ID: 1071573046

View in Genome Browser
Species Human (GRCh38)
Location 10:86708439-86708461
Sequence CAGGGACTGGCACTGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573046_1071573060 28 Left 1071573046 10:86708439-86708461 CCCTTTCCCAGTGCCAGTCCCTG 0: 1
1: 0
2: 3
3: 39
4: 449
Right 1071573060 10:86708490-86708512 GGCAAAGTGTCCTCCAATGATGG No data
1071573046_1071573056 6 Left 1071573046 10:86708439-86708461 CCCTTTCCCAGTGCCAGTCCCTG 0: 1
1: 0
2: 3
3: 39
4: 449
Right 1071573056 10:86708468-86708490 GACCTGTAGCTCCTGGGCTGTGG No data
1071573046_1071573054 -1 Left 1071573046 10:86708439-86708461 CCCTTTCCCAGTGCCAGTCCCTG 0: 1
1: 0
2: 3
3: 39
4: 449
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573046_1071573055 0 Left 1071573046 10:86708439-86708461 CCCTTTCCCAGTGCCAGTCCCTG 0: 1
1: 0
2: 3
3: 39
4: 449
Right 1071573055 10:86708462-86708484 ACTCAGGACCTGTAGCTCCTGGG No data
1071573046_1071573057 7 Left 1071573046 10:86708439-86708461 CCCTTTCCCAGTGCCAGTCCCTG 0: 1
1: 0
2: 3
3: 39
4: 449
Right 1071573057 10:86708469-86708491 ACCTGTAGCTCCTGGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573046 Original CRISPR CAGGGACTGGCACTGGGAAA GGG (reversed) Intronic
900115169 1:1025171-1025193 CGGGGCCTGGCACAGGGACAGGG + Intronic
902240794 1:15088027-15088049 CAGAGGCTGGCACTGGAATATGG - Intronic
903045509 1:20561682-20561704 CAGGGACTGGGAGTAGGAAATGG - Intergenic
903350043 1:22711558-22711580 CAGGGACTGGCAGAGTGGAAGGG + Intronic
904003921 1:27353518-27353540 CTGGGACAGGCCCTGGGAGATGG + Intronic
904309770 1:29621226-29621248 GTGGGACTGGCAGTGGGAATGGG + Intergenic
905648295 1:39639733-39639755 CAGGAAAGGGCCCTGGGAAAGGG - Exonic
905867574 1:41384489-41384511 GAGGAACTGGCATTGGGAAGGGG + Intergenic
905887608 1:41499934-41499956 CAGGGCCTGGCACAGAGCAACGG - Intergenic
905889386 1:41510091-41510113 CAGAGGCTGGCAGAGGGAAAGGG - Exonic
906762090 1:48384332-48384354 CAGGGACAGGGACAGGGACAGGG + Intronic
906762092 1:48384338-48384360 CAGGGACAGGGACAGGGAGAGGG + Intronic
907137972 1:52157239-52157261 CAGGTCCAGGAACTGGGAAAGGG + Intronic
907249761 1:53130351-53130373 CAGGGCTTGGCATGGGGAAAGGG + Intronic
907417809 1:54326559-54326581 CAGCTCCTGGCACTGGGAAAGGG + Intronic
908071374 1:60464085-60464107 CATGGACTGGCAATGGAGAAGGG + Intergenic
910058719 1:83063033-83063055 CAGGGACTAGCAGTCCGAAATGG + Intergenic
910329362 1:86052568-86052590 CAGGGACTGGGAGTGGAGAACGG + Intronic
911583315 1:99660264-99660286 CAGGGAATGGCACAGTGAATTGG + Intronic
911679584 1:100699697-100699719 CAGGCCTTGGCACAGGGAAAGGG - Intergenic
912883747 1:113447276-113447298 CAGGGACTGGCATCTGGCAAGGG + Intronic
913034046 1:114943760-114943782 CAGGGACAGGAATTGGGAAGAGG - Intronic
913305178 1:117422203-117422225 CAGGGGCTGGCAATGGGATAGGG - Intronic
913418310 1:118636327-118636349 CAGCCAGTGGAACTGGGAAAGGG - Intergenic
915216731 1:154345388-154345410 CAGGAACTTGAACTGGGAGAAGG - Exonic
