ID: 1071573045

View in Genome Browser
Species Human (GRCh38)
Location 10:86708431-86708453
Sequence GGCACTGGGAAAGGGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 792
Summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 711}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573045_1071573057 15 Left 1071573045 10:86708431-86708453 CCTCTGCTCCCTTTCCCAGTGCC 0: 1
1: 0
2: 3
3: 77
4: 711
Right 1071573057 10:86708469-86708491 ACCTGTAGCTCCTGGGCTGTGGG No data
1071573045_1071573054 7 Left 1071573045 10:86708431-86708453 CCTCTGCTCCCTTTCCCAGTGCC 0: 1
1: 0
2: 3
3: 77
4: 711
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573045_1071573056 14 Left 1071573045 10:86708431-86708453 CCTCTGCTCCCTTTCCCAGTGCC 0: 1
1: 0
2: 3
3: 77
4: 711
Right 1071573056 10:86708468-86708490 GACCTGTAGCTCCTGGGCTGTGG No data
1071573045_1071573055 8 Left 1071573045 10:86708431-86708453 CCTCTGCTCCCTTTCCCAGTGCC 0: 1
1: 0
2: 3
3: 77
4: 711
Right 1071573055 10:86708462-86708484 ACTCAGGACCTGTAGCTCCTGGG No data
1071573045_1071573050 -8 Left 1071573045 10:86708431-86708453 CCTCTGCTCCCTTTCCCAGTGCC 0: 1
1: 0
2: 3
3: 77
4: 711
Right 1071573050 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573045 Original CRISPR GGCACTGGGAAAGGGAGCAG AGG (reversed) Intronic
901194265 1:7431717-7431739 GACACTTGGCAAGGGAGCAGGGG - Intronic
901201638 1:7470584-7470606 GGCACTAGGAAAGGGAGTGATGG + Intronic
902198377 1:14815178-14815200 GTCACTGGGAAAGGGATCACAGG + Intronic
902212029 1:14911397-14911419 GGCACTGGGCAAGCTAGCTGGGG - Intronic
902568860 1:17333649-17333671 AGATCTGGGAAAGGGAGTAGGGG - Intronic
902682841 1:18055795-18055817 TGCAGTGGGAAAGGGAGCCCAGG - Intergenic
903178636 1:21594697-21594719 GGCGGAGGGATAGGGAGCAGGGG + Intergenic
903361215 1:22778578-22778600 GGCACAGGAGAAGGGAGCAGAGG + Intronic
903536631 1:24071289-24071311 GGGAGCGGGAAAGGGAGAAGGGG - Intronic
903738672 1:25545512-25545534 GGCAGGGGGAAGAGGAGCAGGGG - Intronic
903742509 1:25566544-25566566 GGGGCTGGTAAAGGGAGCAGCGG - Intronic
903829206 1:26164654-26164676 GGCCCTGGGAAAGGGGTCTGGGG + Intergenic
903931583 1:26865207-26865229 GCCAATGGGAAAGTGAGCGGCGG + Intergenic
903968327 1:27103111-27103133 GGCACTGGCACAGGGAGAAGGGG + Intronic
904676764 1:32203694-32203716 GGCACTGGGAAGGGGTGAGGAGG - Intronic
904745736 1:32709644-32709666 GGCACAAAGAAAGTGAGCAGAGG - Intergenic
905271058 1:36787732-36787754 GGCACTGAGGAAGGGAGGGGAGG + Intergenic
905353910 1:37367628-37367650 GGCACTGGGAAAATGACCACAGG - Intergenic
905477871 1:38241658-38241680 GGCCCTGGGAGAGTGAGCAGAGG - Intergenic
905645328 1:39621392-39621414 GGCACTATGAGAGGGACCAGGGG + Intergenic
906130220 1:43451378-43451400 GGCCCTGGGGAAGGGAGCTCTGG - Exonic
906146908 1:43565766-43565788 GGGCCTGGGAAGGGGCGCAGAGG + Intronic
906436649 1:45802415-45802437 GGAACTGGGACAGGGAATAGAGG + Intronic
906644361 1:47463217-47463239 GGCAGAGGGAAAGTGAGCAAAGG + Intergenic
906691942 1:47798545-47798567 AACACTGGGAAAGGGGCCAGGGG - Intronic
907368619 1:53982644-53982666 AGCACAGGGAAGGGGAGCAGAGG + Intergenic
907395263 1:54185324-54185346 TTCACTGGGGATGGGAGCAGGGG + Intronic
907400782 1:54223569-54223591 GGCTCTGGGGCAGGGGGCAGTGG + Intronic
907733357 1:57088595-57088617 GGCACTGGGAGAAGGGGAAGTGG - Intronic
907865895 1:58398746-58398768 GGAGCTGGGACAGGAAGCAGAGG + Intronic
908366109 1:63425292-63425314 GTCATTGGGAAAGGGAGATGGGG + Intronic
908686650 1:66727853-66727875 GGGACAGGGAAAGGAGGCAGTGG + Intronic
908857408 1:68446208-68446230 GCCACTGGGAAAGGGGTCGGGGG - Intronic
908971057 1:69832229-69832251 CACAATGGGAGAGGGAGCAGAGG + Intronic
909172765 1:72316617-72316639 GGCACTGGGGAAGTGACCACAGG + Intergenic
909435708 1:75639599-75639621 TGCACTGGGGAAGTGAGCAAAGG - Intergenic
910509232 1:87985100-87985122 TGCACTGGAAAAGGGAAAAGGGG - Intergenic
910785777 1:90996815-90996837 GGCACTAGGAAAGACAGAAGAGG + Intronic
911039066 1:93578158-93578180 GGCAGTGGAAGAAGGAGCAGAGG - Intronic
911099144 1:94080239-94080261 CCCACTTGGAAAGGGAACAGAGG - Intronic
911101440 1:94098856-94098878 TGCCCTGGGAGAGGGAGCACAGG + Exonic
911695854 1:100890016-100890038 GGCAGTGTGGAAGGGAGAAGTGG - Intronic
912273395 1:108232048-108232070 GGCACTTGGAACAGGAGAAGAGG + Intronic
912294825 1:108462274-108462296 GGCACTTGGAACAGGAGAAGAGG - Intronic
912383444 1:109259932-109259954 CCCACAGGGAAGGGGAGCAGGGG - Intronic
912502163 1:110129870-110129892 GGGAGTGGGGAAGGGAGCACCGG + Intergenic
915020556 1:152775198-152775220 TGCCCTGGAAAAAGGAGCAGGGG + Intronic
915025508 1:152826085-152826107 TCCACTGGGAAAAGGAGCAGGGG + Intergenic
915169569 1:153968422-153968444 GATAATGGAAAAGGGAGCAGAGG + Intronic
915266741 1:154724208-154724230 GGCAGTGGGAGAGTGTGCAGCGG - Intronic
915732000 1:158060464-158060486 GGACATGGGAAAGGGAGCAAAGG - Intronic
915736389 1:158088174-158088196 GGGACGGGGACAGAGAGCAGGGG + Intronic
915883480 1:159698803-159698825 GTGACTGGGAAGGGGAGGAGGGG + Intergenic
915986217 1:160467780-160467802 GGAACTGGGAAAGGGAGAAATGG - Intergenic
916051808 1:161041735-161041757 GGCAGTGGGAGATGGGGCAGGGG - Exonic
916102626 1:161406124-161406146 GGCCCTGGGATAGGGAACCGTGG + Intergenic
916214766 1:162385268-162385290 GGTGGTGGGAAGGGGAGCAGAGG - Intronic
917462568 1:175245052-175245074 GGCACTGGGAAAAGGACCACAGG - Intergenic
917668862 1:177252712-177252734 GGTAGTGGGAAAGGGAGATGGGG - Intronic
918118572 1:181517614-181517636 GGCAGAGGAAAAGGGAGCAGGGG + Intronic
919190465 1:194210579-194210601 GGGACTGGGAAAGGGACAGGTGG - Intergenic
919846988 1:201648606-201648628 GGCACGGGGGGAGGGGGCAGGGG - Exonic
920245019 1:204580854-204580876 GTCACTGAGGCAGGGAGCAGAGG + Intergenic
920257020 1:204662313-204662335 GGGAGTGGGAAAAGGGGCAGGGG + Intronic
920583038 1:207131060-207131082 AGCATTGGGAAAGAGAGAAGAGG + Intronic
920983291 1:210858981-210859003 GGCACTGGAAAAGAAACCAGTGG - Intronic
922025758 1:221747033-221747055 GGCAATAGAAATGGGAGCAGGGG + Intergenic
922194416 1:223347361-223347383 TGCACTGGGAAGGGGAGGCGGGG - Intronic
922572674 1:226643161-226643183 GACACTGGGGAAGGTAACAGGGG + Intronic
923498782 1:234547226-234547248 GGCACTCAGAAAGAGAGCTGTGG - Intergenic
923508462 1:234627569-234627591 GGCAGTGGGCATGGGACCAGAGG - Intergenic
924637102 1:245798689-245798711 GGCACAGGAAAAGCCAGCAGTGG - Intronic
1063434649 10:6020106-6020128 GGCACTGGGAAGCGGTGAAGTGG + Intronic
1064578065 10:16766159-16766181 GGCACACGGGCAGGGAGCAGTGG + Intronic
1064874485 10:19977446-19977468 GCCACTGGGGGAGGGGGCAGAGG + Intronic
1065677596 10:28194946-28194968 GAAACTGGGAAGGGGAGAAGGGG + Intronic
1065843482 10:29725673-29725695 AGCACTGAGAAAGGAGGCAGAGG + Intronic
1067012162 10:42724400-42724422 GGCACATGGGCAGGGAGCAGTGG - Intergenic
1067311431 10:45117493-45117515 GGCACATGGGCAGGGAGCAGTGG + Intergenic
1067809057 10:49412911-49412933 GGCACAGGCAAAGGGAGCTGGGG - Intergenic
1067829537 10:49602478-49602500 GGCACTGGGATATAGAGCAGAGG + Intergenic
1067833085 10:49621491-49621513 GGCACTGGAGAAACGAGCAGCGG - Intronic
1068102799 10:52577410-52577432 AGAACTGGGAAAGGTAGCAAAGG - Intergenic
1068292680 10:55024781-55024803 GGCAGTGGGAATGGCAGGAGGGG - Intronic
