCTTTGCTGG - Intronic
1065722892 10:28643356-28643378 TGTCTCCTGGAGCCCCTTCCAGG + Intergenic
1067047084 10:42990904-42990926 TGTCACCAGGAGCCGTGTGCGGG - Intergenic
1067509580 10:46884011-46884033 TGTCAGCTGAAGCCCTTAAGAGG - Intergenic
1067652674 10:48167848-48167870 TGTCAGCTGAAGCCCTTAAGAGG + Intronic
1069757270 10:70780980-70781002 AATCAGCTGGAGCCCTTGGAAGG - Intronic
1070935680 10:80293049-80293071 TGCCAGATGGTACCCTTTGCTGG + Intergenic
1071570240 10:86692692-86692714 TGTCAGCTGGAGCCCTTTGCAGG - Intronic
1073475768 10:103752112-103752134 TTTCAGCAGGAGCCCTTTGCAGG + Intronic
1074549937 10:114433391-114433413 CTCCAGCTGGAGCCTTTTGCTGG + Intronic
1076152773 10:128176672-128176694 AGTCACATGGAGCCATTTGCAGG - Intergenic
1076675798 10:132147170-132147192 TGGGAGCTGGACCCCCTTGCAGG - Intronic
1076752575 10:132550983-132551005 TTTCAGGTGGACCCCTTTCCAGG - Intronic
1076981201 11:205803-205825 TGTCAGCTGGGGCCTCATGCAGG + Intronic
1077142776 11:1031691-1031713 TGTGATCTGGAGTCCATTGCTGG + Exonic
1078081755 11:8209272-8209294 TGACAGCTGGAGCCCTCCTCTGG + Intergenic
1078694920 11:13621098-13621120 TGTCAGCTGGAGACACTTCCTGG + Intergenic
1081766630 11:45615767-45615789 AGGGAGCTGGAGCCCTTGGCAGG + Intergenic
1084172691 11:67408298-67408320 GGTCAGGTGGAGCCCTTTAAGGG - Intronic
1084425928 11:69084602-69084624 TGACAGGAGGCGCCCTTTGCAGG + Intronic
1084512641 11:69615826-69615848 TTTCAGCTGGGCCCCTTGGCTGG - Intergenic
1086567988 11:88248722-88248744 TGTCAGCTGAATCCCTCTCCAGG - Intergenic
1092513610 12:9184632-9184654 TGTCAGCCAAAGCACTTTGCAGG - Intronic
1093161978 12:15757997-15758019 TGTCAGCTTGAGACCTTAGCTGG + Intronic
1101645885 12:106630528-106630550 CATCAGCTGGTGCCCTTTGCAGG + Intronic
1104080134 12:125422804-125422826 TGTCCCCTGGAGCCCTCGGCAGG + Intronic
1105026539 12:132852953-132852975 TAGCACCTGGAGCCCCTTGCTGG + Intronic
1105383964 13:19913125-19913147 TGTTATCTGGAGCCTTTGGCGGG + Intergenic
1105699105 13:22922479-22922501 TGTCTGCTGGTGCCATGTGCAGG - Intergenic
1105850847 13:24335325-24335347 TGTCTGCTGGTGCCGTGTGCAGG - Intergenic
1105896986 13:24724868-24724890 GGTGAGCTGGAGCCCAGTGCAGG + Intergenic
1105999618 13:25708948-25708970 TGTCATCTGCAGAGCTTTGCTGG + Intronic
1106566866 13:30893171-30893193 TGTCACTTGGCGGCCTTTGCCGG - Intergenic
1106679889 13:31999017-31999039 TGTCAGATGGAGCCTTTGGGAGG - Intergenic
1106774367 13:32994196-32994218 TGTCAGCTGCAGCCCTTCCTGGG - Intergenic
1107056139 13:36105912-36105934 TGACAGCTGGAGCCCTGACCCGG - Intronic
1107467988 13:40666480-40666502 TGTCAGCTGGAGCGCGGCGCAGG - Exonic