915466588 1:156102052-156102074 GAGGGCCTGGCACTGGGCCAAGG - Intronic
915916667 1:159944690-159944712 CAGGGCCTGGCACTGCCAAGTGG + Intronic
915927713 1:160036590-160036612 CAGGGACAGGAACTAGGGAAGGG - Intergenic
916213513 1:162376987-162377009 CAGGGCCTGCCACTGGGCAATGG - Intronic
916520686 1:165561067-165561089 CAGTGACTGCGACTGGGAAGAGG + Intronic
918255525 1:182742753-182742775 CAGGGACAGGGACAGGGACAGGG + Intergenic
918255527 1:182742759-182742781 CAGGGACAGGGACAGGGAGAGGG + Intergenic
918514408 1:185346538-185346560 CTGGGACTGGAACTGAGAACTGG - Intergenic
921166497 1:212511673-212511695 CACTGTCTGGCACTGGCAAAGGG + Intergenic
921700881 1:218267257-218267279 CAGGGGCTGGCATTTGGCAAGGG + Intergenic
922593875 1:226798932-226798954 CAGGGACTAGCAGTGGGATGTGG + Intergenic
923319453 1:232816234-232816256 GAGGGACTGGCACTTAGAGAGGG + Intergenic
923491815 1:234490937-234490959 TAGGTGCTGGCACAGGGAAAGGG - Intergenic
923949028 1:238926341-238926363 CTGGGACTTGCGCTGGGGAAGGG - Intergenic
924473916 1:244367159-244367181 CAGGGGCTGGAGCTGGGAGAAGG + Intronic
1062843192 10:686727-686749 CAGGGACAGGCAGTGGAAGAAGG + Intronic
1063665198 10:8056456-8056478 AAGGCACTAGCTCTGGGAAAAGG - Intronic
1063720110 10:8571467-8571489 CAGGGACTGGGAGAGGGGAAGGG - Intergenic
1063752076 10:8961159-8961181 CAGGGAATGGCACCAGGAAGAGG + Intergenic
1066759704 10:38739729-38739751 CAGGGACAGGGACAGGGACAGGG - Intergenic
1067524751 10:47031564-47031586 CAGGGAATGACAGTGGGCAAGGG + Intergenic
1068383331 10:56289179-56289201 CAAGGACATACACTGGGAAAAGG - Intergenic
1070191107 10:74112682-74112704 GAGGGAATGGGAGTGGGAAATGG + Intronic
1070737298 10:78871999-78872021 CAGGTAGTGGCCCTGGGAAGGGG - Intergenic
1070770486 10:79079620-79079642 CAGGGCCTGGCACTGGGGCCGGG + Intronic
1070851183 10:79562630-79562652 CAGGGCCTGGCAGTGTGAAGAGG - Intergenic
1070856019 10:79608603-79608625 CAAGGACTGGCAGTGTGAAGAGG + Intergenic
1071573046 10:86708439-86708461 CAGGGACTGGCACTGGGAAAGGG - Intronic
1071849833 10:89557782-89557804 CAGGGACTGGGAGAGGGACAAGG + Intergenic
1073028066 10:100502871-100502893 GGGGTACTGGCACTGGGAATGGG - Intronic
1073048494 10:100653778-100653800 CAGGGAATGGCTGTGGGAACGGG - Intergenic
1073647817 10:105324340-105324362 CTGGGAAAGGCAATGGGAAATGG - Intergenic
1073939558 10:108680008-108680030 GAGGGACGTGCAGTGGGAAACGG - Intergenic
1074056945 10:109931013-109931035 CAGGGACTGGCCCCATGAAATGG + Intergenic
1074094348 10:110296593-110296615 CAGGGAGTTGCAATGGGAATGGG - Intronic
1074866476 10:117546954-117546976 CAGGGACTGGCACTGGGCTGTGG + Intronic
1075258804 10:120945511-120945533 CAGGCCCTGGCCCTGGGGAAGGG - Intergenic
1075709659 10:124523827-124523849 CAGGGAAGGGCACCGGGAACAGG + Intronic
1076332804 10:129683227-129683249 CAGGCACTTGCACTGGAAATGGG - Intronic
1076393504 10:130121438-130121460 CAGAAAATGCCACTGGGAAATGG - Intergenic