1068349276 10:55822418-55822440 GGTGCAGGGGAAGGGAGCAGAGG - Intergenic
1069719979 10:70543807-70543829 GGAGCTGGGAAAGGGGACAGAGG - Intronic
1069763822 10:70836548-70836570 GGCAAAGGCAAAGGGAGGAGAGG - Intronic
1069917306 10:71795651-71795673 GGCACTGGGAAGGAAACCAGGGG - Intronic
1070086734 10:73245256-73245278 GGCACTCAGGAAGGCAGCAGTGG + Intronic
1070786697 10:79166199-79166221 GGCCCTGAGAAGGAGAGCAGAGG - Intronic
1070827245 10:79398469-79398491 TGCACTAGGAGAGGGAGCAGAGG + Intronic
1070959090 10:80486398-80486420 GGCCCCGGGCAGGGGAGCAGAGG + Intronic
1071573045 10:86708431-86708453 GGCACTGGGAAAGGGAGCAGAGG - Intronic
1071942947 10:90608937-90608959 GGCACTGGGAAAATGACCACAGG + Intergenic
1072504969 10:96056530-96056552 GGCACTGGGAAAGAAAACACAGG + Intronic
1072837779 10:98735436-98735458 GGCAGTGTGGAAGGGAGAAGTGG + Intronic
1073147549 10:101290957-101290979 GGCACTGGGAATGGGAACATGGG - Intergenic
1073301466 10:102473601-102473623 GGCACAGGGACAGGAAGTAGAGG - Exonic
1073471634 10:103726103-103726125 GGGACGGGGACAGGGAGCCGAGG + Intronic
1074233644 10:111562581-111562603 AACACTGGGAAAGGGAGTAGGGG + Intergenic
1074290146 10:112132235-112132257 GGCACAGGCACAGGCAGCAGGGG + Intergenic
1074604107 10:114943244-114943266 GGCACTGGGGCCGGGTGCAGTGG + Intronic
1074756420 10:116627472-116627494 GGGACGAGGAAAGGGAGCTGGGG + Intronic
1074784808 10:116829493-116829515 GGCTCTGGGAAGGGGAGCCAAGG + Intergenic
1074859609 10:117500321-117500343 GTGACTGGGAAGGGGAGCCGGGG + Intergenic
1075345436 10:121678725-121678747 AGCACTGGGCTGGGGAGCAGCGG - Intergenic
1075388245 10:122073271-122073293 AGCCCCGGGAAGGGGAGCAGGGG + Intronic
1075427970 10:122356598-122356620 GGCATGGGAAAAGGGAGTAGTGG + Intergenic
1075606629 10:123816245-123816267 GGCACTGGGGAAGTGACCACAGG - Intronic
1075923933 10:126235581-126235603 GGCTGTTGGAAAGGCAGCAGCGG + Intronic
1075939926 10:126382162-126382184 GGCACTGGGCACTGGAACAGGGG + Intronic
1076366908 10:129927002-129927024 GGCACTGCCCAAGGGAGCAGCGG - Intronic
1076566435 10:131402791-131402813 GGCACTGGGATAGGAGGCAGGGG + Intergenic
1077046978 11:551040-551062 GGGTCTGGGAAAGGGAGCCAGGG + Intronic
1078231304 11:9445354-9445376 GGCACTGGAAAAGAAATCAGCGG + Exonic
1079290239 11:19181521-19181543 GTCACTGTGAAATGCAGCAGAGG + Intergenic
1079345468 11:19647779-19647801 GGCTCTGGGCAAGAGGGCAGAGG + Intronic
1080118543 11:28647913-28647935 GGCACTGGGAAGGAAAGAAGAGG + Intergenic
1081622276 11:44625629-44625651 GGCACTGTGGAAGGAATCAGGGG + Intergenic
1081682701 11:45019423-45019445 GGAGCTGGGAAGGGGATCAGGGG - Intergenic
1081714315 11:45237755-45237777 GGCACTGGGAAACTGAGCTGGGG + Intergenic
1081812159 11:45920206-45920228 AGAACTGGGAAGGGGAGCATGGG + Intergenic
1081812182 11:45920333-45920355 GGCAGGGGGCCAGGGAGCAGGGG - Intergenic
1082763774 11:57150385-57150407 GGCACTAGGCAGGCGAGCAGAGG - Intergenic
1082799358 11:57402967-57402989 GGGAAGGGGAAAGGGAGTAGGGG + Intronic
1083187349 11:61025445-61025467 AGCACTGGGAGATGGAGAAGAGG + Intergenic
1083288989 11:61679743-61679765 GGCACTGGGAACGGGGGTAGGGG + Intergenic
1083572108 11:63766377-63766399 AGCCCTGAGAAAGGGAGCTGGGG + Intronic
1083747619 11:64744597-64744619 GGGTCTGGGAGAGGGGGCAGCGG - Intronic
1083784345 11:64935228-64935250 GGCACAGGCAACGGGAGCTGGGG - Intronic
1083821202 11:65172400-65172422 GGCACAAGGTCAGGGAGCAGAGG - Intronic
1083968712 11:66059148-66059170 GGAACTGGGAAGGGGCTCAGAGG + Intronic
1084008269 11:66334447-66334469 GGCGCTGTGGAGGGGAGCAGAGG + Intronic
1084184345 11:67463917-67463939 GGGACTGGGAAGGAGGGCAGTGG + Exonic
1084316176 11:68347161-68347183 GGCACTGGCACAGGGAGCTGTGG + Intronic
1084514621 11:69629819-69629841 GGCACAGGGACAGGGATGAGGGG - Intergenic
1084648546 11:70474664-70474686 GCCACTGGGGAGGGGAGGAGAGG + Intronic
1084698002 11:70767899-70767921 AGCAGAGGGAAAGGGAGCACTGG - Intronic
1084717584 11:70883567-70883589 GGGGCTGGGAAAGGGGGCAGAGG + Intronic
1084934703 11:72580719-72580741 GGCTCTGAGATAGGGAGGAGGGG - Intronic
1085479213 11:76807632-76807654 GGCAGGGAGAAAGGGAGCAATGG - Intergenic
1086232184 11:84583274-84583296 GCAACAGGGAGAGGGAGCAGTGG - Intronic
1086435953 11:86781501-86781523 AGGACTGGGAAAGGAAGCATGGG + Intergenic
1087410903 11:97789324-97789346 GGCACTGGGGAAGTGACCACAGG + Intergenic
1088124479 11:106407199-106407221 GGCAATGGAAAAGGAAGCACAGG - Intergenic
1088438676 11:109843792-109843814 GGAACTGGGGAAGAGAGGAGGGG + Intergenic
1088991977 11:114961513-114961535 ACAACTGGGGAAGGGAGCAGAGG - Intergenic
1089178866 11:116567171-116567193 GGCACTGCGAAACTGAGCTGCGG + Intergenic
1089378596 11:118012058-118012080 GGCTTTGGGAAAGGGAGCACAGG + Intergenic
1089453557 11:118612744-118612766 GGGACTTGGAAAGGAAGTAGGGG - Intronic
1089610849 11:119667750-119667772 GTCACTAGGAAAGAAAGCAGAGG - Intronic
1089711462 11:120317759-120317781 GACACAGGGAAAGGGGGAAGTGG + Intronic
1089768150 11:120783480-120783502 GACAAAGGGAGAGGGAGCAGAGG - Intronic
1090206025 11:124884944-124884966 GGCACTGGGGAAGGGAGATAAGG - Intronic
1090307146 11:125701218-125701240 GGAAATGGGAAATGGTGCAGCGG + Intergenic
1090350479 11:126104743-126104765 GGGAGTGGGAGAGGGACCAGAGG - Intergenic
1090410735 11:126507994-126508016 GACAAAGGGGAAGGGAGCAGTGG + Intronic
1091148643 11:133304601-133304623 GGCATTGGGTATGGGAGCAGGGG - Intronic
1091224572 11:133949864-133949886 GGCACAGGGAAAGGCACCATAGG + Intronic
1091252181 11:134153487-134153509 GGCCCTGGGACAGGGTCCAGTGG - Intronic
1091391438 12:128681-128703 GGCACTGGGGAAGGCAAGAGAGG - Intronic
1091449466 12:563338-563360 GGCACTGGCCCAGGGCGCAGGGG - Exonic
1091645599 12:2270090-2270112 GGCACGGGGTCAGGGAACAGAGG + Intronic
1091785127 12:3238739-3238761 TGCACTGGGAAAGTCAGCAGAGG + Intronic
1092235962 12:6809753-6809775 TCCACTGGGAAACTGAGCAGTGG - Intronic
1092367703 12:7890726-7890748 CGCAATGGGACAGGGAGCGGGGG + Intronic
1092380673 12:7994290-7994312 GGCACTGGAAAAGCTAGCAATGG + Intergenic
1092785036 12:12018774-12018796 GGCTCTAGGAAAGGGAGTGGAGG - Intergenic
1093875210 12:24341831-24341853 GGCACTGGGCACTGGACCAGAGG - Intergenic
1094200277 12:27788020-27788042 GGGACTAGGAAGGGGAGAAGGGG - Intronic
1094341513 12:29417162-29417184 GGATCTGGGAAAGGGTGAAGTGG + Intronic
1094342857 12:29432115-29432137 AGCACTGGGAAAAGTAGCAGGGG + Intronic
1094353233 12:29549765-29549787 GGCACTGAGGAGGGGAACAGAGG + Intronic
1094391838 12:29960259-29960281 GGCACTGGGAAATGTTGCAATGG - Intergenic
1094490597 12:30958205-30958227 GGGACTGGGGAAGACAGCAGAGG + Intronic
1095458621 12:42417407-42417429 GGAAATGGGATAGGGAGGAGGGG + Intronic
1095598606 12:43989069-43989091 GGCAAGGGAAAAGGGAGCGGTGG + Intronic
1095614824 12:44175782-44175804 AGAACTGTAAAAGGGAGCAGTGG + Intronic
1095998132 12:48106348-48106370 GGCGGCGGGTAAGGGAGCAGAGG - Intronic
1096244225 12:49975380-49975402 GGCACTGGGGAAGCAGGCAGCGG + Intronic
1096457634 12:51800623-51800645 GGCACTGGGAAAATGACCACAGG + Intronic
1096628800 12:52912239-52912261 TGCAGTGGGGAAGGCAGCAGAGG + Intronic
1096750651 12:53756777-53756799 GGAAGTGGGGTAGGGAGCAGGGG + Intergenic
1096883724 12:54695807-54695829 GTCAGTGGACAAGGGAGCAGAGG + Intergenic