1108948838 13:56061105-56061127 TGTCAGCTGGGACTCTTGGCTGG + Intergenic
1113925425 13:113939217-113939239 GGCCAGCTGCAGCCCTTGGCTGG - Intergenic
1116256418 14:42562230-42562252 TGGAAGTTGGTGCCCTTTGCAGG - Intergenic
1121641897 14:95490360-95490382 TAACAGCTGGAGACCTTGGCAGG + Intergenic
1122460346 14:101889368-101889390 TTTCTGTAGGAGCCCTTTGCGGG + Intronic
1122839166 14:104446412-104446434 TGACTTCTGGAGTCCTTTGCAGG + Intergenic
1124212738 15:27776723-27776745 CGTCAGCTGGAGCCGTGTTCTGG - Intronic
1124269498 15:28267825-28267847 TGTGGGCTGGAGCCCTGAGCAGG - Intronic
1124381622 15:29172520-29172542 TTTCAGCAGGTGCCCATTGCTGG + Intronic
1126213930 15:46132575-46132597 TGTCAGCTGGAGCTCCCTGAAGG + Intergenic
1127832174 15:62760554-62760576 TGTCAAGTGTAGCCTTTTGCTGG + Intronic
1129669982 15:77602219-77602241 TGCCAGCTGCTGCCCTGTGCTGG - Intergenic
1129885257 15:79032664-79032686 TGTCAGCTGGGTCCCTCTCCAGG + Intronic
1132889219 16:2196006-2196028 TGACAGCTGGAGGTCTCTGCTGG - Intronic
1135740608 16:24972113-24972135 TATCAGATGGAGCCCTTTGGAGG - Intronic
1136072461 16:27796138-27796160 GATCAGCTGGATCCCTTTACAGG + Intronic
1139851417 16:69953068-69953090 TGGCAGCTGGCACCCTTTCCAGG + Intronic
1139880395 16:70175980-70176002 TGGCAGCTGGCACCCTTTCCAGG + Intronic
1140372115 16:74419537-74419559 TGGCAGCTGGCACCCTTTCCAGG - Intronic
1141510594 16:84509467-84509489 TGCCTGCTGCAGCCCTTAGCTGG - Intronic
1141996271 16:87638324-87638346 TGTTTGCTCCAGCCCTTTGCTGG + Intronic
1142394358 16:89823178-89823200 TATCAGACGGAGCCCTTTGAGGG - Intronic
1143612354 17:8026035-8026057 GGTCAGTGAGAGCCCTTTGCTGG + Intergenic
1144520869 17:15951542-15951564 TGTCAGCTGGAGGCCCCAGCAGG - Intronic
1146056533 17:29584129-29584151 TGTAAGCTGGAGCCCTCTTAAGG + Intronic
1146650538 17:34603549-34603571 TGCCTGCTGGATCCCTGTGCAGG - Intronic
1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG + Intronic
1148689937 17:49521298-49521320 GGACACCTGGAGACCTTTGCTGG - Intergenic
1151396705 17:73827614-73827636 TGTCAGCTGGGGCCCTTCACTGG + Intergenic
1151874165 17:76857091-76857113 TGGCAGATGGACCCCTTTGTTGG - Intergenic
1152303145 17:79507018-79507040 AGGCAGCTGGAGCCCGTTGGTGG + Intronic
1153785259 18:8528753-8528775 TGTCAGCTGGAGAGCTTAGTTGG - Intergenic
1154315462 18:13300353-13300375 TGAGGGCTGGAGCCCTCTGCAGG + Intronic
1155630893 18:27890900-27890922 TGTCATCTGGAGTCCTTTCAAGG - Intergenic
1155878405 18:31114492-31114514 AGTCACCTTGAGCTCTTTGCTGG + Intergenic
1157257734 18:46153430-46153452 TGTCAGCTGCAGCCTGATGCAGG + Intergenic
1158889785 18:61862383-61862405 TGTCAGCTGAAGTTCTTTTCAGG - Intronic