1077084109 11:739552-739574 CAGGGACTGGAGGAGGGAAATGG - Intergenic
1077474563 11:2780247-2780269 CAGGGACAGACCCTAGGAAAGGG + Intronic
1078872304 11:15359757-15359779 CAGGCACTGGCACCGGCAGATGG - Intergenic
1078874026 11:15376082-15376104 CAGGGAATGGTCATGGGAAAAGG + Intergenic
1080447822 11:32353483-32353505 CTGGGGCTGCCACTGAGAAATGG - Intergenic
1081165590 11:39805232-39805254 CAGGGAATGGCACTGGCCAATGG - Intergenic
1081252944 11:40857991-40858013 CAGGGACAGGGACAGGGACAAGG + Intronic
1083780592 11:64915449-64915471 CAGGGACTGAGACTGGGATGCGG + Intronic
1084271680 11:68032594-68032616 CAGGGACTGGCAATAGGCACAGG - Intronic
1084672584 11:70616017-70616039 CAGAGCCTGCCTCTGGGAAATGG + Intronic
1084932406 11:72567550-72567572 CAGGGACTGGGACTGGTCCATGG + Intergenic
1085022295 11:73217422-73217444 CAGGGAATGGAACTGGGTCAAGG + Intergenic
1085296922 11:75436566-75436588 CAGGGACTGGCAAAGAGCAAGGG + Intronic
1085346743 11:75773082-75773104 CAGTGCCTGGCACTGGTAATAGG + Intronic
1087018227 11:93575363-93575385 ACGGGAATGGCATTGGGAAAGGG + Intergenic
1087451931 11:98334710-98334732 CAGGGACTGGCAGGGGCAATGGG - Intergenic
1088882779 11:113984518-113984540 CAGGGCCTGGCACAGAGGAAGGG + Intronic
1089209429 11:116790422-116790444 CAGGCACTGGGACTGAGGAAGGG - Exonic
1089451674 11:118602410-118602432 CAGGCACTGGCAGTGGGAAGAGG + Exonic
1090043338 11:123309880-123309902 CAGGCACGGGCAGTGGGGAAAGG + Intergenic
1090758582 11:129816033-129816055 CAGGGAGGGGCTCTGGGACAGGG + Intronic
1090840853 11:130486667-130486689 CAGGGCCTGGAACTGGGGATTGG - Intergenic
1090938870 11:131370309-131370331 CAGGGAATGCCAGGGGGAAAGGG + Intergenic
1091380723 12:56778-56800 CAGAGAGTGGGACTGGGGAAGGG + Intergenic
1091950809 12:4591504-4591526 CAAGGAGTGGCTCTGGGCAAGGG + Intronic
1092308822 12:7330651-7330673 CATACACTAGCACTGGGAAAAGG + Intergenic
1092674403 12:10900314-10900336 AAGGGAAAGACACTGGGAAAAGG + Intronic
1094731763 12:33184732-33184754 CAGGACCTTGCACTGGGAGATGG - Intergenic
1095986987 12:48005246-48005268 CAGGGGCAGGCCCTGGGAAGGGG + Intergenic
1096183889 12:49566040-49566062 GAGGGCCAGGAACTGGGAAAGGG - Intronic
1096205392 12:49717345-49717367 CAGGGGCAGGTACTGGGCAAGGG - Intronic
1096807279 12:54148566-54148588 CAGGGACTGGCAGAGGGAGAGGG - Intergenic
1096841048 12:54379278-54379300 CAGGGACAGGGACAGGGACAGGG + Intronic
1096971567 12:55670575-55670597 CTGGGACTGGGACTGGGACTGGG - Intergenic
1097185324 12:57193516-57193538 CAGCCACAGGCACAGGGAAAGGG - Intronic
1097256484 12:57679673-57679695 CAGGGACTGGGGTAGGGAAAGGG + Intergenic
1099285320 12:80708699-80708721 CAGGGACGCGCCCTGCGAAAAGG + Intronic
1101123212 12:101605003-101605025 CAGGGCCTGGGACTTGGGAAAGG - Intronic
1101804088 12:108048257-108048279 CAGGGAGAGTTACTGGGAAATGG + Intergenic
1102976383 12:117209795-117209817 CAGGGACTGGCAGTGGGCCAAGG + Exonic
1103094202 12:118119674-118119696 CAGGGCCCGGCACTGGCAAGTGG + Intronic