1097087715 12:56480851-56480873 GGCACAGGGAAAAGGAGGAGAGG - Intronic
1098230876 12:68370733-68370755 GGCTCTGAGAAAGGGAAAAGGGG - Intergenic
1098413450 12:70206209-70206231 CGCAATGGGAAAGAGAGCATAGG - Intergenic
1099072551 12:78064114-78064136 GGCAGTGGGGAAGGGGGCTGGGG + Intronic
1100492866 12:95098206-95098228 TGCACTGTGACAGGGAGCACTGG - Intronic
1100726674 12:97416432-97416454 AGCAGTGGGATATGGAGCAGTGG + Intergenic
1101797788 12:107991847-107991869 GGCACAGGGAAAGGAAGAATTGG + Intergenic
1101892714 12:108731203-108731225 GGCTCGGGGAAAGGGAGTTGGGG - Intronic
1102019357 12:109670885-109670907 AGAGCTGGGAAAGGGAGGAGAGG - Intergenic
1102796939 12:115696995-115697017 GGCCCTGGGGCAGGAAGCAGAGG + Intergenic
1103432793 12:120903329-120903351 GGCTCTGGGACAGGGAGCGCAGG - Intronic
1103736553 12:123064447-123064469 GGCACAGGGCAGGGGAGCTGAGG + Intronic
1103778230 12:123382454-123382476 AGCACTGGGAAAGGTAGAAAAGG - Intergenic
1104654049 12:130559992-130560014 GAAACTGAGAATGGGAGCAGGGG + Intronic
1104983007 12:132582397-132582419 GGAACGGGGAAGGGGAACAGGGG - Intronic
1105213643 13:18272286-18272308 TGCACTGGGACAGGGTGGAGTGG - Intergenic
1105825814 13:24121883-24121905 GGCACTGGAAAAGAAACCAGCGG - Intronic
1106776647 13:33016265-33016287 GGCACTGGGGGCGGGGGCAGGGG - Intergenic
1107315703 13:39129364-39129386 CTCACTGTGAACGGGAGCAGGGG - Intergenic
1107408509 13:40137525-40137547 GGCACGGTGAGAAGGAGCAGTGG + Intergenic
1107560378 13:41552385-41552407 GGCACTGGGACAGGCTGGAGTGG - Intergenic
1109965108 13:69682383-69682405 AGCACTGGGAAAGGTATCATTGG + Intergenic
1110159963 13:72363943-72363965 GGCTATGGGTAAGGGAGAAGAGG + Intergenic
1110570122 13:76993898-76993920 GGCACTGGGAAAGAAAGAAGTGG - Intronic
1110860229 13:80339634-80339656 GGGACTGGGAAAGAGAAGAGGGG - Exonic
1111247443 13:85558768-85558790 AGCACTGGGAAAAGGAGAGGTGG - Intergenic
1111395943 13:87671208-87671230 CGGATTGGGAAAGGGAGGAGTGG - Intergenic
1111575909 13:90153949-90153971 GGCACTGGGGAAATGATCAGAGG + Intergenic
1112401041 13:99078501-99078523 GTCACAGGGATAGGGAGCTGTGG + Intronic
1113046133 13:106157429-106157451 GGTCCTGGGAAAGGGAAGAGAGG + Intergenic
1113424234 13:110194776-110194798 GGTCCTCGGAAAGGGAGAAGGGG + Intronic
1113843041 13:113371250-113371272 TCCACTGGGGAAGGGAGAAGAGG - Intergenic
1114588347 14:23835669-23835691 GGCAGTGGGAAGAGGTGCAGGGG - Intergenic
1116391766 14:44400304-44400326 GAGACTGGGAAGGGCAGCAGAGG + Intergenic
1117989254 14:61417463-61417485 GGCTCTGGGAAATTTAGCAGTGG - Intronic
1118615436 14:67571902-67571924 GGTACAGAGAAGGGGAGCAGGGG + Exonic
1118971970 14:70644367-70644389 AGCACTGGAGAAGGCAGCAGAGG - Intronic
1119031563 14:71196893-71196915 GGAGCTGGGAAAGGGAGCTGTGG - Intergenic
1119403237 14:74378536-74378558 GGCACTGGGATGGGGAACAATGG - Intergenic
1119706958 14:76788974-76788996 GGCCCTGGGAGAGGCAGAAGGGG - Exonic
1122242122 14:100376037-100376059 GCCAGTGGGAAAGGGAGACGGGG + Intronic
1122242644 14:100379033-100379055 AGCACAGGGAAAGGGTGCAGGGG + Intronic
1122643452 14:103176101-103176123 GGGAGTGGGAGAGGGGGCAGGGG - Intergenic
1122703272 14:103604649-103604671 GGGACTGGGAGTGGGAGCTGGGG - Intronic
1122890514 14:104730059-104730081 GGCACTGGGAAGGTGAGGGGTGG - Exonic
1123131773 14:105993055-105993077 TGGACTGGGAAAGGGAGATGTGG - Intergenic
1123435738 15:20252921-20252943 GGGGCTGGGAAAGGGGGCAATGG + Intergenic
1123582006 15:21724183-21724205 TGGACTGGGAAAGGGAGATGTGG - Intergenic
1123618653 15:22166779-22166801 TGGACTGGGAAAGGGAGATGTGG - Intergenic
1123904678 15:24909879-24909901 GGCGCTGGGGCAGGGAGAAGGGG + Intronic
1124098564 15:26671780-26671802 GGCACTGGGGAGGGGAGGAAAGG - Intronic
1124102936 15:26712700-26712722 GGCACTGGAAAGGCGAGGAGGGG + Intronic
1124363432 15:29054849-29054871 TGTCCTGGGGAAGGGAGCAGAGG + Intronic
1124581498 15:30959516-30959538 GGCATGGGGAAAGGTAGAAGAGG - Intronic
1125437952 15:39668113-39668135 GGCAATGGAAAAGAGAGAAGTGG + Intronic
1125506745 15:40271743-40271765 GGCAGTGGGGTGGGGAGCAGTGG - Intronic
1125531587 15:40416897-40416919 GGAAATGGGAAAGGGAGATGTGG + Intronic
1125884709 15:43220160-43220182 GGCAGAGGGAAATGGTGCAGAGG - Intronic
1126154758 15:45555613-45555635 GGCACTGGGCAGTGGAGCACGGG - Intergenic
1127842978 15:62846515-62846537 GACACAGGGAGAGGGAGCTGGGG + Intergenic
1128161634 15:65426459-65426481 TGGACTGGGCAGGGGAGCAGGGG + Intergenic
1128256264 15:66199342-66199364 GGCACTAGGACTGGGAGGAGAGG - Intronic
1128316246 15:66661329-66661351 GGCACTGGAGGAGGGAGCACTGG - Intronic
1128801788 15:70501713-70501735 GGCACTGGGGGAGGAAGTAGAGG - Intergenic
1128813255 15:70587201-70587223 GGGACTGGGCACTGGAGCAGGGG + Intergenic
1128944434 15:71811389-71811411 AGGACTGGGAAAGGGACCCGAGG + Intronic
1129192914 15:73947788-73947810 GGCCCTGGGAAAGGGACAAGAGG - Exonic
1129379660 15:75157032-75157054 GGCCCTGGGAAAGGTGGCAGGGG - Intergenic
1129412759 15:75359027-75359049 GGCACTGGGAAAGGGCAATGAGG + Intronic
1129788483 15:78324494-78324516 GGCACTGGGATGGAGAGGAGAGG + Intergenic
1129993898 15:79988451-79988473 GGCATTGGGAGTGTGAGCAGAGG - Intergenic
1130120250 15:81041761-81041783 GGGACAAGGGAAGGGAGCAGTGG + Intronic
1130674713 15:85941520-85941542 GGCCCTGGGAATGGGAGAATGGG - Intergenic
1130840300 15:87693690-87693712 GGCTCTGTGGAAGAGAGCAGGGG - Intergenic
1131019575 15:89087340-89087362 GGCTCGGAGAGAGGGAGCAGGGG - Intergenic
1131178462 15:90224655-90224677 AGCACTGGTGAAGGGTGCAGAGG + Intronic
1131836690 15:96398006-96398028 GGAACTAGGAAAGGGATTAGAGG - Intergenic
1132400027 15:101499406-101499428 GGCTCTGGGAGAGGCTGCAGTGG - Intronic
1132829681 16:1921357-1921379 GGCTGTGGGAAGGGGAGAAGAGG - Intergenic
1132847541 16:2007363-2007385 GGCAGTGGGAGGGGGCGCAGAGG - Intronic
1133039432 16:3052537-3052559 GGTCCTGGGGAAGGGGGCAGTGG + Intronic
1133043275 16:3072170-3072192 GGTCCTGGGGAAGGGGGCAGTGG + Intronic
1134032575 16:11004311-11004333 GGCACTGGGGCTGGGGGCAGCGG + Intronic
1134098694 16:11436407-11436429 AGCAGTGGGGAGGGGAGCAGTGG + Intronic
1134882159 16:17754620-17754642 GGGAAAGGGAAAGGGAGAAGGGG - Intergenic
1135974544 16:27099326-27099348 GGAAGTAGGAATGGGAGCAGAGG + Intergenic
1136250786 16:29003385-29003407 GGCACTGGGAAAATGACCACAGG - Intergenic
1136275202 16:29175681-29175703 GGCAGTGGCAATGGAAGCAGAGG + Intergenic
1136848860 16:33598059-33598081 GGGGCTGGGAAAGGGGGCAATGG - Intergenic
1137500925 16:49011132-49011154 TGAACTGAGAAAGAGAGCAGAGG + Intergenic
1137560403 16:49498642-49498664 GGAACAGGGGATGGGAGCAGAGG - Intronic
1137677196 16:50309548-50309570 GGAACTTGGAAAGGCATCAGGGG - Exonic
1137735232 16:50718914-50718936 GGAAGTGGGGAAGGGAGCTGGGG + Intronic
1138375823 16:56563367-56563389 GGCACTGGGGAGGGGAGGAGGGG - Intergenic
1138531663 16:57637785-57637807 GGCCATGGGAAAGGCAGCAGGGG - Intronic
1138868230 16:60849608-60849630 GGCACTGGGAAAATGAACACAGG - Intergenic
1138923986 16:61568145-61568167 TGCACTGAGAAAAGCAGCAGGGG - Intergenic
1139439947 16:66961444-66961466 GAGACAGGGACAGGGAGCAGTGG + Intronic
1140032507 16:71349825-71349847 GCTACTGGGCATGGGAGCAGTGG + Intergenic
1140151141 16:72367726-72367748 GGAAGTGGGCAAGGGAGAAGAGG - Intergenic