1159228989 18:65580060-65580082 TGTCAGCTGGAGTCTGTTCCTGG - Intergenic
1159494273 18:69180327-69180349 TTTCAGCTCAAACCCTTTGCGGG - Intergenic
1159943899 18:74429383-74429405 TGTCAGCTGGAGCCCGTGTTTGG + Intergenic
1161935884 19:7372003-7372025 TGTCAGCTGGGGATCTTTGCCGG - Intronic
1163242646 19:16073699-16073721 TCTCAGCTAGAGACCCTTGCAGG + Intronic
1164423452 19:28118416-28118438 GAGCAGCTGGACCCCTTTGCCGG + Intergenic
1165481675 19:36068251-36068273 TGTCACCTTGAGCCCATTTCAGG - Intronic
1166132672 19:40755771-40755793 TGTCAAGTGATGCCCTTTGCTGG + Intronic
1166223752 19:41382299-41382321 TGTATCCTGGAGCCCTTTGAAGG - Intronic
1166432637 19:42740322-42740344 TGTGAGCAGGAGCCCCTTCCAGG + Exonic
1166435749 19:42765519-42765541 TGTGAGCAGGAGCCCCTTCCAGG + Exonic
1166453016 19:42917730-42917752 TGTGAGCAGGAGCCCCTTCCAGG + Exonic
1166455506 19:42937014-42937036 TGTGAGCAGGAGCCCTTTCCAGG + Exonic
1166482563 19:43186343-43186365 TGTGAGCAGGAGCCCCTTCCAGG + Exonic
1166492189 19:43269369-43269391 TGTGAGCAGGAGCCCCTTCCAGG + Exonic
925224655 2:2172718-2172740 TGTCACCAGGAGCCCCTTGCTGG + Intronic
925224665 2:2172759-2172781 TGTCGCCAGGAGCCCCTTGCTGG + Intronic
925224687 2:2172839-2172861 TGTCACCAGGAGCCCCGTGCTGG + Intronic
926140940 2:10367727-10367749 TGTCAGTGTGAGCCCTGTGCTGG + Intronic
928295217 2:30076907-30076929 TGTCTTCTGGAGCCCTTGCCTGG - Intergenic
928387559 2:30883326-30883348 GGTCAGCTGGAGGCCTTGGGTGG - Intergenic
928921392 2:36531941-36531963 AGGGACCTGGAGCCCTTTGCTGG - Exonic
929500472 2:42486767-42486789 TGACAGCAGGAACCCTTTGTAGG + Intronic
930300039 2:49603880-49603902 TGGCAGGTGGTGCCCTTTGCTGG - Intergenic
932575404 2:72959904-72959926 TGTCACCTGGATCCCTTCTCTGG + Intronic
933234324 2:79848551-79848573 TTTCAGCTGTAGCCTTTTCCTGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
936018630 2:108978104-108978126 TGCCCTCTGGGGCCCTTTGCTGG - Intronic
936463322 2:112726885-112726907 TGTCAGCCAGCGCCCTCTGCTGG + Intronic
942150708 2:173073994-173074016 TATCAGCTAGAGTGCTTTGCAGG - Intergenic
943596418 2:189862850-189862872 TTTCAGCTGCTGCCCATTGCAGG - Intronic
947187959 2:227472076-227472098 TGTCCGCTGGCGCCCTCTGCTGG - Intergenic
948665961 2:239535182-239535204 TCTCAGCTGGAGCTGTGTGCAGG + Intergenic
1168843016 20:921773-921795 TGTCAGCTGGAGCAACTTGCAGG + Intergenic
1168957985 20:1848156-1848178 TGTGAGATGGAGGCCTTTGGAGG + Intergenic
1169162970 20:3398073-3398095 GGTCAACTGGAGTCCTTTCCAGG + Intronic
1169619448 20:7488809-7488831 TCTCTGCTGGAGATCTTTGCTGG + Intergenic
1169620842 20:7504894-7504916 GGTCTGCTGGAGCCCAGTGCAGG + Intergenic
