ID: 1071573044

View in Genome Browser
Species Human (GRCh38)
Location 10:86708424-86708446
Sequence GGAAAGGGAGCAGAGGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 428}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573044_1071573050 -1 Left 1071573044 10:86708424-86708446 CCATAAGCCTCTGCTCCCTTTCC 0: 1
1: 0
2: 2
3: 42
4: 428
Right 1071573050 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG No data
1071573044_1071573056 21 Left 1071573044 10:86708424-86708446 CCATAAGCCTCTGCTCCCTTTCC 0: 1
1: 0
2: 2
3: 42
4: 428
Right 1071573056 10:86708468-86708490 GACCTGTAGCTCCTGGGCTGTGG No data
1071573044_1071573054 14 Left 1071573044 10:86708424-86708446 CCATAAGCCTCTGCTCCCTTTCC 0: 1
1: 0
2: 2
3: 42
4: 428
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573044_1071573057 22 Left 1071573044 10:86708424-86708446 CCATAAGCCTCTGCTCCCTTTCC 0: 1
1: 0
2: 2
3: 42
4: 428
Right 1071573057 10:86708469-86708491 ACCTGTAGCTCCTGGGCTGTGGG No data
1071573044_1071573055 15 Left 1071573044 10:86708424-86708446 CCATAAGCCTCTGCTCCCTTTCC 0: 1
1: 0
2: 2
3: 42
4: 428
Right 1071573055 10:86708462-86708484 ACTCAGGACCTGTAGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573044 Original CRISPR GGAAAGGGAGCAGAGGCTTA TGG (reversed) Intronic
900608251 1:3533342-3533364 GGCAAGGGCTCAGAGGCTGATGG - Intronic
901127001 1:6936606-6936628 GGAAAGAGAGCTCTGGCTTATGG + Intronic
901537718 1:9893412-9893434 AGAAAGGAAGCAGAAGCTTCTGG + Intronic
902090488 1:13899040-13899062 GGAATGGGAGCACAGCTTTAAGG + Intergenic
902091137 1:13904150-13904172 GGCAAGGGAGCAGAGGATGGAGG + Intergenic
902558470 1:17260967-17260989 GGATAGGGAGCAGGGGTATATGG - Intronic
902652281 1:17844635-17844657 GGAAAGGGAGGACAGGCAGATGG + Intergenic
902732815 1:18380789-18380811 GGAAAGGGAGAAGAAGCACAGGG - Intergenic
902791944 1:18775376-18775398 GGCAAGGGAGCAGAGGGCTCTGG + Intergenic
903453919 1:23473875-23473897 AGAAGGGGAGCAGAGACATAGGG - Intronic
903566481 1:24270093-24270115 TGAAACAGAGCAGAGGCTTCAGG - Intergenic
903639341 1:24848037-24848059 GGAAAGCGAGCAGGGGCTTTAGG - Intergenic
903675628 1:25062897-25062919 GGGAAGGGGGCAGAGGATGAAGG - Intergenic
904732850 1:32607543-32607565 GGAAACGCAGCTGAGGCTCACGG - Intronic
905075623 1:35268652-35268674 GGAAAGGAAGGAGGGACTTAGGG + Intergenic
906656365 1:47551425-47551447 GCATAGGGAGCAGAGGCATAGGG + Intergenic
906671119 1:47655731-47655753 GCACAGGGAGGAGAGGCTGAAGG - Intergenic
907245259 1:53104202-53104224 GAAAAGGAAGCAGAGACTTCAGG - Intronic
908616512 1:65928746-65928768 GGAAGGGATCCAGAGGCTTAGGG - Intronic
909349068 1:74627368-74627390 GGCAAGAGAGGAGAGGTTTAAGG + Intronic
910068146 1:83178574-83178596 AGAAAGTGAGCACAGGCTTTTGG + Intergenic
910793879 1:91078166-91078188 GGAAAGGTTACAGAGGCTAATGG + Intergenic
910898835 1:92097293-92097315 TGAAAAGGAGCAGAGCATTAGGG - Intronic
911980196 1:104557633-104557655 GGAAAGGACCCAAAGGCTTAGGG + Intergenic
914464120 1:147910861-147910883 GGAAAGGACACAGAGGCTAAAGG + Intergenic
915082127 1:153359496-153359518 GGAAAGGAAGCAGAGCCTCATGG + Intronic
915101542 1:153504420-153504442 GGTAAGGAAACAGAGGCTCAGGG - Intergenic
915974564 1:160376410-160376432 GGAAAGGGACAAGAGGCTAAGGG + Intergenic
916024443 1:160821739-160821761 GGTAAGGAAACTGAGGCTTAGGG - Intronic
916563796 1:165955751-165955773 GGGAATGGAGCACAGGCTCAGGG - Intergenic
918154039 1:181827502-181827524 GGAAAGTGAACAGAGGCTAAGGG + Intergenic
918755988 1:188339821-188339843 GGAAAGGATTCAAAGGCTTAGGG - Intergenic
919149765 1:193680886-193680908 GATGAGGGAGCTGAGGCTTATGG - Intergenic
919909840 1:202104170-202104192 GGAAAGGAAGCAGAGTCCTATGG + Intergenic
920034834 1:203059123-203059145 GGCAAGGGAGGAGAGGCAGAGGG + Intronic
920071430 1:203305693-203305715 CGTGAGCGAGCAGAGGCTTAAGG + Exonic
921424972 1:214990949-214990971 GTATAGGGAGCAGAGGATAATGG - Intergenic
921489986 1:215763453-215763475 GGAAAGGGAGTTCAGGCTGAGGG + Intronic
921619593 1:217311151-217311173 GGAAGGGATGCAAAGGCTTAGGG + Intergenic
921658068 1:217764263-217764285 GTAAAAGGATCAGTGGCTTACGG - Intronic
922103272 1:222491476-222491498 AGGAAGGGAGTAGAGGTTTAAGG - Intergenic
922159475 1:223068123-223068145 GGAGCTGGGGCAGAGGCTTATGG - Intergenic
922194929 1:223351636-223351658 GGAGAGGGCACAGAGGCTTAGGG + Intronic