1140218803 16:73028723-73028745 ATCCCTGGGAAAGGGGGCAGTGG + Intronic
1140731166 16:77858073-77858095 TGCACTGGGCACAGGAGCAGAGG + Intronic
1141155057 16:81591666-81591688 TGGGCTGGGAAGGGGAGCAGGGG + Intronic
1141712600 16:85708655-85708677 GGCACTTGGAAAGGTCACAGAGG + Intronic
1141937815 16:87253551-87253573 GGCAGGGTGAAAGGGAACAGGGG + Intronic
1142067060 16:88068733-88068755 TGCACTTGGAAAGGGGGCTGGGG - Intronic
1142079562 16:88141749-88141771 GGCAGTGGCAATGGCAGCAGAGG + Intergenic
1142126318 16:88412286-88412308 GGCACTGGGAAGGTGGGCACTGG - Intergenic
1203110567 16_KI270728v1_random:1446709-1446731 GGGGCTGGGAAAGGGGGCAATGG - Intergenic
1142979188 17:3661819-3661841 AGCACTGGGAGCGGGGGCAGTGG + Intergenic
1143444001 17:6996488-6996510 GTCACTGGGAGAAGGAGCTGGGG - Intronic
1143484645 17:7246989-7247011 GGGACTGGGAAAGGGAGTCCAGG + Intronic
1143571315 17:7760386-7760408 CAGACTGGGGAAGGGAGCAGGGG + Intronic
1143729411 17:8872511-8872533 GGCAGAGGGAGAGGAAGCAGGGG - Intergenic
1143910848 17:10247477-10247499 GGCACTTGGAAAGGGCAAAGTGG + Intergenic
1144355126 17:14437976-14437998 GGCACTGGGGCTGGGCGCAGTGG - Intergenic
1144770916 17:17758922-17758944 GGGGCTGGTAGAGGGAGCAGGGG + Intronic
1144968092 17:19090254-19090276 TGCCCTGGGAGAGGCAGCAGCGG + Intergenic
1144979825 17:19161809-19161831 TGCCCTGGGAGAGGCAGCAGCGG - Intergenic
1144988397 17:19216423-19216445 TGCCCTGGGAGAGGCAGCAGCGG + Intronic
1145005878 17:19337461-19337483 GGCACTTGCACAGAGAGCAGAGG - Intergenic
1145891441 17:28418886-28418908 GACTCTGGGACTGGGAGCAGTGG - Intergenic
1146529046 17:33592249-33592271 AGCACTGGGACACAGAGCAGGGG - Intronic
1146655132 17:34630557-34630579 GACACTTGGCAAGGCAGCAGGGG + Intronic
1146692947 17:34889318-34889340 AGAGCTGGGAGAGGGAGCAGAGG - Intergenic
1147253631 17:39168353-39168375 CAGACTGGGAATGGGAGCAGTGG - Intergenic
1147885383 17:43680686-43680708 GGAACTTGGAAAGGGAGACGTGG + Intergenic
1148411473 17:47471112-47471134 GGAACTTGGAATGGGAGCCGTGG - Intergenic
1148464139 17:47854861-47854883 GGGAGTGGGAAATGGAGGAGAGG - Intronic
1148684632 17:49494810-49494832 TGCACTGGGAAGGGGAGGGGTGG + Intergenic
1148764698 17:50030440-50030462 GGGGCTGGGATAGGGAGCAGTGG - Intergenic
1148836909 17:50470197-50470219 GGTACTGGGTAAGGGAAGAGAGG - Intronic
1149302505 17:55318160-55318182 GGGAGAGGGAAAGGGGGCAGAGG + Intronic
1150285997 17:63954486-63954508 GGCATGGGGGAAGGGAGGAGGGG + Intronic
1150988497 17:70227426-70227448 GACCCTGGGAAAGGGAGATGCGG + Intergenic
1151404510 17:73877941-73877963 GGCATTTGGAAATGGGGCAGGGG - Intergenic
1152158080 17:78648027-78648049 GGCACTGGGAATAGGGACAGGGG - Intergenic
1152587375 17:81195117-81195139 GGCGCTGGGGAGGGCAGCAGTGG - Intronic
1152803024 17:82340394-82340416 GGCACTGGGGGAGGGTACAGGGG - Intergenic
1152895545 17:82909043-82909065 GGCACAGAGAGAGGGAGGAGAGG - Intronic
1152988783 18:343424-343446 GGCAGTGGAGAAGGGAGAAGTGG - Intronic
1153047655 18:871429-871451 GGCACTGGGAAACTGAACAGAGG - Intergenic
1153336984 18:3934938-3934960 AGCACTGAGAAATGGAACAGGGG - Intronic
1153773832 18:8435765-8435787 GGCCCTGGAAAAGGGAGGACAGG - Intergenic
1154472918 18:14722292-14722314 AGGATTGGGAAAGGCAGCAGTGG - Intergenic
1154945384 18:21157334-21157356 GGCACTGGCAGTGGCAGCAGTGG + Intergenic
1155076590 18:22362633-22362655 GTTGCTGTGAAAGGGAGCAGAGG - Intergenic
1156088840 18:33440876-33440898 GGCACTGGGAGAAGGCGGAGCGG - Intronic
1156490507 18:37493200-37493222 GGCATGGGGGAAGGCAGCAGAGG - Intronic
1156846996 18:41677508-41677530 GAGACTGGGAAAGTGAGCAGGGG - Intergenic
1157080373 18:44518365-44518387 TGCACTGGGAGAGGGAGAAGGGG + Intergenic
1157281381 18:46348284-46348306 GTCACTGGGACAGGGAGCTGGGG + Intronic
1157461413 18:47899022-47899044 GGCAGTGGGGAATGGAGAAGGGG + Intronic
1157546426 18:48549838-48549860 GGAAGTGGGGAAGGGAGCAATGG + Intronic
1157893645 18:51443023-51443045 GGTACTGGGAAAGGGCTCTGGGG + Intergenic
1159287634 18:66374293-66374315 GGCACTGGGGAAATGAGCACAGG - Intergenic
1160012287 18:75115294-75115316 GGCACTGAGAGAGAGAGCAAAGG - Intergenic
1160434408 18:78834856-78834878 GGCTGTGGGAAAAGGGGCAGAGG + Intergenic
1160437453 18:78862465-78862487 GGCACAGGGAGAGGCAGCACAGG + Intergenic
1160497458 18:79383707-79383729 GGCTCTGGGAAGGGCTGCAGGGG - Intergenic
1160617601 18:80144622-80144644 GGGGCTGGAAATGGGAGCAGGGG - Intronic
1160704622 19:524227-524249 GGCACAGGGTCAGGGATCAGGGG - Intergenic
1160806695 19:995127-995149 GGCCCTGGGGAAGCCAGCAGGGG - Intronic
1161015166 19:1979731-1979753 GGCTGTGGGTGAGGGAGCAGGGG - Exonic
1161245580 19:3249829-3249851 GGCCCTGGGATAGGGAGCAGTGG - Intronic
1161951281 19:7469465-7469487 GGAACTGGGACAATGAGCAGAGG - Intronic
1162879455 19:13647371-13647393 AGAACTGGTAAAGGGATCAGAGG + Intergenic
1162968862 19:14168231-14168253 GGCGCTGGGAAGGGAGGCAGAGG - Intronic
1163234880 19:16024412-16024434 GGCACTGTGGAAGGTGGCAGTGG - Intergenic
1163266849 19:16227030-16227052 GCCACTGGAAGAGGGTGCAGTGG + Intronic
1163686747 19:18716103-18716125 GGCACTGGGCAGGGCAGCGGGGG - Intronic
1163767554 19:19171889-19171911 GACACTGAGACAGGGAACAGGGG + Intronic
1164698058 19:30261801-30261823 GGAACTGTGAAAGGGGGCTGTGG + Intronic
1165145394 19:33727038-33727060 GGGCCTGGGAAGGGGAGGAGAGG - Intronic
1165936140 19:39390204-39390226 GGCAGTGGGGCTGGGAGCAGAGG - Intronic
1166053407 19:40274582-40274604 AGTGCAGGGAAAGGGAGCAGGGG + Intronic
1166228222 19:41410618-41410640 GGTGCTGGGGAAGAGAGCAGAGG - Exonic
1166396656 19:42446175-42446197 GCCCGTGGGAAAGTGAGCAGTGG + Intergenic
1166419530 19:42625781-42625803 GTCACTGGTAAGGGGAGCACTGG - Intronic
1166784197 19:45357957-45357979 GGTGCTGGGAGAGTGAGCAGTGG - Intronic
1166980067 19:46626828-46626850 CCCACTGGGCATGGGAGCAGAGG - Intergenic
1167463759 19:49639709-49639731 GGCACTGGGAGAGGGAATAGTGG + Intronic
1167674764 19:50877401-50877423 GGCTCTGGGGCAGGGAGGAGGGG + Intronic
1167744077 19:51340723-51340745 GGCTCTGGGAGAGGGAGAATGGG + Exonic
1167874852 19:52403376-52403398 GTCACTGGGACAGGGTGCAGTGG + Intronic
1168539508 19:57198560-57198582 GGCACTGGGAAAATGACCACAGG + Intronic
925232161 2:2243056-2243078 GGCAATGTCAATGGGAGCAGGGG + Intronic
925854762 2:8118745-8118767 GAGGCTGGAAAAGGGAGCAGAGG + Intergenic
926086913 2:10026257-10026279 CCCACTGGGAAAGGGAGTGGAGG - Intergenic
926825743 2:16903541-16903563 GGCACTGGGAAAATGACCACAGG + Intergenic
926846613 2:17147866-17147888 AGCACAGGGAAGGGGAGAAGGGG + Intergenic
927721740 2:25387555-25387577 GGCAGAGGGAGAGGGACCAGTGG - Intronic
927856365 2:26530209-26530231 GGCCCTGTGAAAGGGAGGTGGGG + Intronic
928102896 2:28449747-28449769 GGCACCGGGAGAGGGAGGTGTGG - Intergenic
928178066 2:29048496-29048518 GGGACTGGGGAAGGGAGGAATGG - Intronic
928398171 2:30959037-30959059 GGCACTGGGCATGGGAGGTGGGG - Intronic
928452079 2:31386297-31386319 GGCAGAGGGATAGGGTGCAGAGG + Intronic
929021012 2:37553066-37553088 GGCACAGGGGAGGGGAGAAGGGG + Intergenic
930235420 2:48884564-48884586 AGGACTGGGAGAAGGAGCAGAGG - Intergenic
930293230 2:49521900-49521922 GTCAGTGTGAAAGGGATCAGCGG - Intergenic
931077539 2:58733423-58733445 GGCACTAGGACAGGGTGCTGGGG - Intergenic
932223549 2:70021067-70021089 GGGACTGGGGGAGGGAGCAATGG - Intergenic