1169727298 20:8749382-8749404 TGTCTCCTGGAGCCCTTCCCAGG - Intronic
1171243372 20:23588871-23588893 TTTCAGCTGTAGCCATTTGAAGG - Intergenic
1171794756 20:29558109-29558131 TCTCGGCTGTAGCCCTTGGCGGG - Intergenic
1171853700 20:30326156-30326178 TCTCGGCTGTAGCCCTTGGCGGG + Intergenic
1174040644 20:47697279-47697301 TGACATCTGGACCCCTTTGGTGG + Intronic
1174572054 20:51508913-51508935 TGTCAGCAGGATCCCTCTGCTGG - Intronic
1176389490 21:6156307-6156329 TGTGAGCTGGAGCCCATAGGAGG + Intergenic
1177205345 21:18003788-18003810 AGTGAGCTGAAGCCCTGTGCTGG - Intronic
1178749550 21:35287402-35287424 TGTCAGCTGGAGGCCCTTGCAGG - Intronic
1179733978 21:43381931-43381953 TGTGAGCTGGAGCCCATAGGAGG - Intergenic
1180352367 22:11815594-11815616 TTTCAGCTGGAGTCCGTTCCAGG - Intergenic
1180352417 22:11815885-11815907 TTTCAGCTGGAGTCCGTTCCAGG - Intergenic
1180385838 22:12176472-12176494 TTTCAGCTGGAGTCCGTTCCAGG + Intergenic
1180917212 22:19497558-19497580 TGTCAGATGCAGCCCCTTTCTGG + Intronic
1183065873 22:35362290-35362312 TGTCACCTGGAGCACCATGCAGG - Intergenic
1183535951 22:38401592-38401614 TGCCAGCTGGGGCCCTTTGTTGG + Intergenic
1183831709 22:40421646-40421668 TGCCAGCTGGAGGTCTTTGGGGG - Intronic
1183987105 22:41575912-41575934 TGTCACCTGGAGTCCTTTTGGGG + Exonic
1184260867 22:43315138-43315160 TGCCAGCTTGAAGCCTTTGCTGG + Intronic
1184456749 22:44615229-44615251 GAGCAGCTGGAGCCCTTTGCTGG - Intergenic
1184758838 22:46533543-46533565 TGCCAGGCGGAGCCCTTGGCGGG + Intronic
1184836013 22:47021450-47021472 TGTCGCCTGGAGCCCTGAGCAGG + Intronic
1184836031 22:47021535-47021557 TGTCACCTGGAGTCCTGAGCAGG + Intronic
949123329 3:414946-414968 TGTCATCTGGTGCCCTTTCTTGG - Intergenic
949788444 3:7767011-7767033 TGTCAGCTTGAGCCCCTCTCTGG - Intergenic
954324648 3:49856788-49856810 TGCCAGCTGGACCCTTTTCCAGG + Intergenic
954839257 3:53495986-53496008 TGTCGGCTGGAAGCCTTTCCGGG + Intronic
954917622 3:54162409-54162431 TGTCGGCTGGAACCCTATGTGGG + Intronic
958493877 3:94817104-94817126 TGTTAGCTGGAGGTTTTTGCAGG - Intergenic
960255921 3:115511651-115511673 TGTCAGCTGTGACCCTTTGATGG - Intergenic
961101360 3:124201949-124201971 GGCCAGCTGGAGCCCTGTGATGG + Intronic
961154961 3:124671785-124671807 TTATAGCTGGAGCCCTTTGGGGG - Intronic
962716335 3:138129077-138129099 TGTCAGCTGGAGACATTTTTTGG - Intronic
962892186 3:139681588-139681610 TGACAGCTGGAGCACTTGTCAGG - Intergenic
968090245 3:195894769-195894791 TGTCAGCTACTGCCCTCTGCCGG + Intronic
973377730 4:49298683-49298705 CTTCAGCTGGAGTCCGTTGCAGG - Intergenic