922263591 1:223963988-223964010 AGGAAGGGAGTAGAGGTTTAAGG - Intergenic
923454201 1:234148962-234148984 GGAATGGGAGCAGAGATTAATGG + Intronic
923618042 1:235554087-235554109 GGAGCAGGAGCACAGGCTTAAGG + Intronic
924407528 1:243766158-243766180 GCAAATAGAGCAAAGGCTTAAGG + Intronic
924813556 1:247423986-247424008 GGAGAGGGAGCAGGAGCTTCTGG + Exonic
1063173654 10:3532742-3532764 TGAAAGGGATCAGAGACGTAAGG - Intergenic
1063349124 10:5338180-5338202 GGAAAGGAAGCAGAGGAGGAAGG - Intergenic
1063404084 10:5776009-5776031 GGAAGGGGAGCAGTGGCGCAGGG - Intronic
1064099579 10:12451816-12451838 GGACAGGGAGCTAAGGCTTCTGG + Intronic
1064106889 10:12507920-12507942 GGAAAGTGTGTAGAGGCTTGGGG - Intronic
1064550123 10:16492170-16492192 TTAAAGGGAGCAGATGGTTAGGG - Intronic
1064991661 10:21261978-21262000 GGATAATGAGCAGAGGCCTAAGG + Intergenic
1067093275 10:43282530-43282552 GGGAAGGGAGCAGGGGCTCCTGG + Intergenic
1067215564 10:44299955-44299977 AGAGAGGGAGCAGAGGGTCAGGG + Intergenic
1067298270 10:44988231-44988253 AGAAAGGAATCAGAGGCTTTAGG - Intronic
1068369787 10:56097082-56097104 TGAAAGGTAGCAGAGGATAAAGG - Intergenic
1068766223 10:60767060-60767082 GAAAAGGGAAGAGAGTCTTAAGG - Intergenic
1068837512 10:61570627-61570649 GGAAGGGATGCAAAGGCTTAGGG - Intergenic
1069610670 10:69770504-69770526 GAAATGGGAACAGAGGCTCAGGG + Intergenic
1070531141 10:77338488-77338510 AGAGCAGGAGCAGAGGCTTAGGG - Intronic
1070700782 10:78600270-78600292 ATAAAGGGAGAAGCGGCTTAAGG + Intergenic
1070846496 10:79526637-79526659 AGAACGAGGGCAGAGGCTTATGG + Intergenic
1071573044 10:86708424-86708446 GGAAAGGGAGCAGAGGCTTATGG - Intronic
1071683865 10:87734870-87734892 GGAAAGGGAGGAGCAGCTGAGGG - Intronic
1071730226 10:88240772-88240794 GGAAAGAGAGTAGAGGCTAAGGG - Intergenic
1072032832 10:91537691-91537713 TGAAAGGGAGCAGATGGTTGTGG - Intergenic
1072676206 10:97468230-97468252 GGTAAGGGAGCAGAATCTTTGGG - Exonic
1074426962 10:113359827-113359849 GGAGAAGAAGCAGAAGCTTAAGG + Intergenic
1074964741 10:118480152-118480174 GGAAAAGGAGGAGAGGCACAGGG - Intergenic
1075164109 10:120051555-120051577 GGGAAGGGAGCAGAGAGTTGGGG + Intergenic
1075627220 10:123972251-123972273 GGAAAGGGAGGGGAGGAGTAGGG + Intergenic
1076122894 10:127950410-127950432 GGAAGGGATCCAGAGGCTTAGGG + Intronic
1076280466 10:129242274-129242296 GAGAATGGAGCAGAGGCTGAAGG + Intergenic
1076935583 10:133566195-133566217 GGAGGAGGAGCAGAGGCTTTCGG + Intronic
1076983993 11:222521-222543 GTAAAGCCAGCAGAGGCTGAGGG - Intronic
1077160371 11:1109874-1109896 GGAGAGCGGGCAGCGGCTTAGGG - Intergenic
1077353697 11:2104958-2104980 GGAAAGGGACCAAAGGCCCAGGG + Intergenic
1078528553 11:12119116-12119138 GGAAACGGAGAAGAGGGTTCAGG - Intronic
1079048328 11:17129333-17129355 AGAAAGGGACCAGAAGCTTTGGG - Exonic
1081850746 11:46273731-46273753 GGAAAGGGATCACAGGCCAAAGG + Intergenic
1083212119 11:61194515-61194537 GGAAAGGTAGAGGAGGCTTCTGG - Intergenic
1084612534 11:70212683-70212705 GGGCGGGGAGCAGAGGCTCAGGG - Intergenic
1084737124 11:71112707-71112729 GGAGAGGGGGCTGAGGCATAGGG - Intronic
1085277416 11:75309086-75309108 AGAAAAGGAGCAGGGGCTTTGGG - Intronic
1085468277 11:76738935-76738957 GGAAAGGGCGCAGCGGGCTATGG + Intergenic
1085474291 11:76780154-76780176 GGTAAGGAAACTGAGGCTTAGGG + Intergenic
1086416421 11:86592967-86592989 GATAAGGGAGCTGAGGCCTATGG - Intronic
1087784773 11:102342174-102342196 GGAAGGGCAGCAGAGGTTTGGGG + Intergenic
1087847702 11:102992001-102992023 GGCAAGGGATCAGAGGATGACGG + Intergenic
1089610847 11:119667743-119667765 GGAAAGAAAGCAGAGGGTCAAGG - Intronic
1089619265 11:119713213-119713235 GGGGAGGGGGCAGAGGCCTATGG + Intronic
1089903357 11:122011585-122011607 GGAAAGGATCCAAAGGCTTAGGG + Intergenic
1090852673 11:130584191-130584213 GGAATGGGGGCAGATGCTGAGGG + Intergenic
1091212250 11:133872033-133872055 GGAAAGGGTCCAAAGGCTCAGGG + Intergenic
1091654269 12:2333892-2333914 GGAAAGGAAACTGAGGCTCAGGG + Intronic
1091837927 12:3598950-3598972 GAAAAGGAAGCAGAGGCTGAGGG + Intergenic
1092313053 12:7379269-7379291 GGATATGGAGCTGAGGCTTGTGG - Exonic
1092685868 12:11045269-11045291 GGAAAGGTAGTGGAGGCTAAAGG + Intronic
1093232626 12:16566240-16566262 GGAAAGGGAGCAGAGAGGGAAGG + Intronic
1093990408 12:25583722-25583744 GGAGAGGGAGCAGAGAGTGATGG + Intronic
1094659000 12:32448330-32448352 GCAAATGGAGCAGAGTCATATGG + Intronic