932769071 2:74490397-74490419 GACACTGGGGAAGGTGGCAGAGG - Exonic
933215366 2:79624022-79624044 GGCAAGGGGAAAGAGAGCATGGG - Intronic
933983076 2:87569452-87569474 GGCAATGGGAAAGAGAGAAAAGG - Intergenic
933983984 2:87575543-87575565 GGCACTGGGTGAGGGAGGTGAGG - Intergenic
934049225 2:88196307-88196329 GGGACTGAGAAAGAAAGCAGAGG - Intergenic
934300685 2:91774460-91774482 TGCACTGGGACAGGGTGGAGTGG + Intergenic
934495034 2:94789182-94789204 GGAACTGGTAAATGGAGGAGTGG - Intergenic
935156069 2:100484685-100484707 GGCATTGGGTATGAGAGCAGAGG + Intergenic
935613164 2:105047072-105047094 GGCTGTGGCAAGGGGAGCAGGGG + Intronic
935964865 2:108463689-108463711 GGTGCTGGGAATGGCAGCAGTGG + Intronic
936058840 2:109281359-109281381 GGGACTTGGAAAGTGAGGAGAGG + Intronic
936064518 2:109320254-109320276 GGCGGTGGGAATGAGAGCAGAGG + Intronic
936309870 2:111375253-111375275 GGCACTGGGTGAGGGAGGTGAGG + Intergenic
936310769 2:111381342-111381364 GGCAATGGGAAAGAGAGAAAAGG + Intergenic
936824534 2:116565190-116565212 GGCAAAGGGAAAAGGAGCAATGG + Intergenic
937311771 2:120907190-120907212 GGCACAGGGATGAGGAGCAGTGG - Intronic
937922203 2:127138408-127138430 GGCAGTGGGAAAGGTGGCTGTGG - Intergenic
940120392 2:150258003-150258025 GGCACTGAGAAATGGAGTATCGG - Intergenic
940353656 2:152717215-152717237 GGCCCTCGGTAAGGGATCAGTGG - Intronic
942321759 2:174742153-174742175 GGCCCTGGGGAAGGAGGCAGAGG - Intergenic
942650114 2:178157692-178157714 GGGACTGGCAGAGGGAGAAGTGG - Intergenic
942997738 2:182285095-182285117 GGCACTGGGGAGGGAATCAGAGG - Intronic
943683426 2:190791814-190791836 GGCAGTGGGAAAGGAAGGACGGG - Intergenic
944031582 2:195240712-195240734 GATACTGGGAAAGGAAGTAGGGG + Intergenic
944203742 2:197135754-197135776 GGCACAGAGCAGGGGAGCAGGGG - Intronic
944306700 2:198187632-198187654 GGCAATGGAGAAGAGAGCAGAGG - Intronic
944958064 2:204835514-204835536 GGGAGTGGCAAACGGAGCAGGGG - Intronic
945010034 2:205451131-205451153 GCCACTGGGAAAGGCAAGAGAGG - Intronic
945253051 2:207780404-207780426 CGCACCGGGACATGGAGCAGTGG + Intergenic
945466099 2:210171622-210171644 GGCACTGGGAAAGAGAAGGGAGG - Intergenic
946856068 2:223951034-223951056 GTCAGGGGGAAGGGGAGCAGGGG - Intergenic
947116959 2:226782106-226782128 GGAATTGGGAAGGGGGGCAGAGG + Intronic
947187358 2:227467184-227467206 GGCACTGGGGCACGGGGCAGAGG + Intergenic
947263512 2:228251638-228251660 GGCATTGGCAATGGCAGCAGTGG + Intergenic
947936567 2:234009640-234009662 AGCAAGGGGAAAGGGAGAAGGGG - Intronic
948636173 2:239339240-239339262 TTCACTGGGACAGTGAGCAGTGG - Intronic
948770113 2:240247539-240247561 GGCTCCTGGGAAGGGAGCAGGGG + Intergenic
1168779596 20:477543-477565 GGCACTTGGAAAGGCTACAGGGG - Intronic
1168953442 20:1818034-1818056 GGCACTGAGGAAGGCAGCAGAGG + Intergenic
1169064989 20:2690127-2690149 GGCACTGGGGTAGGGAGGAAAGG + Intergenic
1169973451 20:11296481-11296503 AGTACTTGGAGAGGGAGCAGTGG + Intergenic
1170702132 20:18713094-18713116 GGCCATGGGAGGGGGAGCAGAGG - Intronic
1170765087 20:19283007-19283029 CACACAGGGAAAGGGAGGAGAGG + Intronic
1170765322 20:19285025-19285047 GGCAGAGGGAAGGGGAGGAGGGG - Intronic
1172619420 20:36309245-36309267 GGCACGGGGTAATGAAGCAGAGG - Intronic
1173151292 20:40568444-40568466 GGCACTGGGAAAGAGCACAGAGG + Intergenic
1173541698 20:43857404-43857426 GGGAGAGGGAAAGGGAGAAGGGG + Intergenic
1173627947 20:44487664-44487686 GGGACTGGGAAAGGCTGAAGAGG - Intronic
1173849800 20:46210557-46210579 GGCGCTGCGGGAGGGAGCAGAGG + Exonic
1174028422 20:47599383-47599405 GGGGGTGGGAATGGGAGCAGGGG + Intronic
1174351843 20:49974246-49974268 GCCAGAGGGAAAGGGAGGAGAGG + Intergenic
1174450066 20:50614368-50614390 GGGACTGGGAAAGCGAGGAGGGG - Intronic
1174486002 20:50861671-50861693 GGAGATGGGAAAGGGAGCTGGGG - Intronic
1174494308 20:50929543-50929565 TGCACTGGGTAAGGCTGCAGAGG - Intronic
1174861710 20:54097555-54097577 GTCACTGAGAAAGGGAGCAGTGG - Intergenic
1175140233 20:56855491-56855513 GCCACTGAGCAAGGGAGGAGGGG + Intergenic
1175213014 20:57373231-57373253 GGCAGAGGGAGAGCGAGCAGCGG + Intronic
1176669290 21:9717512-9717534 TGCACAGGGTAAGGGATCAGGGG + Intergenic
1176801568 21:13435557-13435579 AGGATTGGGAAAGGCAGCAGTGG + Intergenic
1177180432 21:17739090-17739112 GGCACTAGGAAAGGGGGAGGTGG - Intergenic
1178371583 21:32031474-32031496 AGCACAGTGAGAGGGAGCAGAGG - Intronic
1178372603 21:32038580-32038602 GGCACTGTGCATTGGAGCAGGGG - Intronic
1178824510 21:36004738-36004760 GGCAGTGGGGGAGGCAGCAGTGG + Intergenic
1178889505 21:36509421-36509443 GGCCCAGAGAAGGGGAGCAGTGG + Intronic
1179415318 21:41193704-41193726 GGCACTGGGAAAATGACCACAGG + Intronic
1179654593 21:42837551-42837573 GGGACTGGGGAGGGGAGCAAGGG - Intergenic
1180012341 21:45059231-45059253 GGGACTGGGGAGGAGAGCAGAGG - Intergenic
1180099102 21:45576089-45576111 GGCACTGGGAGAAGGCCCAGGGG - Intergenic
1180195178 21:46189779-46189801 TGCCCTGGGCAAGGCAGCAGGGG + Exonic
1181028852 22:20140535-20140557 GGGGCTGGGCAAGGGAGCTGGGG - Intronic
1181406830 22:22690787-22690809 GCCCCTGGGACATGGAGCAGAGG - Intergenic
1181699040 22:24609596-24609618 TGCACTGGGACAGGGTGGAGTGG + Intronic
1181774630 22:25150429-25150451 AGCACAGGGAAAGGGCTCAGAGG - Intronic
1181956120 22:26589377-26589399 GGGACTGGGACTGGTAGCAGGGG - Intronic
1182046040 22:27274903-27274925 GGCACTGGGTAAAGGGGCAGTGG - Intergenic
1182273762 22:29171850-29171872 GGGACGGGGAGAGGGAGCCGAGG + Intergenic
1183318317 22:37148964-37148986 AGCACTGTGTATGGGAGCAGGGG - Intronic
1183621129 22:38973435-38973457 GGGCCTGGGAAAGGGAGAACAGG + Intronic
1183644372 22:39115093-39115115 GGCTATGGGAAAGGGAGAAGAGG + Intergenic
1183649524 22:39145878-39145900 CGCAGTGGGAAGGGGCGCAGCGG + Intronic
1183778099 22:39980967-39980989 GGCACAGAGGAAGGGAGCACTGG + Intergenic
1183877089 22:40792228-40792250 GGCTCAGGGAAAGGGAAAAGGGG + Intronic
1183906942 22:41048895-41048917 GCCCCAGGGAAAGGGAGCTGTGG - Intergenic
1183952269 22:41358438-41358460 CGCTCTGGGAAAGGTGGCAGAGG + Exonic
1183956290 22:41382282-41382304 GGCAGTGGGTCAGGGAGCAGTGG + Intronic
1184092509 22:42299911-42299933 AGGAGGGGGAAAGGGAGCAGAGG + Intronic
1184603721 22:45559574-45559596 GGCACTGGGAAAATGACCACAGG + Intronic
1184963808 22:47951766-47951788 GGGGCAGGCAAAGGGAGCAGAGG - Intergenic
1185010266 22:48309036-48309058 GAGAGAGGGAAAGGGAGCAGAGG + Intergenic
1185076829 22:48687673-48687695 GTCACTGGGAGAGTGAGGAGGGG - Intronic
949604260 3:5636276-5636298 GGCACTGGGAAAGGTATTTGAGG + Intergenic
950086378 3:10261104-10261126 GCCAGTGGGAAGGGGAGAAGAGG + Intronic
950451229 3:13066974-13066996 GGGACTGGGAGTGGGAGGAGTGG - Intronic
950647720 3:14387251-14387273 GGAACTTGGAAAGGGAACTGTGG - Intergenic
950649248 3:14396840-14396862 GGCCATGGGAATAGGAGCAGTGG - Intergenic
950662435 3:14474850-14474872 CGTCCTGGGCAAGGGAGCAGGGG + Intronic
950697746 3:14716609-14716631 TGCACTGGCAAAGAGAGGAGGGG - Intronic
950772449 3:15323287-15323309 GGCACTGGGAAGGGGGTCAGAGG - Intronic
951017123 3:17743033-17743055 TGGACTGAGAAGGGGAGCAGAGG + Intronic
951364378 3:21762920-21762942 AGCACTGTGGAAGGGAGAAGAGG - Intronic
951405110 3:22287194-22287216 TGCAATGGAAAAGAGAGCAGAGG - Intronic