1103414622 12:120735997-120736019 CAGGGACAGGGACGGGGACAGGG - Intronic
1103414627 12:120736009-120736031 CAGGGACGGGGACAGGGACAGGG - Intronic
1103414629 12:120736015-120736037 CAGGGACAGGGACGGGGACAGGG - Intronic
1104725812 12:131075020-131075042 CGGGGGCTGGCACTGGGTGAGGG + Intronic
1105786723 13:23757384-23757406 CACAGACTGGTACTGGGAACTGG - Intronic
1105977012 13:25481205-25481227 CAGGGACAGGGACAGGGACAGGG + Intronic
1106131799 13:26946907-26946929 CAGGGTCTGGGACAGGCAAAGGG + Intergenic
1107523504 13:41206304-41206326 AAGGGACTGGCACTGGCATCTGG - Intergenic
1107705849 13:43104187-43104209 GAGGGATTGGCAATGGGAAGGGG - Intronic
1108030397 13:46223255-46223277 CAAGAACTGACACTGGGGAAAGG - Intronic
1108136157 13:47363997-47364019 CAGGGACTGGTAGAAGGAAATGG - Intergenic
1108378617 13:49836593-49836615 AAGGAACAGGCACTGGGAAAAGG - Intergenic
1109607300 13:64713319-64713341 CAGGAACTTACACTGGGCAAAGG + Intergenic
1111738824 13:92176366-92176388 CAGGCACTGAGACTGGGACAAGG + Intronic
1111843024 13:93473435-93473457 CAGGCACTGGGAATGGGGAAAGG + Intronic
1113084917 13:106559094-106559116 CAGGGAGTGGTAAAGGGAAAAGG - Intronic
1114058371 14:18996393-18996415 CAGGGACTGGTACTGGTCTATGG - Intronic
1114104175 14:19405361-19405383 CAGGGACTGGTACTGGTCTATGG + Intronic
1114751851 14:25213174-25213196 CAAGGCCTGGCATTAGGAAAGGG - Intergenic
1114820671 14:26015195-26015217 CAAGAACATGCACTGGGAAAAGG + Intergenic
1116308583 14:43291355-43291377 CAGAGACTAGAGCTGGGAAAAGG + Intergenic
1117330638 14:54708520-54708542 CAGAGACTGGCAGAGAGAAAAGG + Intronic
1118746233 14:68775529-68775551 CAGGGACTGGCAGGTGGAATTGG - Intergenic
1119369576 14:74127896-74127918 GATGGACTGGCTGTGGGAAAGGG + Intronic
1119545575 14:75469232-75469254 CGGGGACTGGCTCTGGGGAGAGG - Intronic
1119722198 14:76898873-76898895 CAGGGACAGGGACAGGGAGAGGG + Intergenic
1119868692 14:77994533-77994555 CAGGGACAGGGACAGGGACAGGG + Intergenic
1120911685 14:89672634-89672656 CAAGGACTGGCAGTGGGACATGG - Intergenic
1121455426 14:94035822-94035844 CAGGGCCTGGCACGGAGAAGGGG - Intronic
1121870497 14:97402712-97402734 CAGGCACTGGCACTACAAAATGG - Intergenic
1122309927 14:100787997-100788019 CAGAGACTTGCATTAGGAAATGG - Intergenic
1122651833 14:103230667-103230689 CAGGGGCTGGCTCTGGGCTATGG - Intergenic
1122703274 14:103604651-103604673 CAGGGACTGGGAGTGGGAGCTGG - Intronic
1122892065 14:104736610-104736632 CGGGAACTGGCAAAGGGAAAGGG + Intronic
1122920047 14:104876303-104876325 CAGGGACGAGCACTGGGTGAAGG + Exonic
1122960560 14:105092030-105092052 CAGAGACCAGCACTGGGCAATGG + Intergenic
1124720871 15:32109939-32109961 CAGGAACTGGGAATGGGAATGGG - Intronic
1126578771 15:50222989-50223011 GTGAGACTGGCACTGGGAAATGG + Exonic
1127931108 15:63598053-63598075 CAAGGTCAGGCTCTGGGAAAAGG + Intronic
1128237144 15:66076007-66076029 CAGTGTCTGGCACATGGAAAGGG + Intronic
1128325385 15:66720720-66720742 CAGGGTCTAGCACGGGGAAGGGG + Intronic