1094824744 12:34261139-34261161 GAAAAGGGATCAGAGGATGATGG - Intergenic
1095500358 12:42830711-42830733 TGAATCGGAGCAGAGACTTAAGG - Intergenic
1096078351 12:48818481-48818503 GGAAGGGGAGGAGAGGCTGCGGG - Intronic
1096386698 12:51199121-51199143 GAACAGGGAGCAGAGGCTGATGG + Intronic
1097098719 12:56570982-56571004 GAAAAGGCAGAAGAGGATTAAGG + Intronic
1098715830 12:73827739-73827761 GGAAGGGGTGCAAAGGCTTAGGG + Intergenic
1101549892 12:105751908-105751930 GAAAAGGGAGGCAAGGCTTATGG + Intergenic
1101807514 12:108077311-108077333 GGAAATGGAGCAGAGAGTTGAGG - Intergenic
1102802428 12:115748121-115748143 TGAAGAGAAGCAGAGGCTTATGG + Intergenic
1103661310 12:122520738-122520760 AGAAAGGGAGAAGAGTCTTGTGG - Intronic
1103810985 12:123613595-123613617 GGAAAGGCAGAGGGGGCTTAGGG + Intronic
1104707226 12:130956234-130956256 GGAAAGGAGACAGAGGCTGAGGG - Intronic
1105844443 13:24282118-24282140 GGGAAGGGAGGAGAGGCATAAGG + Intronic
1105913754 13:24894191-24894213 GGAAGGAAAGCAGAGGCATATGG + Intronic
1106148420 13:27073465-27073487 GGAAAGGGTCAAGAGACTTAAGG + Intronic
1106151076 13:27102702-27102724 GGAAAGGGGACAGAGGATGAGGG - Intronic
1106202204 13:27548620-27548642 GGAAAGCCAGCATAGGCTTAAGG - Intronic
1107946288 13:45419963-45419985 GGAAAGGGAGGGGAGGCGAAGGG + Intergenic
1108131110 13:47301270-47301292 GGTAAGAGAGTAGAGGCTCATGG + Intergenic
1109951560 13:69507161-69507183 GGAAAGGGAGCAAAGGAAAAGGG + Intergenic
1110087115 13:71394183-71394205 GGAAAGGGAGCAGAAGATTTTGG + Intergenic
1112179798 13:97067794-97067816 GGAAAGAGGGTTGAGGCTTAGGG - Intergenic
1112719635 13:102228683-102228705 GATAAGAAAGCAGAGGCTTAGGG + Intronic
1113319981 13:109223723-109223745 GGAAGGGGTCCAAAGGCTTAGGG - Intergenic
1113482219 13:110629447-110629469 GAACAGGGAGCAGATGCTAACGG - Intronic
1113859645 13:113472947-113472969 GGTACGGGAGCAGAGGCGCAGGG - Intronic
1115372482 14:32633549-32633571 GGTAAGTGAGCAGATGCTTTAGG + Intronic
1118311072 14:64693565-64693587 GAAAAGGGAGCAGAGGCTCAGGG - Intergenic
1119603592 14:75995303-75995325 GGAAAGGGCGGAGAGACTTAGGG + Intronic
1119720570 14:76887376-76887398 GGAAAGGGCCCAGAGCCTGAAGG + Intergenic
1120098081 14:80411760-80411782 AGAAAGGGACCAGAGGCGTGAGG + Intergenic
1120973388 14:90228417-90228439 GGAAAGGATCCAAAGGCTTAGGG + Intergenic
1121890454 14:97585292-97585314 TGAAAGGAACCAGATGCTTAGGG + Intergenic
1122298411 14:100718338-100718360 TGAAAGGGAGCAGGGTCTAAAGG + Intergenic
1122696376 14:103554870-103554892 GGAAAAAGACCAGTGGCTTAGGG - Intergenic
1123015071 14:105369577-105369599 GGAAGGGCTGCAGAGGCTTCTGG + Intronic
1124005017 15:25788433-25788455 GGGACGGGAGCAGAGGGCTACGG - Intronic
1126978860 15:54218361-54218383 GGATAGGGAGGAGATACTTATGG + Intronic
1127562025 15:60148738-60148760 GGAAACTGAGCAAAGGCTCAAGG + Intergenic
1127609636 15:60624035-60624057 GGAAAGGGTGGGGAGGCCTATGG + Intronic
1127699070 15:61479339-61479361 AGAAAGGGTGCAGAGGGTGAGGG + Intergenic
1127820962 15:62655679-62655701 GGAAAAGCATCAGAGGCTTCGGG - Intronic
1127821201 15:62657731-62657753 GGAAAAGCATCAGAGGCTTCGGG - Intronic
1128243766 15:66119029-66119051 GGGAAGGGAGGAGAGGCAAAAGG - Intronic
1128639510 15:69325781-69325803 GGAGAGGTAGATGAGGCTTAAGG - Intronic
1128894184 15:71357566-71357588 GGAAAGGGAGCAAGGGCGTGGGG - Intronic
1129029788 15:72609826-72609848 GGAGCAGGAGCAGAGGCTGAGGG + Intergenic
1129145231 15:73641035-73641057 GCAAAAGGAGCTGAGGCTGAAGG + Intergenic
1129933371 15:79430564-79430586 CAAAAGGGAGCATAAGCTTAAGG - Intergenic
1130238812 15:82165443-82165465 GGAACTGAAGCAGAGGCTTCAGG + Intronic
1130878077 15:88031719-88031741 GGAAATGAAGCAAAGGCTGATGG + Intronic
1130916847 15:88311912-88311934 GGTTAGGGAGCAGATGCTTAAGG - Intergenic
1131593290 15:93772157-93772179 GGAAGGGGAGCAATGACTTAAGG + Intergenic
1131703651 15:94969176-94969198 GGAGAGGGAGCTGGGCCTTAGGG + Intergenic
1133254994 16:4511302-4511324 GGCAAGAGAGCAGAGGCCCAGGG + Exonic
1135337153 16:21612379-21612401 GGGAAGGGTGGAGAGGCTTTTGG - Intronic
1136529872 16:30860892-30860914 GGTCAGGGAGCGGAGGCTGAGGG - Intronic
1137397521 16:48126658-48126680 GGTAAAGAAACAGAGGCTTAGGG + Intronic
1137527899 16:49252604-49252626 GGAAGGGTAGCAGAGGATTTGGG + Intergenic
1137563274 16:49516502-49516524 GGTAAGGAAACTGAGGCTTACGG + Intronic
1138149343 16:54641468-54641490 GGGAAGGGAGCAGAGTCACATGG - Intergenic