951755591 3:26087642-26087664 GGCACTGGAAAAGGGAAATGTGG - Intergenic
951925856 3:27908189-27908211 GGCACTTGGAGAGTGAGAAGAGG + Intergenic
952541304 3:34370831-34370853 GGCAGTGAGAAAGGGAAAAGTGG + Intergenic
952819557 3:37474594-37474616 CTGACTGGGAAAGGGTGCAGGGG - Intronic
952820979 3:37485311-37485333 GGAACAGGGCAAGGGAGGAGGGG + Intronic
952869508 3:37886000-37886022 GGCAGTGGGAAATGGAGGGGAGG - Intronic
953020931 3:39112584-39112606 GGCAGTGGAAAAGGGAGAGGTGG + Intronic
953034995 3:39203543-39203565 GGCAGTGGGAGTGGGAGAAGGGG + Intergenic
953266618 3:41395611-41395633 GGCACTGGGAGAAGGAGGAGTGG + Intronic
953407380 3:42666091-42666113 GGCACTGGGGCAGGGAGCTGGGG + Intergenic
953878834 3:46681278-46681300 GCCACTGGGAGAGGGGCCAGAGG - Exonic
954460957 3:50626630-50626652 GGCAGTGGCACAGGGGGCAGGGG + Intronic
954463049 3:50638531-50638553 TGCTCTGGGTAATGGAGCAGGGG + Intronic
954502231 3:51029506-51029528 TGCACTGGGGAGGGGAACAGGGG + Intronic
956325323 3:68045704-68045726 GGCACTAGGGAAGGGAGTGGTGG + Intronic
956716890 3:72087175-72087197 GACACTGGAAAAGGAAGCAAAGG + Intergenic
957302560 3:78411455-78411477 GTCACCTGGAAAGGGAGCATGGG - Intergenic
958044134 3:88263056-88263078 GGCACAGGGAAAAGGAGGAAGGG + Intergenic
958447225 3:94230794-94230816 GGGAGTGGGAATGGAAGCAGGGG - Intergenic
958779208 3:98521860-98521882 GGCACAGGAAAAAGAAGCAGTGG + Exonic
958934157 3:100239447-100239469 GGCACTGGGGAAGTGACCACAGG - Intergenic
959995454 3:112675622-112675644 GGGACTAGAAAAGGAAGCAGAGG + Intergenic
960439033 3:117664192-117664214 GGCTCTGGGAAAGGCAGAACTGG - Intergenic
961033807 3:123628606-123628628 TGCCCAGGGAAAGGGAGCAGTGG - Intronic
961384665 3:126516714-126516736 GGCGCTGGGGAAGGGAGAAAGGG - Intronic
961386978 3:126528298-126528320 GGCACTGGGCAAGGTTGCAGGGG + Intronic
961479578 3:127171308-127171330 GGACCTGAGAAAGGGAGGAGGGG + Intergenic
963076669 3:141353546-141353568 GGCATTGGGAAGGGGGGAAGGGG + Intronic
963133461 3:141878485-141878507 AGCACTGGGGAAGGGAGAAAGGG - Intronic
963858108 3:150277390-150277412 GACCCTGGGGAAGGAAGCAGGGG - Intergenic
964072377 3:152650514-152650536 CTCACTGGGAAGGGAAGCAGTGG - Intergenic
964709671 3:159658329-159658351 GTCAGTGAGAAAGGGAACAGTGG + Intronic
964981162 3:162682354-162682376 GGCACTGGGAAGGGCTGCATGGG - Intergenic
966197030 3:177323958-177323980 GGAACTATGAAAGGGAGAAGGGG - Intergenic
966219647 3:177538158-177538180 GGCATTGGGGAATGCAGCAGGGG - Intergenic
966331833 3:178823281-178823303 GGCATTGGGATTGGGAGCTGGGG + Intronic
967015647 3:185479261-185479283 GGCTCTGGGAAATGAAGCTGGGG + Intronic
967149846 3:186638532-186638554 AGCCCTGGGAGAGGAAGCAGGGG - Intronic
967851834 3:194088254-194088276 GCCTCTGGGATAGGGACCAGGGG + Intergenic
968453513 4:686173-686195 GGCTCTGGGCAAGGGCACAGAGG + Exonic
969175813 4:5398293-5398315 GGCACTGGGAAATAGTGCGGGGG + Intronic
969373806 4:6750116-6750138 GGCAGAGGGAAAGGGAGCTCCGG + Intergenic
969413277 4:7043227-7043249 GGCTCTGGGAAAGGCGGCGGTGG + Intronic
969497528 4:7534646-7534668 GGAGCTGGGAGATGGAGCAGAGG + Intronic
970369427 4:15392637-15392659 GGCACCGGCAGAAGGAGCAGAGG + Intronic
971108864 4:23559883-23559905 AGCACTGTGAAAGGCAGCTGAGG - Intergenic
971855113 4:32032836-32032858 GGCACTGGGATAAGTAGGAGTGG - Intergenic
972488675 4:39566151-39566173 GGCAGTGGGATAGTGAGAAGTGG + Intronic
972650362 4:41011806-41011828 ATCACTGGGAAAGGGGGCTGGGG + Intronic
974089836 4:57300191-57300213 GTCAATGGGAATGGGAGCTGTGG + Intergenic
974499030 4:62673891-62673913 ATCCCTGGGAAAGGGTGCAGTGG - Intergenic
974726928 4:65810284-65810306 GGCACTGGGGAAGTGACCACAGG - Intergenic
975733855 4:77363220-77363242 GGCACTGGGAAAATGACCACAGG + Intronic
976507566 4:85866713-85866735 GGCACAGGGGAAGGGAGGTGTGG - Intronic
977626429 4:99193844-99193866 GGCACTGGGAAAATGACCACAGG + Intergenic
978757481 4:112319091-112319113 GGAACTGGGAAAGAGACAAGTGG + Intronic
978826635 4:113032403-113032425 GGCACTGGAAAAGGACTCAGAGG - Intronic
980126210 4:128776788-128776810 AGCACTGGGAGAGTGAGCTGAGG - Intergenic
980425116 4:132618234-132618256 GGCACTGGGGAAGGGAAATGTGG - Intergenic
980957574 4:139444745-139444767 GGCACTGGGAAAATGACCACAGG - Intergenic
981297518 4:143149125-143149147 GCCACTTGGAGAGGAAGCAGTGG + Intergenic
982581803 4:157188290-157188312 GGTACTGGGAATGGTAGCAGTGG - Intergenic
983490732 4:168385992-168386014 GGGAGAGGGAAAGGGAGAAGGGG + Intronic
984580508 4:181504543-181504565 GGCAGTGGGAAAGGAGGAAGAGG - Intergenic
984705985 4:182847584-182847606 GGCTCTGGGGCAGGGAGGAGAGG - Intergenic
985053655 4:186017527-186017549 AGCCCTGGGGAAGGGAGCAGAGG + Intergenic
985405480 4:189633958-189633980 TGCACAGGGTAAGGGATCAGGGG - Intergenic
985787758 5:1908492-1908514 GGCAGTGGGAAAGTGAGGTGAGG + Intergenic
985852209 5:2397177-2397199 GGCCCTGGGAGAGGAGGCAGTGG - Intergenic
986253649 5:6083587-6083609 GGAAGTCAGAAAGGGAGCAGGGG - Intergenic
986476728 5:8142266-8142288 GCCAGTGGGGAAGGTAGCAGGGG - Intergenic
986748506 5:10764220-10764242 AGCGCTTGGAAAGTGAGCAGGGG - Intergenic
988228620 5:28446970-28446992 GGCACTGGGGAAGTGACCACAGG - Intergenic
988405252 5:30816103-30816125 GGAAGGGAGAAAGGGAGCAGTGG - Intergenic
989457800 5:41662953-41662975 GGCACTGGGGAAATGAGCATAGG + Intergenic
989757462 5:44973111-44973133 GGCATTGGGAAAGGGGAGAGTGG - Intergenic
989786895 5:45343444-45343466 GGCAGTGGGAAAGGAAGCAAAGG + Intronic
990407963 5:55510990-55511012 GGGGCTCGGAAAGAGAGCAGGGG - Intronic
990534368 5:56705389-56705411 GAGAGTGGGAAAGTGAGCAGGGG - Intergenic
991126477 5:63075438-63075460 GGCAGTGGGAAGGGAAGTAGAGG - Intergenic
991967474 5:72107369-72107391 GGCGCTGGGAGAGGGCGGAGGGG + Exonic
991989918 5:72327359-72327381 GCCACTGGGAAAGCCAGCAAAGG + Intronic
992021991 5:72633940-72633962 GCTACTGGGAAAAGGAGGAGGGG - Intergenic
992453204 5:76891815-76891837 GGGCCTGGGAGAGGGAGGAGGGG + Intronic
992453694 5:76896182-76896204 GAGACTGGGAAGGGTAGCAGGGG - Intronic
992943371 5:81785292-81785314 GGCAATGGAGAATGGAGCAGAGG + Intergenic
993307181 5:86288033-86288055 GGCACTTGGAACAGGAGAAGAGG - Intergenic
993375335 5:87143727-87143749 GGGAGTGGGAAATGAAGCAGGGG - Intergenic
993604279 5:89969055-89969077 GGCTGTGGGAAAGGGTTCAGAGG - Intergenic
994179295 5:96746159-96746181 AGCTGTGAGAAAGGGAGCAGTGG - Intronic
995044669 5:107632259-107632281 AAGACTGGAAAAGGGAGCAGCGG - Intronic
995650263 5:114361710-114361732 GGCACTAGTCAAGGGGGCAGCGG + Intronic
996353257 5:122569156-122569178 GGCACTGGAAAAGTAGGCAGGGG + Intergenic
996542977 5:124648969-124648991 GCCAATGGGAAAGGGAGGCGGGG - Exonic
996988234 5:129594790-129594812 GGGATTGGGGAAGGGAGAAGAGG - Intronic
997266731 5:132499186-132499208 GGCTATGGGAAAGGGAGCAGAGG - Intergenic
997803374 5:136889155-136889177 AGGACTGGGAAAGAGAGGAGAGG - Intergenic
998128973 5:139641619-139641641 GGAACAGGGAAAGGGATCAGGGG + Intergenic
998170160 5:139868112-139868134 GGCACTGGGGAGGGGCACAGTGG + Intronic
998385692 5:141756046-141756068 TGTACTGGGACAGGGCGCAGTGG + Intergenic
998402074 5:141853271-141853293 GGCACTGCGGCAGGGAGGAGGGG + Exonic
998518758 5:142781132-142781154 GCCTCTGGGGGAGGGAGCAGAGG + Intronic
998997161 5:147878171-147878193 GACACTGGAAAAGGTAACAGAGG + Intronic