1128372427 15:67050058-67050080 CAGGGACTGTCACTAAGACAGGG + Intergenic
1128495938 15:68198472-68198494 GAGGGACTGGCGCAGGGGAAGGG - Intronic
1128889535 15:71318338-71318360 CAGGGAATGGCACTAGGCATAGG + Intronic
1128964931 15:72049535-72049557 CATGGACTGGCACTGGTCCATGG - Intronic
1129118202 15:73378137-73378159 CAGGGACAGGCACTGCGATGGGG + Intergenic
1129149180 15:73676943-73676965 CAGAGTCTGGCACCAGGAAATGG - Intergenic
1129766819 15:78174796-78174818 CAGGAACTGGGACTGGCAGAAGG - Intronic
1130398073 15:83522012-83522034 GAGGAACAGGCACTGAGAAAGGG + Intronic
1132118313 15:99154555-99154577 CAGGGACTGGCATTTGGCAGGGG - Intronic
1132797520 16:1732592-1732614 CAGGGACTTGCCCTGAGAACGGG + Intronic
1134023638 16:10938755-10938777 CAGGGCCTGACCCTGGGAAGTGG - Intronic
1137036626 16:35574512-35574534 CAGAGACTGAGACTCGGAAATGG - Intergenic
1138667854 16:58586908-58586930 CAGGGACTGGCAGTGGGGAGGGG + Intronic
1138846250 16:60570394-60570416 CAGGGACTGGGGAGGGGAAATGG + Intergenic
1139378141 16:66513736-66513758 CAGGGGCTGCCATGGGGAAAAGG + Exonic
1139499341 16:67348885-67348907 CAGGCAAAGTCACTGGGAAAGGG - Intronic
1140045840 16:71440185-71440207 CAGGGACTGGCAAAGGGGAATGG + Intergenic
1140910399 16:79446096-79446118 CAGGGACGGGCAGAGGGGAAAGG + Intergenic
1141143817 16:81515122-81515144 GACGGTCTGGCACAGGGAAAAGG - Intronic
1141586375 16:85036310-85036332 CAGAGACTGCAAATGGGAAAGGG - Intronic
1142084470 16:88169388-88169410 CAGGGGCTGGCGCAGGGGAAGGG - Intergenic
1142872434 17:2829475-2829497 CAGGGCATGGCACTGGGAGGTGG - Intronic
1142901187 17:3012835-3012857 CTGAGAATGGCACTGGAAAATGG - Intronic
1143071234 17:4295397-4295419 GAGAGACTGGAACTGGCAAATGG - Intronic
1143155940 17:4836043-4836065 GGGGGACAGGCACTGAGAAAAGG - Intronic
1143387840 17:6542687-6542709 CACTGCCTGGCACTTGGAAATGG + Intronic
1146374335 17:32284264-32284286 CTGCGACTGGCAAAGGGAAAGGG - Intronic
1146928495 17:36761720-36761742 CAGGCACTGGCCCAGGGGAAAGG - Intergenic
1147131255 17:38410653-38410675 CAGGGCCTGGCACAGTTAAATGG + Intergenic
1147450683 17:40502039-40502061 CTGGGACAGGCACAGGGTAAGGG + Intergenic
1147656220 17:42092707-42092729 CAGGAAAAGGCACTGGGAACAGG - Intergenic
1148120367 17:45206324-45206346 CAGGCACTGGGCCTGTGAAAGGG - Intergenic
1148240582 17:45997237-45997259 CAGGGACAGGAATGGGGAAAGGG - Intronic
1148327300 17:46790579-46790601 GAGGGACTGGTACTGGGAATAGG - Intronic
1148355316 17:46971935-46971957 CAGGGCCTGGCTCTGAGGAAGGG + Intronic
1148441109 17:47711955-47711977 CAGGGAGTGGAAATGGGGAAGGG + Exonic
1149891053 17:60391366-60391388 CAGGCATAGGCTCTGGGAAAAGG + Intronic
1150146535 17:62774104-62774126 GAGGAAGTGTCACTGGGAAATGG + Intronic
1150575817 17:66430217-66430239 CAGGGACTTGAAATGGGGAAAGG - Intronic
1151464373 17:74275132-74275154 CAGGGACTGGCACATAGAAGGGG - Intronic
1152020698 17:77778902-77778924 CAGCAACAGGCACTGGGAAAGGG + Intergenic