976044026 4:80923149-80923171 TGTTAGCAGAAGCCCTTTGAAGG - Intronic
976281404 4:83330336-83330358 TGTGCCCTGGAGCCCTTTGCAGG - Intronic
983043669 4:162959441-162959463 TGCCAGCTGCAGCCCTAGGCAGG + Intergenic
984009488 4:174353857-174353879 TGTCTGCTGGAGCCCAGTGTAGG - Intergenic
984275581 4:177606374-177606396 GGGAAGCTGCAGCCCTTTGCAGG + Intergenic
985557204 5:563808-563830 CGTCAGCTGAACCCCTCTGCGGG - Intergenic
985557543 5:564969-564991 CGTCAGCTGAACCCCTCTGCGGG - Intergenic
985557555 5:565012-565034 CGTCAGCTGAACCCCTCTGCGGG - Intergenic
985557567 5:565055-565077 CGTCAGCTGAACCCCTCTGCGGG - Intergenic
988306356 5:29499044-29499066 TCTCTGCTGGAGCACTCTGCTGG + Intergenic
990807703 5:59684673-59684695 CATCAGTTGGGGCCCTTTGCTGG - Intronic
991227043 5:64285549-64285571 AGTCAGCTGGAGCTCTCTGATGG + Intronic
994318361 5:98360638-98360660 TGTCTGCTGGAGCTCTCTGATGG + Intergenic
994655261 5:102585000-102585022 CGTCAGCTGGGGACATTTGCAGG - Intergenic
996228716 5:121034051-121034073 TGTCAGCTGGGGCCTTTTGCTGG - Intergenic
997399289 5:133590229-133590251 TGTCATCTGGAGCTCTGGGCTGG - Intronic
999003873 5:147954450-147954472 TGTCAGTGGGAGGCCTTTACGGG - Intergenic
999070248 5:148736843-148736865 TGTGGGCTGGTTCCCTTTGCAGG + Intergenic
1000031557 5:157406368-157406390 TGTCAGCTGGAGACCACTGGTGG - Intronic
1001592235 5:172873447-172873469 TGTCACCTGGAGGCCCTGGCTGG - Intronic
1004046465 6:12028875-12028897 TGTCAGCTGCAGGCAATTGCTGG + Intronic
1007321782 6:41033083-41033105 GGCCAGCTGCAGCCATTTGCGGG + Exonic
1007894851 6:45343888-45343910 TGTCAGGTGGAGGTCTTTGATGG - Intronic
1010918838 6:81655093-81655115 TTTCAGCTGGAGTCCCTTTCTGG - Intronic
1014254576 6:119148188-119148210 TGTCAGCAGAAGCACTTTCCTGG + Intronic
1019166178 6:170098914-170098936 TGAGGGCTGGCGCCCTTTGCAGG - Intergenic
1019191095 6:170251446-170251468 TCTGAGCTGTAGCCCTTTCCAGG + Intergenic
1019368179 7:645930-645952 TGTCAGCTCCTGCCCTTTCCGGG - Intronic
1021802037 7:24316776-24316798 TGTCACCTCTAGCCCTTTCCTGG - Intergenic
1028639925 7:93030261-93030283 TGTCAGCTAAAGCACTTTGTAGG - Intergenic
1029364112 7:100106444-100106466 TGGCAGAGGGAGCCCTTCGCTGG + Exonic
1030421306 7:109309923-109309945 TGTCTGCTGGAGCTCTCTGATGG - Intergenic
1034324886 7:150220940-150220962 TGGCGGCTGGAGCCCTGCGCAGG - Intergenic
1034357723 7:150465750-150465772 TGGCAGGTGGAAGCCTTTGCAGG + Intronic
1034768309 7:153748293-153748315 TGGCGGCTGGAGCCCTGCGCAGG + Intergenic
1037399041 8:18475128-18475150 AGTCAGCTGGAGACCACTGCAGG + Intergenic
1038069281 8:23995507-23995529 TGTCAGCTGAATCCCTCTCCTGG - Intergenic