1138352853 16:56355576-56355598 GCAGAGTGAGGAGAGGCTTAGGG - Intronic
1138531659 16:57637778-57637800 GGAAAGGCAGCAGGGGCTTGGGG - Intronic
1139139054 16:64239114-64239136 AGAAAGGGAGCAGAAGGTAATGG + Intergenic
1139420238 16:66845213-66845235 AGAAAGGGAGAAGAGGCAGAAGG + Intronic
1141497496 16:84420100-84420122 GGACAGGGAGCAGAGACCTCCGG - Intronic
1141522025 16:84586977-84586999 GGAAAGGGAGCAGAGGGAGGGGG - Intronic
1142611642 17:1111742-1111764 GGGAAGGGAGCAGAGGGCTGAGG - Intronic
1143657350 17:8303333-8303355 AGAGATGGAGCAGACGCTTATGG + Intergenic
1143919796 17:10322069-10322091 GGAAGGGGAGGAGAGGCGTGAGG + Intronic
1144123708 17:12181698-12181720 GGAGAGAAAGCAGAGGTTTAGGG - Intergenic
1144602713 17:16632438-16632460 AGAAATGGAGCAGTGGCTAAAGG - Intronic
1145942025 17:28747571-28747593 GGAAAGGAAGCAGAGCCCCAGGG + Intronic
1146069716 17:29668926-29668948 GAAAAGGAAACAGAGGCTCAGGG - Intronic
1146229030 17:31092603-31092625 GGCAAGGGAGCTGAGGGTTTGGG + Intergenic
1146562857 17:33886567-33886589 GGCAAAGAAGCAAAGGCTTAAGG + Intronic
1146654830 17:34628972-34628994 GGAAGGAGAGCAGAGGATGAAGG - Intronic
1147506480 17:41022587-41022609 GGAAAGGAATCAAAGACTTAAGG - Intergenic
1148689787 17:49520569-49520591 GGGAAGGGAGCAGAGGGATGGGG - Intergenic
1148764697 17:50030433-50030455 GGATAGGGAGCAGTGGTTTGAGG - Intergenic
1148907615 17:50921199-50921221 GGGGAGGAAGCAGAGGCTTCAGG - Intergenic
1149004635 17:51792911-51792933 GGAGAGGAAGCAGAGGTTCAAGG + Intronic
1149112299 17:53048320-53048342 GCAAAGGGACTACAGGCTTATGG + Intergenic
1149453706 17:56770332-56770354 GGAAAGGCAGCTGAGGCACAGGG + Intergenic
1150270631 17:63862212-63862234 GGAGAGGGAGCAGGGGGTGAAGG + Intergenic
1150276404 17:63900561-63900583 GGAGAGGGAGCAGGGGGTGAAGG + Intergenic
1150632864 17:66892273-66892295 GGAAAGGGCTCAGAGGCAGAAGG - Intergenic
1151111517 17:71683450-71683472 TGAAAGGGAGCAGAGAAATAGGG - Intergenic
1151572294 17:74932878-74932900 GGAAAGGGAGAAGGGGATGAGGG + Intronic
1151887788 17:76933324-76933346 GGGAAGGGAGCAGAGGGTAGAGG - Intronic
1151950521 17:77351157-77351179 GGGAAGGGTGGAGAGGCTCACGG - Intronic
1152310366 17:79546284-79546306 AGAAAGGAAGCACAGGTTTATGG + Intergenic
1153131535 18:1859739-1859761 AGGAAGGGACCAAAGGCTTAGGG - Intergenic
1154069450 18:11140272-11140294 GGAAGGGATCCAGAGGCTTAGGG - Intronic
1154930275 18:20987503-20987525 GAAAAGGTTGAAGAGGCTTAAGG + Intronic
1156315183 18:35962959-35962981 GGAAAAAGAGCAAAGGCTTCTGG + Intergenic
1156447673 18:37249252-37249274 GGCACGGGAGAAGAGGCCTAAGG + Intronic
1157589337 18:48826948-48826970 GGCAGGGGAGCTGGGGCTTAAGG + Intronic
1157683415 18:49624565-49624587 GACAAGAGAGCAGAGGCTTATGG - Intergenic
1158693495 18:59682508-59682530 GGAAATGTAGCAGATGCTAAAGG - Intronic
1159861184 18:73651472-73651494 AGAGAGGGAGCAGAGGCCAAGGG + Intergenic
1160246799 18:77165768-77165790 GGTCAGAGAGCAGGGGCTTAGGG + Intergenic
1160309778 18:77778581-77778603 GGAAAGGGAGGAGAGACAGATGG + Intergenic
1160478470 18:79216374-79216396 GGAGAGGGTGAAGAGGCTGAGGG - Intronic
1160848080 19:1175360-1175382 GGAATGGGGGCAGAGGCCTCTGG - Intergenic
1162031579 19:7919781-7919803 GGAACTGGAGCAGAGGCAGAAGG - Intergenic
1162422666 19:10574728-10574750 GGAGAGGGAGCACAGGCTGTGGG + Intronic
1162770009 19:12943742-12943764 GGACGAGGAGCAGAGGCTTAAGG + Exonic
1163712787 19:18856851-18856873 GGGAAGGGTGCAGAGGCATCAGG - Intronic
1164451416 19:28368831-28368853 GGAAAGAGAGTAGCGGCTCAAGG - Intergenic
1164730024 19:30496619-30496641 GGAAAGGCAGCAGAGGCAGTTGG + Intronic
1166073738 19:40401737-40401759 GGAAAGGGTGAAAAGGCTAAAGG - Intronic
1166624341 19:44336440-44336462 GGAAAGTGAGAAGAGGTTGAGGG + Intronic
1166679484 19:44758177-44758199 GGTAAGGGAACAGAGGCTGGAGG - Intronic
1166731340 19:45060668-45060690 GGGAGGAGAGCAGGGGCTTAGGG + Intronic
1167349643 19:48966445-48966467 CCAAAGGGAGCAGAGGCTTGAGG - Intronic
1168400503 19:56083645-56083667 GATAAGGGAACAGAGGCTTTGGG - Intergenic
925460456 2:4058427-4058449 GGAAGGGATGCAAAGGCTTAGGG + Intergenic
925840335 2:7985975-7985997 GACAAGGAAACAGAGGCTTAAGG - Intergenic
927519225 2:23689162-23689184 GGAAAGGCCGCAGAGGCACAGGG - Intronic
928199164 2:29236280-29236302 GGAGATGGAGCAGAGGCCGACGG - Intronic
928443818 2:31315525-31315547 GGAATGGGAGCAGAGGGGAAGGG - Intergenic
929249250 2:39734749-39734771 GGAAAGGCTGCAGAGGCTGCAGG - Intergenic