1152467675 17:80475279-80475301 CTGGGGCTGTCTCTGGGAAAGGG - Intronic
1152605290 17:81286541-81286563 CGTGGACTGGCACAGAGAAAGGG + Intronic
1152648314 17:81480575-81480597 CAGGGGCTGGCATGGGGCAATGG - Intergenic
1152740644 17:82016965-82016987 CAGGGGCTGGCAATGGGGAAGGG - Exonic
1153818285 18:8809822-8809844 CAGGCACTGGGACTTGAAAAGGG + Intronic
1154001963 18:10489309-10489331 CAGAGACTGGGAAAGGGAAATGG + Exonic
1154415092 18:14172056-14172078 CAGGGACAGGGACAGGGACAGGG + Intergenic
1154415094 18:14172062-14172084 CAGGGACAGGGACAGGGACAGGG + Intergenic
1155022678 18:21910885-21910907 CTGGGACTGGCCCGGGCAAACGG - Intergenic
1155553107 18:26987697-26987719 AAGGTAATGGCACTGGGAAGTGG + Intronic
1156078830 18:33311614-33311636 CAGAGAGGGTCACTGGGAAAAGG + Intronic
1156088842 18:33440884-33440906 AAGGGAAAGGCACTGGGAGAAGG - Intronic
1156547554 18:37979835-37979857 CAGGGACTCGCACTTGAAAAAGG - Intergenic
1156944593 18:42814130-42814152 CAGCCAGAGGCACTGGGAAAAGG + Intronic
1157072460 18:44423954-44423976 CAGGGACTGGGAGTTGGAGAGGG - Intergenic
1157218534 18:45806778-45806800 CAGCCAGAGGCACTGGGAAAAGG + Intergenic
1158531076 18:58262281-58262303 CAGGGCCTGGCACTGGAATGTGG - Intronic
1158536837 18:58315865-58315887 CAGGGCCTGGCACTGGAATGTGG - Intronic
1158677004 18:59529313-59529335 CAGGCACTGGCAGGGGAAAATGG + Intronic
1158831975 18:61289682-61289704 CAGGATCCAGCACTGGGAAAGGG + Intergenic
1159319890 18:66833039-66833061 CAGAGACTGGCAAAGGAAAAGGG + Intergenic
1159457434 18:68678445-68678467 CAGGGACTGCAAAGGGGAAAGGG + Intronic
1159734704 18:72080680-72080702 CAGGACCATGCACTGGGAAAGGG + Intergenic
1161457759 19:4378066-4378088 CAGGGCCAGGCACAGGGACAGGG + Intronic
1162316416 19:9941239-9941261 CAGGGTCTGGCACTGGGCACAGG + Intergenic
1163514746 19:17756054-17756076 CAGGGCCTGCAACTGGGGAAGGG - Intronic
1164451516 19:28370072-28370094 CATGGACTGGGAGTGGGAAAGGG - Intergenic
1165060677 19:33203878-33203900 CAGGGACATGCAGAGGGAAAGGG + Intronic
1165077186 19:33286372-33286394 GAGGGACTGGCCCTGGGGACTGG + Intergenic
1165096648 19:33413362-33413384 CAGGACCTGGCACTGGGTGAAGG - Intronic
1165262996 19:34636821-34636843 CGGGGACTGGCTCTGGTAAGTGG - Intronic
1165610572 19:37148490-37148512 CAAGGGCTGGGAGTGGGAAAAGG + Exonic
1166133280 19:40759663-40759685 CATGGACTGGCTTTGGGACAGGG + Intronic
1166820264 19:45574949-45574971 CTGGAACTGGCACTGGGACTGGG - Intronic
1167267951 19:48492921-48492943 CAGGGCCTGGCAATGGGGCAGGG - Intronic
1167573480 19:50305459-50305481 CAGGGACAGGCAGAAGGAAACGG + Intronic
1168257200 19:55173523-55173545 CAGCGAGTGCCACTGGGCAATGG + Exonic
925047024 2:780301-780323 CAGAGCCTTCCACTGGGAAAAGG - Intergenic
925176546 2:1788539-1788561 CAGGGACAGGAACAGGGACAGGG + Intergenic
925176565 2:1788637-1788659 CAGGGACAGGGACAGGGACAGGG + Intergenic
925887307 2:8404010-8404032 GAGGGACTGGCATTGGGGCACGG - Intergenic
927445943 2:23161694-23161716 CAAGGCCTGGTACAGGGAAAGGG - Intergenic