999145353 5:149389611-149389633 AGCACTGGGATGGGGAGGAGGGG + Intronic
999264014 5:150254935-150254957 CCCACTGGGAAGGGGATCAGAGG - Intronic
999715430 5:154356391-154356413 GGCTCTGGGAGAGGGATCTGAGG + Intronic
999747130 5:154600900-154600922 GAAACTGGCAAAGGGAGAAGGGG - Intergenic
1001016574 5:168146995-168147017 GGCACTGGTAAAGTGAAAAGGGG - Intronic
1001304593 5:170562527-170562549 GGAACTGGACAAGGGAGGAGAGG - Intronic
1001441344 5:171745431-171745453 GGCTCTGGTAAAGGGAGCCCAGG - Intergenic
1001545108 5:172566135-172566157 GGCACTCGGAGAGGTAGGAGGGG + Intergenic
1001572666 5:172740845-172740867 GGCACTGGGGGTGGGGGCAGTGG - Intergenic
1001951323 5:175818595-175818617 GGGACTGGAAAGGGGAGCAAAGG - Intronic
1002186901 5:177458817-177458839 GTCACTGGGTAAGGGGGCAGTGG - Intronic
1002439919 5:179258945-179258967 GGCCATGGGAATGAGAGCAGCGG - Intronic
1002478303 5:179482640-179482662 GGCAGAGGGACAGGGAGCAGGGG - Intergenic
1002934768 6:1662094-1662116 GGGACTGGGAAAGGAAGGAAGGG + Intronic
1003739430 6:8919152-8919174 GGTATTGGGAAATGGAGAAGGGG + Intergenic
1003885252 6:10515801-10515823 GAGGCTGGGAAAGGGAGTAGGGG - Intronic
1004040790 6:11972894-11972916 GGCATGGGGAAAGGGAGGAATGG - Intergenic
1004263983 6:14133137-14133159 GGGACTATGAAAGGAAGCAGGGG - Intronic
1004964312 6:20830654-20830676 GGCACAGGGGAGGGGAGAAGGGG - Intronic
1005821611 6:29603794-29603816 GGCACAGGGAAAGAGAGGAAGGG + Intronic
1006891483 6:37433134-37433156 GGCCCCGGGAAAGGCAGCTGAGG - Intergenic
1007163791 6:39813699-39813721 AGCTGTGGGAAAGGGGGCAGAGG - Intronic
1007237220 6:40399323-40399345 GGCAGTGAGCATGGGAGCAGTGG - Intronic
1007519565 6:42441113-42441135 TGCACTGGGGGAGGGTGCAGAGG - Intronic
1007588454 6:43007114-43007136 GGCACAGGGAAAGGACACAGGGG + Intronic
1007742437 6:44021136-44021158 AGCACGGGGAGAGGGGGCAGAGG - Intergenic
1007766969 6:44166391-44166413 ATTACTGGGAAAGGGAGCAGAGG - Intronic
1008680302 6:53864799-53864821 GGCACTGGGAGAAACAGCAGAGG - Intronic
1010062872 6:71645438-71645460 GGGAGTGAGAAAGGGAGAAGGGG + Intergenic
1012306841 6:97669206-97669228 TGCTCTGGGAAAGGGAACTGGGG - Intergenic
1012672138 6:102066688-102066710 AGCAGTGGGGAAGGGAGAAGAGG + Intronic
1013960132 6:115889387-115889409 GTCAATGGGACTGGGAGCAGGGG - Intergenic
1014605522 6:123469388-123469410 GGGGTTGGGAAAGGGAGGAGTGG - Intronic
1015577600 6:134689777-134689799 GGCACTTGGCAAAGGAGCTGGGG + Intergenic
1015994092 6:138980185-138980207 GGCAGTAGGATAGAGAGCAGTGG - Intronic
1016270894 6:142289172-142289194 GGGACTGGGGGAGGGAGAAGTGG + Intergenic
1017388682 6:153914288-153914310 GGCACAGGGGAGGGGAGGAGAGG + Intergenic
1017507422 6:155081351-155081373 GGCATTGGGAAAGGGATCATTGG + Intronic
1017613109 6:156213145-156213167 GGTGCTTGGAATGGGAGCAGTGG + Intergenic
1017621814 6:156306984-156307006 GGCACTAGGTATGGGAGAAGTGG + Intergenic
1018123087 6:160656411-160656433 GGCACTGGGAAAATGACCAGAGG + Intronic
1018443950 6:163837993-163838015 GGGAAAGGGAGAGGGAGCAGGGG - Intergenic
1018674605 6:166207867-166207889 GCCTCTGGGAAAGGGAGTGGGGG + Intergenic
1018867582 6:167758216-167758238 GGGACTGGGAAGGGGAACCGAGG + Intergenic
1019447025 7:1076634-1076656 GGCCCTGGGAAAAGCCGCAGAGG + Intronic
1019621315 7:1993786-1993808 CACACTGGGAAAGGGGACAGAGG + Intronic
1019660167 7:2219681-2219703 GGCAGGGGGAAGAGGAGCAGGGG + Intronic
1019688245 7:2394587-2394609 GTCACTAGTGAAGGGAGCAGTGG + Intergenic
1019718472 7:2554234-2554256 GAGGCTGGGACAGGGAGCAGGGG - Intronic
1019735927 7:2649681-2649703 GGCACTGGGGGAGGGACGAGGGG + Intronic
1019786823 7:2982488-2982510 TGCACAGGGAAAGGAAGCAACGG + Intronic
1020035074 7:4959462-4959484 GGCACCGGGAAAAGGGGCCGGGG - Intergenic
1021315524 7:19144084-19144106 GGCCCTGGGACAAGGAGCTGTGG + Intergenic
1021616148 7:22505086-22505108 GGGAGAGGGAAAGGGAGAAGAGG + Intronic
1022013593 7:26329882-26329904 GGCAGTGGGACAGGGAGCTGAGG + Intronic
1022036798 7:26542374-26542396 GGCAAGGAGAAAGGGAGCTGAGG + Intergenic
1022368879 7:29751946-29751968 TGCACAGGGGAAGGGAGCTGAGG - Intergenic
1022681537 7:32551903-32551925 GGGACTTAGCAAGGGAGCAGAGG + Intronic
1022925939 7:35056302-35056324 GGGAGAGGGAAAGGGAGAAGAGG + Intergenic
1023221008 7:37920296-37920318 TTCACTGGGAATGGGAGCTGAGG + Intronic
1023285414 7:38614034-38614056 GGGAAAGGGAAAGGCAGCAGTGG + Intronic
1023735778 7:43234971-43234993 GGCAATGAGATAGGGAGGAGAGG - Intronic
1023842363 7:44104588-44104610 GTCTCTGGGAAAGGGCGGAGAGG - Exonic
1025753094 7:64310810-64310832 GGCACTGGGAAGGAGACTAGGGG - Intronic
1025839102 7:65127251-65127273 GTACCTGTGAAAGGGAGCAGTGG + Intergenic
1025883966 7:65568714-65568736 GTACCTGTGAAAGGGAGCAGTGG - Intergenic
1025889479 7:65633892-65633914 GTACCTGTGAAAGGGAGCAGTGG + Intergenic
1026538392 7:71259478-71259500 GGCACTTGGAAACGAAGCACTGG + Intronic
1027136466 7:75627858-75627880 GGCACAGGGAAAGGGCCCTGAGG + Intronic
1028047567 7:86142089-86142111 TACACTGGTAAAGGGAGCACTGG + Intergenic
1028141586 7:87280794-87280816 GGCACTGGGAAAATGACCACAGG - Intergenic
1028376323 7:90149249-90149271 GGGAGAGGGAAAGGGAGAAGAGG - Intergenic
1028739755 7:94260227-94260249 GACTTTGGGAAAGGGAGAAGAGG - Intergenic
1029540350 7:101179133-101179155 GACACTGGGGGAGGGAGGAGAGG + Intronic
1029823945 7:103170992-103171014 GGGAGAGGGAAAGGGAGAAGAGG + Intergenic
1030069938 7:105689656-105689678 GGCACGGGGAAGTGGAACAGAGG + Intronic
1030091251 7:105861083-105861105 GGCAAGGGGAAGGGGAGAAGGGG + Intronic
1030457620 7:109794232-109794254 GGCACTGGGGAAAGGACCACAGG + Intergenic
1031665726 7:124480568-124480590 GGCCCTGGGATGGGGAACAGCGG + Intergenic
1031852975 7:126888085-126888107 GTACCTGTGAAAGGGAGCAGTGG - Intronic
1032153262 7:129448134-129448156 GGCACTGGGGAAGTGACCACAGG + Intronic
1032635097 7:133698174-133698196 GGCACTGATACAGAGAGCAGGGG - Intronic
1033048498 7:137983349-137983371 GGCAGTGGGGAAGGGAAGAGAGG + Intronic
1033151081 7:138915565-138915587 GGCACTGTCACAGTGAGCAGAGG + Intronic
1033573676 7:142658849-142658871 GGCAGAGGGAAATGGGGCAGAGG + Intergenic
1034284529 7:149875793-149875815 TGGAATGGGAAAGAGAGCAGTGG + Intronic
1034375545 7:150640864-150640886 AGAACTGGGACAGGGTGCAGTGG + Intergenic
1034422078 7:150995671-150995693 GGGACGGGGAGAGGGAGGAGGGG - Intronic
1034562963 7:151893627-151893649 GATGCTGGGAAAGGGAGGAGTGG + Intergenic
1034724187 7:153320050-153320072 AGCCCTTGGAAAGAGAGCAGAGG + Intergenic
1035266197 7:157691488-157691510 GACCCTGGTAAAGTGAGCAGAGG - Intronic
1035395216 7:158530489-158530511 TGCACTGGGACAGGGAGCTCTGG + Intronic
1035547798 8:497134-497156 GGAACTGGGTAATGGGGCAGAGG + Intronic
1035570226 8:667701-667723 GGCACTGGTGCAGGGAGCCGGGG - Intronic
1035608796 8:947303-947325 GGCCCTGGGGACGGGGGCAGGGG + Intergenic
1035609987 8:955425-955447 GACACTGGGGCAGGCAGCAGTGG - Intergenic
1036180947 8:6585007-6585029 CGCACTGGGATGGGGATCAGAGG - Intronic
1036446848 8:8829080-8829102 GGAGCTGGGAAAGTGGGCAGGGG - Intronic
1036503667 8:9335956-9335978 GGCACTGGATTAGGAAGCAGTGG - Intergenic
1036788099 8:11701418-11701440 GCCGCTGGGAAGGGGGGCAGCGG - Intronic
1037564724 8:20108190-20108212 GGCAGTGGCAAAGGCAGGAGCGG - Intergenic