929576835 2:43057355-43057377 CCAAAGGCAGCAGAGGCTGAGGG + Intergenic
931066809 2:58596824-58596846 GGAGAAGGAGCAGAGGCTTTGGG + Intergenic
931118003 2:59185367-59185389 GGCAAGGAAACTGAGGCTTAAGG + Intergenic
931776555 2:65545905-65545927 GGAAAGGCCTCAGAGGCTCAGGG - Intergenic
932817538 2:74874001-74874023 GGAAAGGGAGAAGGGGCCCATGG + Intronic
933781422 2:85804512-85804534 GGGAAGGTGGCAGAGGCTTCAGG + Intergenic
933803843 2:85983928-85983950 GGAGAGGGGGCAGAGGCTGATGG - Intergenic
934037419 2:88099925-88099947 GGAAAGGGGCCAGAGGATAAGGG - Intronic
934562666 2:95321058-95321080 GGCCAGGGAGGAGAGGCTTGGGG - Intronic
935123297 2:100200304-100200326 GAAAACTGAGCAGAGGCTTAGGG - Intergenic
935382817 2:102470238-102470260 GGGAAGGGAGAAAGGGCTTAGGG - Intergenic
937375654 2:121334082-121334104 GAAAATGGAACAGAGGCTCAGGG + Intergenic
937463725 2:122111346-122111368 GGAAAGGGAGCTGAGACTCTGGG - Intergenic
937800067 2:126072700-126072722 GGAAAGGATCCAAAGGCTTAGGG + Intergenic
937969588 2:127538919-127538941 GAAGAGGGAACTGAGGCTTAAGG - Intronic
939097718 2:137853734-137853756 TGAAAAGTAGCAGAGGCTTCAGG + Intergenic
939097998 2:137857924-137857946 TGAAAAGTAGCAGAGGCTTCAGG - Intergenic
939318113 2:140579074-140579096 GGAAAGGGAGCAAAGGAGAAGGG + Intronic
939530646 2:143356494-143356516 GGAAAGGAAGCAAAGACTTCTGG - Intronic
940704721 2:157089557-157089579 GGAAAAGGAGAGGAGGCCTATGG - Intergenic
942726995 2:179020637-179020659 GGTAAGGGAGCTGAGTCTCAGGG - Intronic
943369405 2:186999313-186999335 GAAAAGGAAGCTGAGGCTGAGGG - Intergenic
945554611 2:211263173-211263195 GGTGGGGGAGCAGAGGCTGAGGG - Intergenic
945726081 2:213473534-213473556 GGAAAGGATCCAAAGGCTTAGGG - Intronic
946157372 2:217815816-217815838 GGAAAGTGAGGAGAGGCCTGGGG - Intronic
946528130 2:220542013-220542035 GGAAGGGATGCAAAGGCTTAGGG - Intergenic
946774554 2:223124147-223124169 GGAAAGGGAGAAGAGGGTTTGGG - Intronic
948283224 2:236764697-236764719 AGAAGGAAAGCAGAGGCTTAAGG - Intergenic
948690905 2:239704539-239704561 GGGAAGAGAGCAGAGGCTCTTGG + Intergenic
1169090616 20:2859497-2859519 GGCAAGGGAGCAGAGGGTGTTGG - Intronic
1169256885 20:4106423-4106445 GGAAAGGCAGCAGAGGAGAAGGG + Intergenic
1169275361 20:4230146-4230168 AGACAGGGAGCACAGGGTTAGGG - Intronic
1169521005 20:6372841-6372863 GGAAAGGGAGAAGTGGCTCAGGG + Intergenic
1170121904 20:12921350-12921372 GAAAAGGGATCACAGGCTTCAGG + Intergenic
1170143379 20:13147504-13147526 GGCAAGGGGGCAGAGGGTGATGG - Intronic
1171445745 20:25203434-25203456 GGAAAGTGAGCAGAGCCTCAGGG - Intronic
1172046962 20:32087068-32087090 GCAATGGGAGAAGGGGCTTATGG + Intronic
1172515237 20:35528626-35528648 GGAAGGGGAGCAGAAACTGATGG + Intronic
1172781392 20:37438738-37438760 GGAAGGGGAGCAGAAGCCTGGGG - Intergenic
1172946314 20:38692459-38692481 GGAAAGGGGGAAGAGGCAAAAGG - Intergenic
1173049992 20:39550102-39550124 GGAAAGGGAGCAGATGATTCCGG - Intergenic
1175264055 20:57692011-57692033 GAAAAGGGAGAAGAGGGTGATGG - Intronic
1178680394 21:34669177-34669199 AGAAGGGGCGCAGAGGCTTGGGG + Intergenic
1179025062 21:37673177-37673199 GGAAATGGAGCAGAGGCTGGAGG + Intronic
1181560634 22:23697658-23697680 GGAATGGGAGCTGAGGCCCAGGG - Intronic
1181626511 22:24125659-24125681 AGAAAGGGAGCAAAGGTTAAAGG - Intronic
1181808123 22:25387317-25387339 GGGTAGGGAGCAGAAGCTCAGGG + Intronic
1181920027 22:26313304-26313326 AGAAAGGGAGCTGAGGCTCTGGG + Intronic
1182679431 22:32067189-32067211 GGAAAGGGAGCAGGGCCCTGAGG - Intronic
1184200053 22:42962534-42962556 GGAAAAGGAGAAGAGGCCCAAGG + Intronic
949170297 3:988580-988602 GGAAGGGATGCAAAGGCTTAGGG - Intergenic
949245602 3:1922859-1922881 GGAAAGGATCCAAAGGCTTAGGG + Intergenic
949487341 3:4552713-4552735 GGAGAGGGAAGAGAGGCTGAAGG - Intronic
949960552 3:9308706-9308728 TAAAAGGAAGCAGAGGCTGATGG + Intronic
950205325 3:11075815-11075837 GGAAAGGGACCACAGGCAGAAGG - Intergenic
950333482 3:12175694-12175716 GGACAGGGAGCTGGGGCTTGGGG + Intronic
950929730 3:16776282-16776304 GGGAAGGGAGGAGAGCATTAGGG + Intergenic
951111560 3:18810352-18810374 GGAAAGGGTCCAGAGCCTGAAGG + Intergenic
951558565 3:23945053-23945075 GGAAACGGAGAAGAGGTTTACGG + Intronic
951971023 3:28443913-28443935 GGAAGGGGTCCAAAGGCTTAGGG - Intronic
951987084 3:28632722-28632744 GGCAAGGGAGCACAGACTTTGGG + Intergenic