928046628 2:27940805-27940827 CAGGGACTAGAACCGGGAACTGG + Intronic
928088218 2:28358892-28358914 CAGGGGCAGGCACAGGGGAAGGG - Intergenic
928089199 2:28363754-28363776 TAGGGACAGGGACTGGGAGAGGG - Intergenic
928239602 2:29575021-29575043 CAGGGACTTGCAGGAGGAAACGG - Intronic
928279320 2:29930214-29930236 CAGGGTTTGGGACTTGGAAAGGG - Intergenic
928312795 2:30224309-30224331 CAGGCAAAGGCACTGGGAGAGGG - Intergenic
928399167 2:30965563-30965585 TAGGGACTGGCACTGGGACTTGG + Intronic
929384425 2:41387482-41387504 CAGGGACTGGGGTTGGGAAAAGG + Intergenic
930141175 2:47952884-47952906 CAGTGCCTGGCACATGGAAAGGG - Intergenic
930770193 2:55122802-55122824 CAGGGACAGGCTCTGGGGATGGG - Intergenic
931571535 2:63673901-63673923 CAGCAACTGGAACTGGAAAATGG - Intronic
932493071 2:72133731-72133753 AAGGGGCTGGCACTGGGAGTGGG - Intronic
933251983 2:80039036-80039058 CAGGGAGTGGAGGTGGGAAAAGG + Intronic
933478741 2:82826088-82826110 CAAGGACTGACTCTGAGAAAAGG + Intergenic
934323020 2:91984068-91984090 CAGGGACAGGGACAGGGACAGGG - Intergenic
934323022 2:91984074-91984096 CAGGGACAGGGACAGGGACAGGG - Intergenic
935411886 2:102772586-102772608 CAGGGACTGGCTCATGGTAAGGG + Intronic
936471866 2:112805903-112805925 CAAGAAGAGGCACTGGGAAATGG - Intergenic
937353189 2:121180943-121180965 CAGGGACTGGGAGTGGGAAATGG + Intergenic
937836712 2:126478597-126478619 CATGGACTGGCACTGGTCCATGG - Intergenic
938196705 2:129334920-129334942 CAGTGACTGCCACTCAGAAAGGG - Intergenic
938573752 2:132585383-132585405 CAAGGACTGGGACTGGCAGAGGG - Intronic
939886219 2:147684833-147684855 GAGGGGCTGGCACTTGGGAATGG + Intergenic
940006973 2:149016871-149016893 CAGGCCCAGGCACTGGAAAATGG + Intronic
942594546 2:177580574-177580596 CAGGGCATGGCAGTGGGAGAAGG - Intergenic
943391679 2:187277486-187277508 CAAGAACTTACACTGGGAAAAGG + Intergenic
944617129 2:201472566-201472588 CAGGGACTGGGAGTGGGGATGGG + Intronic
945821874 2:214674470-214674492 CAGGGACTGGCCCTGAGCACTGG - Intergenic
946043575 2:216803105-216803127 CAGGGGATGGGAGTGGGAAAAGG + Intergenic
946744888 2:222835834-222835856 CAGGGAATGGCAATGAGAAAAGG - Intergenic
946820036 2:223619917-223619939 CAGGGACTGGCAGCGGGAGGGGG - Intergenic
947325005 2:228964365-228964387 CAGGTATTGGTACTGGGAAGTGG + Intronic
947712289 2:232323101-232323123 CAGGGGCTGGCACTGGAGAGAGG + Intronic
948777784 2:240298807-240298829 CAGGCACTGGCACTGTCTAAGGG + Intergenic
1169053445 20:2599917-2599939 CAGGGACACCCACTAGGAAAAGG + Intronic
1169218682 20:3808004-3808026 CTGGGCCTGGGCCTGGGAAAGGG + Intergenic
1169248295 20:4041404-4041426 CAGGGACAGCCAAAGGGAAAAGG - Intergenic
1171187060 20:23130112-23130134 CTGGGCCAGGAACTGGGAAATGG - Intergenic
1172847799 20:37940277-37940299 CAGGGCCTGGCACTAGGGAGGGG + Intronic
1173021721 20:39273058-39273080 CAGGGCCTGGCACAGGGCAGGGG + Intergenic
1173104865 20:40124247-40124269 CAGGGAGTGGTGCTGGGAGAGGG - Intergenic