1041174815 8:55184468-55184490 AGTCCCCTGAAGCCCTTTGCTGG + Intronic
1042620027 8:70694425-70694447 TGTCAGCTGGAAAGCTTTGTTGG + Intronic
1042746025 8:72106926-72106948 TGAAAGCTGGAGCACTTAGCAGG + Intronic
1043143859 8:76625802-76625824 TGTCAGCTGGAGATCCTTGCAGG - Intergenic
1044319779 8:90789703-90789725 TGGGAGCTGGAGTCATTTGCAGG + Intronic
1044533129 8:93330506-93330528 TTTCAGCTGGAGCCTGCTGCTGG + Intergenic
1044692822 8:94896019-94896041 TGGCAGCTGGAGGCCACTGCAGG - Intronic
1046609462 8:116408305-116408327 TGTCAGCGGCAGCCCTTTCAGGG - Intergenic
1046679424 8:117152131-117152153 AGTCAGCAAAAGCCCTTTGCTGG + Intronic
1046915337 8:119673089-119673111 ACTCAGCTGGAGCAATTTGCAGG - Intronic
1047165208 8:122431081-122431103 TTTCGGCTGAAGCCCTTTGCTGG - Intergenic
1047789190 8:128185289-128185311 AGTCAGCTTGATCCCTTTGAAGG + Intergenic
1049442714 8:142616606-142616628 TGGCAGCTGGAGGCCACTGCTGG - Intergenic
1049661724 8:143822524-143822546 AGTGAGCTGGAGCCCTCTTCAGG - Intronic
1050428775 9:5539816-5539838 TGTCAGCTTCAGCCCATTCCTGG - Intronic
1053393267 9:37751406-37751428 TGTCAGCTCGAGGGCTCTGCTGG + Intronic
1054153656 9:61625318-61625340 TCTCGGCTGTAGCCCTTGGCGGG - Intergenic
1054812288 9:69444476-69444498 TGGGATCTGAAGCCCTTTGCTGG + Intronic
1059571748 9:115445137-115445159 TGGCAGCTGGACCCCATTACTGG - Intergenic
1061044431 9:128157167-128157189 TCTCAGCTGGACCCCTGGGCAGG + Intergenic
1061577834 9:131518720-131518742 TGTCAGCAGGTGCCCCTTGTGGG - Intronic
1203480335 Un_GL000224v1:5632-5654 TTTCAGCTGGAGTCCGTTCCAGG - Intergenic
1203481302 Un_GL000224v1:11960-11982 TTTCAGCTGGAGTCCGTTCCAGG - Intergenic
1203482266 Un_GL000224v1:18269-18291 TTTCAGCTGGAGTCCGTTCCAGG - Intergenic
1203550503 Un_KI270743v1:162437-162459 CTTCAGCTGGAGTCCGTTGCAGG + Intergenic
1203568215 Un_KI270744v1:109302-109324 TTTCAGCTGGAGTCACTTGCAGG - Intergenic
1203568317 Un_KI270744v1:109884-109906 TTTCAGCTGGAGTCATTTCCAGG - Intergenic
1203568426 Un_KI270744v1:110604-110626 TTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1187485402 X:19698615-19698637 TGTGAGCTGGAGCCCTTCATGGG + Intronic
1189303470 X:39969572-39969594 TGACAGCTGGAACCCCCTGCAGG - Intergenic
1190000509 X:46682126-46682148 TTTCAGCTGGTGACCTTTGTGGG - Intronic
1192603342 X:72487663-72487685 TGTCTCCTCGAGCCCTTTCCTGG - Intronic
1194844890 X:98792930-98792952 TATCAGCTGGAGCCCTGGGGAGG + Intergenic
1195544575 X:106100620-106100642 TCTCAGCTTGAGCACTCTGCTGG + Intergenic
1195997553 X:110746229-110746251 TGTCATCTGGCGCCTCTTGCAGG - Intronic
1197658157 X:129140329-129140351 TAGCAGCTGGAGCCATTTGAGGG + Intergenic