953021829 3:39119447-39119469 CAAAATGGAGCAGAGGCTTCTGG + Intronic
953427048 3:42804173-42804195 GGAGATGGAGCAGAAGCTTGTGG - Exonic
953460303 3:43076534-43076556 GGAAGAGGAGCAGAGGCCAAGGG + Intergenic
953545420 3:43860720-43860742 GCAAAGGGAGCAGAGGATGGTGG - Intergenic
954696147 3:52427958-52427980 GGAAGGGGAGCAGGTGCTTTGGG - Intergenic
955144236 3:56300189-56300211 AGAAAGGGAGCAGAGGAGAATGG + Intronic
955851590 3:63225568-63225590 GGAAAGGGAGCAGAAGGGAAGGG + Intergenic
956091849 3:65676408-65676430 GTAATTGGAGCAGAGGCTTTTGG + Intronic
956455378 3:69415539-69415561 GAAAAGGGAGAAGAGGCTGAGGG - Intronic
956678877 3:71759549-71759571 GGAGAGGGAGCAGCAGCTGATGG - Intergenic
957722354 3:84019941-84019963 GGAAAGTGAACAGAGCCTGAGGG - Intergenic
957952250 3:87141680-87141702 GGAAAGGCTGCAGTGGCTTCTGG - Intergenic
958529071 3:95301185-95301207 GTTAAGGGATCACAGGCTTAAGG + Intergenic
958707124 3:97669901-97669923 GAAAAGGCAGAAGAGGCTGAGGG - Intronic
959790101 3:110349424-110349446 GAAAAGAGAACAGAGGCTTGAGG + Intergenic
960902066 3:122563679-122563701 GGAAAAGCACCTGAGGCTTAGGG - Intronic
961350346 3:126296668-126296690 GGTAAGGAATCAGAAGCTTAGGG - Intergenic
961917817 3:130395661-130395683 GGAAAGGGTGCAGAGGCTAGAGG + Intronic
962674364 3:137743511-137743533 GGAAAGGGAGTAGATGCCTGGGG + Intergenic
963034478 3:141013539-141013561 GGAGTGGGAGGAGAGGCTAATGG - Intergenic
963145866 3:141993291-141993313 GGAAAGAGAGGAGAGACTAAAGG + Intronic
963246398 3:143067616-143067638 GGTGACGGAGTAGAGGCTTAAGG - Intergenic
963287099 3:143443950-143443972 GGAAATGGACCAGTGGCTTGGGG + Intronic
963506633 3:146194006-146194028 GGAAAGGTAGGAAAGGGTTAGGG + Exonic
963931147 3:151005522-151005544 GGAAAGGGAGTGGTGGCTCACGG - Intergenic
965229489 3:166032173-166032195 GCAAAGGAAGCCGAGGCATATGG + Intergenic
965569510 3:170157378-170157400 TGAAAGGGAAAAGAGGCTTTAGG + Intronic
966044583 3:175532969-175532991 GGAAAGGATCCAAAGGCTTAGGG - Intronic
966753836 3:183349780-183349802 GGAAGGGGAGCAGTGGAATAGGG - Intronic
967600478 3:191381689-191381711 GGAAAAAGAGCAGAGGAATAGGG + Intronic
968430677 4:556516-556538 GGAAAGGGAGCCGAGGCCCCGGG + Intergenic
968923429 4:3534357-3534379 GGACTGGGAGCAGAGTCTTCTGG + Intergenic
969507858 4:7599241-7599263 GGCAGGGGAGCAGAGGCTGAAGG - Intronic
969648150 4:8445725-8445747 CAAAAGGAAGCAGAGGCTGAAGG - Intronic
969817996 4:9700141-9700163 GGAGCTGGAGCAGAGGCTGATGG - Intergenic
972201550 4:36719198-36719220 GGAAGGGGTACAAAGGCTTAGGG - Intergenic
972427689 4:38949750-38949772 GGGAAGGTAGGAGAGGGTTAAGG - Intergenic
973834188 4:54792733-54792755 GGAAAGGGAGCAATGGCATCGGG - Intergenic
974520148 4:62972569-62972591 GGCAAAGGAACTGAGGCTTAGGG - Intergenic
975278962 4:72538110-72538132 GAAAAGTGAACAGAGGCTAAAGG + Intronic
976100666 4:81559556-81559578 ACAAATGGAGCAGAGGCTTCGGG + Intronic
977022676 4:91776061-91776083 GGAGAGGGATTAGAGGCTGATGG + Intergenic
981532002 4:145762256-145762278 GGAAAGGAAGCTGAGGACTATGG + Intronic
981995400 4:150968613-150968635 TGGAAGCCAGCAGAGGCTTAAGG + Intronic
983104074 4:163663592-163663614 GGCAAGGGAGCTGAAGCTTGTGG + Intronic
983679232 4:170333041-170333063 GGAAAGTGAGCAGTGGCATCAGG + Intergenic
987421746 5:17728888-17728910 GGAAAGTGAGCAGAGGCCATGGG + Intergenic
988161076 5:27518930-27518952 GGAAAGGATTCAAAGGCTTAGGG - Intergenic
988527734 5:32001310-32001332 GGAAAGGGAAGAGAGGCTCAGGG + Intronic
988561376 5:32284632-32284654 GTTAAAGGCGCAGAGGCTTAAGG - Intronic
989246306 5:39258829-39258851 GGAAAGAGAACAGAGGCACAAGG + Intronic
989411669 5:41126582-41126604 GGAAAGGTAGCAAAGCCATAAGG + Intergenic
991278529 5:64882221-64882243 GGAAAGGGAGAAGAGTCCAAGGG + Intronic
992442413 5:76808501-76808523 GGAGAGGAAGCAGAGGCAGAGGG - Intergenic
992593768 5:78324832-78324854 ATAAAGAGAGAAGAGGCTTAAGG + Intergenic
992902851 5:81316289-81316311 GGATAGGGAGCAACTGCTTAAGG - Intergenic
993723477 5:91344038-91344060 GGGAAGAGAGCTGGGGCTTAGGG - Intergenic
994302723 5:98165080-98165102 GGAAAGGAAGCAGAAGCAGAAGG - Intergenic
995133832 5:108659409-108659431 GGAAATGGAGGAGAGTCCTATGG - Intergenic
998052507 5:139047639-139047661 GGAATAGGAACAGAGGCCTAAGG - Intronic
998352176 5:141508858-141508880 GGAAAGGCTGAAGAGGCTGACGG + Intronic
998518760 5:142781139-142781161 GGGGAGGGAGCAGAGGCCTGTGG + Intronic
998565804 5:143214900-143214922 GTTAATGGAGCAAAGGCTTAAGG - Intronic