1039200082 8:35081619-35081641 GACACTGGGGATGGCAGCAGAGG - Intergenic
1039549056 8:38430096-38430118 GGCAGTGGGAATTGGAGCATGGG + Intronic
1039846700 8:41330549-41330571 GGCCCCAGGGAAGGGAGCAGGGG - Intergenic
1039876301 8:41589386-41589408 GGGACTGGGAGAGCCAGCAGGGG + Intronic
1040798936 8:51319966-51319988 AGGACTGGGACAGGGAGCCGGGG + Exonic
1040955036 8:52970850-52970872 GGCAAGGGGAAAGAGAGCAAAGG - Intergenic
1041762353 8:61380184-61380206 GGCACTGGGCTAGCAAGCAGGGG + Intronic
1042466481 8:69134351-69134373 GGAACTGGGAACTGGAGCAAAGG - Intergenic
1043413253 8:80021847-80021869 AGCCCTGGGTAAGGGTGCAGGGG - Intronic
1044630606 8:94274650-94274672 AGCCCTGGGACAGGGAGCAAGGG - Intergenic
1044633578 8:94300967-94300989 GGCACTGGGAAAATGACCACAGG + Intergenic
1045544992 8:103120535-103120557 AGCACTGGGATAGAGTGCAGAGG - Intergenic
1046790360 8:118315538-118315560 GGCACTGGGAATGGGATCATGGG + Intronic
1046987922 8:120411042-120411064 GGGAGTGGGAGAGGGAGGAGAGG - Intronic
1048193345 8:132310327-132310349 TGCAATGGAAAAGGGAGCTGGGG - Intronic
1048219080 8:132525023-132525045 AGAACCTGGAAAGGGAGCAGGGG + Intergenic
1048447420 8:134502310-134502332 GGCAGTGAGAAAGGGGTCAGGGG + Intronic
1049302256 8:141877813-141877835 GGCACTGGTACAGGCAGAAGAGG - Intergenic
1049467157 8:142756840-142756862 GCCCCTGGGAAAGGGAGCTGTGG + Intergenic
1049592956 8:143470968-143470990 GGCACTGGGGCACCGAGCAGGGG - Intronic
1049623966 8:143611909-143611931 GGCACTGAGAAAGGGGGCGACGG + Intergenic
1049684838 8:143935143-143935165 GGCTCTGGGGCAGGCAGCAGGGG + Intronic
1052003047 9:23311013-23311035 GGCAGAGGGAAAAGGAGAAGTGG + Intergenic
1052018147 9:23493332-23493354 GGCAATGTGGAAGGGAACAGGGG - Intergenic
1052348772 9:27436959-27436981 GGCTCGGGGAAAGGGAGTAGGGG + Intronic
1053017006 9:34667612-34667634 TGCTCTGGGAAAGGAAGGAGAGG + Intergenic
1053112663 9:35476297-35476319 GGCACTGGGACAGAGGACAGTGG - Intergenic
1053272766 9:36761583-36761605 GGCAGTGGGAATGAGGGCAGTGG + Intergenic
1053662087 9:40291172-40291194 GGAACTGGTAAATGGAGGAGTGG + Intronic
1054374214 9:64437412-64437434 GGAACTGGTAAATGGAGGAGTGG + Intergenic
1054522523 9:66085112-66085134 GGAACTGGTAAATGGAGGAGTGG - Intergenic
1055409831 9:76017184-76017206 GGAACTGGGAAATGGAGCCTGGG - Intronic
1055679279 9:78698217-78698239 GGAGCAGGGAAAGGGAGTAGGGG + Intergenic
1056106757 9:83354816-83354838 GGGATGGGAAAAGGGAGCAGAGG - Intronic
1056132996 9:83603610-83603632 GGCTCTGGACAAGGCAGCAGGGG + Intergenic
1056623585 9:88235683-88235705 GGCACTGGGAATTACAGCAGTGG + Intergenic
1056808501 9:89746334-89746356 GGCACTGGGAAAGGCAGCTCTGG + Intergenic
1056827352 9:89885516-89885538 GGTACAGGCAAAGAGAGCAGGGG - Intergenic
1056832719 9:89929805-89929827 GGGGCTGGGGAAGGGAGCAGGGG + Intergenic
1056832727 9:89929824-89929846 GGGGCTGGGGAAGGGAGCAGGGG + Intergenic
1056832734 9:89929843-89929865 GGGGCTGGGGAAAGGAGCAGGGG + Intergenic
1057259201 9:93575099-93575121 GGCACTGGGGAAGGGGGCGGGGG - Intergenic
1057333783 9:94140843-94140865 GGCCCTGGGATGGGGAGCAGAGG - Intergenic
1058105598 9:100967572-100967594 TCCACTGGCAGAGGGAGCAGGGG + Intergenic
1058375306 9:104316080-104316102 GGTAATGGGAGAGGGAGAAGGGG - Intergenic
1058387358 9:104453387-104453409 GTCACTGGGATAGGTAGAAGAGG - Intergenic
1058721733 9:107770288-107770310 GGCACTGGGAAAGGTAGTCTTGG + Intergenic
1059929214 9:119244355-119244377 GGCCATGGGAAGTGGAGCAGGGG + Intronic
1060184766 9:121557635-121557657 GGGGCTGGGAAAGGGGACAGAGG + Intergenic
1060408886 9:123386880-123386902 GGAACAGGGAGAGGGTGCAGGGG + Intronic
1060697494 9:125721916-125721938 GGCCCTGGGAAGGGGAGCTCAGG - Intergenic
1060957340 9:127651964-127651986 GGCTCTGGGAGAGGAAGAAGAGG + Intronic
1061007648 9:127937393-127937415 GGCTCGGGGAAGGTGAGCAGCGG + Intronic
1061734928 9:132647957-132647979 GGCATGGGGAAAGGGAGAAAGGG - Intronic
1062102201 9:134734153-134734175 GGCACCCGGGAAGGCAGCAGTGG + Intronic
1062122171 9:134839664-134839686 GGGACTGGGCCAGGGAGCAGAGG + Intronic
1062309962 9:135930246-135930268 GGGGCTGGGACAGGGAGCATGGG - Intergenic
1062325461 9:136010491-136010513 GGCCCTGGGCGGGGGAGCAGGGG + Exonic
1062474478 9:136720391-136720413 GGAGCTGGGGAAGGGAGCTGCGG - Intronic
1062482583 9:136759387-136759409 GGCCCTGGGTGAGGGGGCAGGGG - Intergenic
1062504473 9:136866063-136866085 GGGCCTGGGACAGGGCGCAGGGG - Intronic
1062551499 9:137089541-137089563 AGGGCTGGGAGAGGGAGCAGGGG + Intronic
1203656577 Un_KI270753v1:3424-3446 TGCACAGGGTAAGGGATCAGGGG - Intergenic
1185537357 X:872893-872915 TGGACAGGGAAAGGGAGGAGAGG - Intergenic
1186721684 X:12311105-12311127 GGCAGGGGGAAAGGGCGCAGAGG + Intronic
1187047082 X:15657285-15657307 GGCACTGGGGCTGGGTGCAGTGG - Intronic
1187074057 X:15916462-15916484 GGAAGTGGGAAAGGGAGTTGGGG - Intergenic
1187457258 X:19453027-19453049 GGGACTGGGGAAGGGAGCAACGG + Intronic
1187939329 X:24365991-24366013 GGGACTGGGCAAGGGAGAATGGG - Intergenic
1188156355 X:26748086-26748108 GGCACTGAGAAGCGGAGCTGGGG + Intergenic
1188236789 X:27741335-27741357 GGCTCTGGGGAGGGGAGGAGAGG - Intronic
1189108416 X:38260484-38260506 GGCAGAGGGAAACGGAGGAGTGG + Intronic
1189141498 X:38611874-38611896 GCAACTGGGAAAGGGAACAGAGG - Intronic
1189425472 X:40896523-40896545 GCCAGTGGGAGAGGGAGCAAAGG + Intergenic
1190297890 X:49039206-49039228 AGGACTGGGGAAGGGAGCCGCGG + Exonic
1190584205 X:51921660-51921682 GGCACTGGAAAAGAAACCAGCGG - Intergenic
1190879045 X:54479678-54479700 GGGGTGGGGAAAGGGAGCAGAGG + Intronic
1191759211 X:64628735-64628757 GGCACTGGGGAAGTGACCACAGG - Intergenic
1192100372 X:68258009-68258031 GGCACCGGGATAGGGAGAAGGGG + Intronic
1192269640 X:69566654-69566676 TGCACTGGGATAGGGAGTACTGG + Intergenic
1192478655 X:71466077-71466099 GGCATTGGGATGGGGAGGAGGGG + Intronic
1192491069 X:71578012-71578034 ACCACTGGGAAAGGGCGCGGGGG - Intergenic
1192559169 X:72114321-72114343 GGGAGTGGGAAAGGTAGCAGCGG + Intergenic
1192661715 X:73048942-73048964 GGCACTGGGAAAATGACCAGAGG + Intergenic
1192990093 X:76442895-76442917 GACACTGAGAAAGGTAGCACGGG - Intergenic
1193689214 X:84619957-84619979 GGCTCTGGGGAAGGGAAAAGGGG - Intergenic
1194395902 X:93385900-93385922 GTTGCTGGGAAATGGAGCAGAGG - Intergenic
1194443997 X:93965529-93965551 TGCACCGGGGAGGGGAGCAGAGG + Intergenic
1194723708 X:97370217-97370239 GGGACAGGGAAAGGAAGAAGAGG - Intronic
1195670019 X:107461852-107461874 GGCATTGGGAAGTGGGGCAGAGG - Intergenic
1198481327 X:137044132-137044154 GGCATAGGGACAGGGAACAGAGG - Intergenic
1198806683 X:140501490-140501512 GGCCCTGGGATTGGGAGAAGGGG + Intergenic
1198956931 X:142143114-142143136 CACACTGGGAAAGGTAGGAGGGG + Intergenic
1198975086 X:142327415-142327437 GGCACTGGGGTAGGAAGTAGGGG + Intergenic
1199243504 X:145575438-145575460 GGCACTGCCTAATGGAGCAGTGG + Intergenic
1199993585 X:153004584-153004606 GGCACTGGGTAGTGGAGCTGTGG - Intergenic
1200075116 X:153546947-153546969 GCCACTGGGAAGAGGAGCCGTGG + Intronic
1200144197 X:153917922-153917944 GGCTCTGGGGGAGGGCGCAGAGG + Intronic
1200397476 X:155999620-155999642 GGTGCTGGAAATGGGAGCAGGGG - Intronic
1201751425 Y:17436213-17436235 GGCACAGGAAAACAGAGCAGTGG + Intergenic
1202068564 Y:20966818-20966840 GGCACCATGAAAGGGAACAGAGG + Intergenic