999034491 5:148332329-148332351 GGTAAGTGAGCACAGCCTTATGG - Intronic
999847056 5:155494820-155494842 GGAATGGGAGTAGAAGCTAAAGG + Intergenic
1001126083 5:169020812-169020834 AGAAAGTGAGCAGAGACTTCAGG - Intronic
1001422920 5:171600715-171600737 AGAAAGGGGGCAGAGGCAGAAGG - Intergenic
1001560470 5:172665729-172665751 GGAGAGGGAGCAGAGGGGAACGG - Intronic
1001916487 5:175565458-175565480 CTAAAGGGAGCAGACTCTTATGG - Intergenic
1002126533 5:177049657-177049679 GCAAAGAGAGCACAGGCTTTAGG + Intronic
1002212115 5:177605224-177605246 AGCAAGGGACCAGAGGCTTGAGG - Intronic
1003215981 6:4112695-4112717 ATAAAGTGAACAGAGGCTTAGGG - Intronic
1004016371 6:11735741-11735763 GGAAGGGGAACAGAGAATTATGG - Intronic
1004085750 6:12447411-12447433 GGAAAGGAAGAAGAGGCATTAGG - Intergenic
1004603934 6:17176393-17176415 GCTAAGGAAGCAGAGGCCTAGGG - Intergenic
1004811498 6:19268978-19269000 GGAGAGGGTGCAGTGGCTTCTGG - Intergenic
1005954978 6:30657304-30657326 GGAAATGGAGAAGAGGATTTAGG + Intronic
1006287085 6:33104802-33104824 GGAAAGGCAGCAGAAGCTCACGG + Intergenic
1006298916 6:33183017-33183039 GGAAAGGCAGTAGAAGCTCAAGG + Intronic
1006854586 6:37124093-37124115 GGAAGGGGAGCAGAGGGGAAGGG + Intergenic
1006854591 6:37124109-37124131 GGAAGGGGAGCAGAGGGAGAGGG + Intergenic
1007068755 6:39019279-39019301 GGAAAGGGCATAGATGCTTATGG + Intronic
1007454241 6:41963889-41963911 GAAAATGGAGCAGAGACTGAGGG - Intronic
1007718136 6:43869313-43869335 GGTAAGAGAGAAGAGGCTTCTGG - Intergenic
1008368086 6:50705918-50705940 GGAATGGAAGGAGAGGCTAAGGG + Intergenic
1008766040 6:54916124-54916146 GGAATAGGAGCAGAAGCTTTAGG - Intronic
1009957260 6:70470840-70470862 GAAAAGGGAGCAGAGAAATAGGG + Intronic
1013002458 6:106037518-106037540 GGAAAGTGAGAAGAGCCTAAGGG - Intergenic
1013329263 6:109082389-109082411 TGTAAGGGAACTGAGGCTTAAGG + Intronic
1014069960 6:117169339-117169361 GGAAAAGGAGCAGTGGTTCAAGG - Intergenic
1014353659 6:120376326-120376348 GTTAAAGGAGCAGAGACTTAGGG - Intergenic
1014787013 6:125630894-125630916 GCAAAGGCAGCAGAGGCCCAGGG + Intergenic
1015226196 6:130860045-130860067 GGAAAGGGAGAGGAGGCACAGGG + Intronic
1015575736 6:134669019-134669041 TAAAAGGTAGCAGAAGCTTAGGG + Intergenic
1016097773 6:140059356-140059378 GGTGAGGGATCTGAGGCTTAGGG + Intergenic
1016109237 6:140201486-140201508 GGAATGGGGACAGGGGCTTAAGG - Intergenic
1016654221 6:146499358-146499380 GGAAAGGGAGCACTTGCATAAGG + Intergenic
1017504857 6:155059017-155059039 GGAAAGGGAGAAGATGTTTCAGG + Intronic
1018107603 6:160503857-160503879 GGAAGGGGTCCAAAGGCTTAGGG - Intergenic
1018908558 6:168089006-168089028 GGAATGGGAGCTGTGGCTTAGGG + Intergenic
1019341566 7:511136-511158 GAGCTGGGAGCAGAGGCTTAGGG + Intronic
1019519946 7:1456064-1456086 CGGCAGGGAGCAGAGGCTGAGGG + Intronic
1019686049 7:2382837-2382859 GGAAAAGGAGCACAGCCTTTAGG + Intergenic
1020430473 7:8112327-8112349 GGGTGGGGAGCAGAGGCTGAGGG + Intergenic
1021313523 7:19118466-19118488 GGAAAGGCAGCAGAGCCAGAGGG + Intergenic
1021401447 7:20213998-20214020 GGAAAAGAAGCAGAGGATGAAGG - Intronic
1021616149 7:22505093-22505115 GGAAAGGGAGAAGAGGAAGAAGG + Intronic
1022286683 7:28960377-28960399 GGAAGGTGAGCAGACGCTCAAGG + Intergenic
1022925940 7:35056309-35056331 GGAAAGGGAGAAGAGGAAGAAGG + Intergenic
1023675286 7:42622303-42622325 GGAAGGGGTGAAGAGGCATATGG + Intergenic
1023840920 7:44097049-44097071 GGAGAGGGTGCAGGGTCTTAGGG + Intergenic
1024423211 7:49194110-49194132 AGAAAAGGAGCAGATGCTTAGGG - Intergenic
1026909912 7:74085422-74085444 AGAAAGGAAGCAGTGGCTTTAGG - Intronic
1027185638 7:75969048-75969070 TCAAAGGGAGCAGACGCTTATGG - Intronic
1027275951 7:76556185-76556207 AGAAAGTGAGCACAGGCTTTTGG - Intergenic
1028237554 7:88380793-88380815 GGAAAGGATCCAAAGGCTTAGGG + Intergenic
1028376322 7:90149242-90149264 GGAAAGGGAGAAGAGGAAGAAGG - Intergenic
1029404496 7:100366543-100366565 GGAGAGGCAGCAGAGGATTCAGG + Intronic
1029409035 7:100397337-100397359 GGAGAGGCAGCAGAGGATTCAGG + Intronic
1029823946 7:103170999-103171021 GGAAAGGGAGAAGAGGAAGAAGG + Intergenic
1032190375 7:129762046-129762068 GGAAAGGGAGCAGAGTGATTTGG - Intergenic
1033156244 7:138959421-138959443 GAAAAGGGAGTGGGGGCTTATGG + Intronic
1033519820 7:142149260-142149282 GGAAAGAGAGCAGAGGCACCAGG - Intronic
1034422170 7:150995892-150995914 GGAGAGGGAGGAGGGGTTTAGGG - Intronic
1035529379 8:338782-338804 GGAAGGGAAGCAGAGGCTTTGGG + Intergenic
1036217420 8:6892261-6892283 GGAAGGAGGGAAGAGGCTTAGGG + Intergenic
1037630549 8:20651809-20651831 GGAAGGGGAGAAGAGGCTGGAGG - Intergenic
1037884337 8:22588519-22588541 GGAAAGGGAGCAGGGGAGTGGGG + Intronic
1037884917 8:22590786-22590808 GGAAAGGGAGCAGGGGAGTGGGG + Intronic
1038588629 8:28814237-28814259 GGAGAGAGAGGAGAGGCTAATGG - Intronic
1038629697 8:29230148-29230170 GAAAAGGAAACAGAGGCTCAGGG + Intronic
1039838770 8:41278793-41278815 AGATGGGGAGCAGAGGCCTAGGG + Intronic
1040288088 8:46110586-46110608 GGAAGGGGTGCAGGGACTTATGG - Intergenic
1040782927 8:51131917-51131939 GAAAAGTGAACAGAGTCTTAGGG + Intergenic
1041409349 8:57536155-57536177 GGAGAAGGAGAAGAGGCTTCTGG + Intergenic
1042724346 8:71856858-71856880 GAAAAGTGAGCAGAGCCTAAGGG - Intronic
1043083120 8:75792076-75792098 GGAAAGGGAGCAGGGAATTTAGG + Intergenic
1043935436 8:86137156-86137178 GGAAAGGGAGAAGAGGATGGCGG - Intronic
1044202129 8:89450430-89450452 GGAAAGGATCCAAAGGCTTAGGG + Intergenic
1044732002 8:95236522-95236544 GGCTGGGGAGAAGAGGCTTAGGG + Intergenic
1045323944 8:101102874-101102896 GGAAAGGGAGCATAGGGTTGGGG - Intergenic
1045332347 8:101166333-101166355 AGAAAGAGAGGAGAGGCTGAAGG - Intergenic
1047105378 8:121725545-121725567 GGAAAGGCAGAAGAGCCTCAGGG + Intergenic
1047128982 8:121996874-121996896 GAAAAGGTAGAAGAGGCTGAGGG - Intergenic
1047452037 8:124973434-124973456 GGGAAGGGAGCCGAGGGTTGCGG + Intronic
1047906826 8:129481449-129481471 GGAAAGGAAGCTGAGGTTCATGG + Intergenic
1048400616 8:134065448-134065470 GGACAGGGGGCAGATGCTAAAGG + Intergenic
1049421504 8:142518597-142518619 GGAGAGTGAGCAGGGGCTTTGGG - Intronic
1051911209 9:22155015-22155037 GGAAAGGGAGCAGGTCCTGAGGG + Intergenic
1052357782 9:27523568-27523590 AGAAAGGTATCAGAGGCATATGG + Intronic
1053156070 9:35780353-35780375 CAAAAGGGAGCAGAGTGTTATGG + Intergenic
1053203929 9:36170900-36170922 GGAAAGAGAGCAGGGGCCGATGG - Exonic
1054738954 9:68785241-68785263 GAGAAGGGAGCAGAGGCTTATGG + Intronic
1054967308 9:71044302-71044324 GAAATGGGAGCAGCTGCTTAGGG - Intronic
1056074284 9:83022362-83022384 GGAAATGGATCAGAGGATTCAGG - Exonic
1058792972 9:108469730-108469752 AGAAAGGGAGCCGAGGATAAAGG - Intergenic
1059411532 9:114135549-114135571 TGAAAGGGAGAAGAGACTGAAGG - Intergenic
1060232816 9:121838292-121838314 GGCAGGAGAGCAGAGGTTTATGG - Intronic
1060423272 9:123484689-123484711 GGAACAGGAGCAGAGGCTCAGGG - Intronic
1060918110 9:127403224-127403246 GGAAAGGAAGGCGGGGCTTAGGG + Intronic
1060995213 9:127871966-127871988 GGATGGGGAGGAGAGGCTCATGG - Intronic
1061250903 9:129425894-129425916 GGAAAGGGGGCAAAGTCTTCTGG - Intergenic
1061300383 9:129701200-129701222 GGAAACAGAGCAGAGGGTTTAGG + Intronic
1061435478 9:130558605-130558627 GGACTGGGAGCAGTGGCTCACGG - Intergenic
1061925428 9:133803897-133803919 GGTTGGGGAGCAGAAGCTTAGGG - Intronic
1186816866 X:13246593-13246615 GGAAGGGGAGCAGAGGGGAAGGG + Intergenic
1186856193 X:13628471-13628493 GAGAAGGGATCAGAGCCTTAAGG + Intronic
1190163036 X:48047756-48047778 AGAAGGGCAGCAGAGGCTTGGGG - Intronic
1190984652 X:55489696-55489718 GAAAAGGGAGCGGAGACTTCGGG - Intergenic
1192223334 X:69212060-69212082 GGAGATGGAGCAGAGGCTGAGGG - Intergenic
1192729198 X:73785624-73785646 GGAGAGGGAAGAGAGGCTGAAGG - Intergenic
1193587304 X:83340989-83341011 GAAAAGGAAACAGAGGCTCAGGG + Intergenic
1194142768 X:90225193-90225215 GAAAAGGAAACAGAGGCTCAAGG - Intergenic
1194513674 X:94824300-94824322 GGAAAGGATCCAAAGGCTTAGGG - Intergenic
1194833672 X:98656738-98656760 GGAAAGGATCCAAAGGCTTAGGG + Intergenic
1194849527 X:98854228-98854250 GGAAAGGATCCAAAGGCTTAGGG - Intergenic
1195343382 X:103926155-103926177 GTTAAGGAAGCTGAGGCTTAAGG + Intronic
1196145803 X:112315547-112315569 GGAAAGGGAGTGGAGGCTAAAGG - Intergenic
1196497232 X:116335623-116335645 GGAAAGGTAGGAGAGACTAAAGG + Intergenic
1196577993 X:117343438-117343460 TGGAAGCTAGCAGAGGCTTAAGG - Intergenic
1196718061 X:118828506-118828528 GTAAAGGAGGCTGAGGCTTAAGG - Intergenic
1197477630 X:126943385-126943407 GGAAAGGATCCAAAGGCTTAGGG - Intergenic
1197821577 X:130546358-130546380 GGAATGTGAGCAGATGCTGAAGG + Intergenic
1200488527 Y:3794294-3794316 GAAAAGGAAACAGAGGCTCAAGG - Intergenic
1201063797 Y:10070256-10070278 GGAAAAGGAGAAGGTGCTTATGG + Intergenic