1173513838 20:43650953-43650975 CAGGGCAGGGCACTGGGGAACGG + Intergenic
1173800808 20:45893217-45893239 CAGGGGCTGGCTGTGGGCAATGG + Exonic
1174206092 20:48840381-48840403 CAGTGTCTAGCACTAGGAAATGG - Intergenic
1174207370 20:48850492-48850514 CAGGGACAGGGACAGGGACAGGG + Intergenic
1174540389 20:51284876-51284898 CAGGGTCGGGCACTGGGCTAAGG - Intergenic
1175214910 20:57387061-57387083 CAGGCACTGGTACTGGGGAGAGG - Intergenic
1176091091 20:63318955-63318977 CAGGGACTGGCACTGGGGCTGGG + Intronic
1177183178 21:17765626-17765648 CAGGGAAAGGGACTGGGCAAAGG + Intergenic
1177438728 21:21089998-21090020 CAAGGACTGGGGGTGGGAAATGG + Intronic
1177877970 21:26657887-26657909 CAGTGACTGGAACTTGAAAAAGG - Intergenic
1178490770 21:33050020-33050042 CTGGGCCTGCTACTGGGAAATGG - Intergenic
1178499062 21:33110696-33110718 CAGGGACTGGCACTCTGACTTGG + Intergenic
1178928144 21:36792825-36792847 CAGGGAGAGGCTCTGGGGAAAGG + Intronic
1179886636 21:44316948-44316970 CAGGGGCAGGCCCTGGGAGAGGG + Intronic
1180476859 22:15719012-15719034 CAGGGACTGGTACTGGTCTATGG - Intronic
1180549773 22:16529962-16529984 CAGGGACAGGGACAGGGACAGGG - Intergenic
1180549775 22:16529968-16529990 CAGGGACAGGGACAGGGACAGGG - Intergenic
1180549777 22:16529974-16529996 CAGGGACAGGGACAGGGACAGGG - Intergenic
1180660602 22:17463705-17463727 CGGGGACGGGCACTGGGATAAGG + Intronic
1180929647 22:19580155-19580177 CAGTGACAGGAAATGGGAAAAGG - Intergenic
1180955318 22:19738825-19738847 CAGCGGCTGGCCCTGGGAATGGG - Intergenic
1182013761 22:27022062-27022084 CATGGACTGGTCCTGGGACAGGG + Intergenic
1182645453 22:31805293-31805315 GAGGCACTGGCACTGGCAGAGGG - Intronic
1182660735 22:31923438-31923460 AAGTGCCTGGCACTGAGAAATGG - Intergenic
1183371491 22:37435085-37435107 CAGGGGTGGGCACTGGGCAAAGG + Intergenic
1183590678 22:38777680-38777702 GTGGGACTGGGACTGGGATAAGG + Intronic
1184169631 22:42751295-42751317 CAGGGACAGGGACAGGGAGAGGG + Intergenic
1184191434 22:42897849-42897871 CAGGGAACAGCACTGGCAAAAGG + Intronic
1184252204 22:43267233-43267255 CAGGGCCTGGCACAGGGTTAGGG + Intronic
1184585687 22:45446567-45446589 CAGGGACAGGCACTGGACATTGG + Intergenic
1184694292 22:46131165-46131187 GAGGGACTGGTCCTGGGAATGGG - Intergenic
1184746980 22:46461844-46461866 CAGGCACTGGCTCGGGGAAGGGG + Intronic
1184963546 22:47949498-47949520 CAGGGAGGGTCACGGGGAAAGGG + Intergenic
1185347068 22:50315117-50315139 CTGGGCCTGGCCCTGGGAATGGG + Intronic
950100818 3:10355628-10355650 CAGGCACAGACTCTGGGAAAGGG - Intronic
951510000 3:23489731-23489753 CACGGACTGGTACTGGGAGTGGG + Intronic
952518097 3:34126007-34126029 CAGAGATTAGCTCTGGGAAAGGG - Intergenic
952749699 3:36815375-36815397 CAGACACTAGCACTGGGCAAAGG + Intergenic
952863274 3:37832696-37832718 CCAGGACTGGCAGTGGGGAAGGG + Intergenic
953495092 3:43379000-43379022 CAGGGACTGCCACTCAGGAAGGG - Intronic
953920398 3:46947543-46947565 CAGAGACTGGCAGGGGGAAAGGG + Intronic
954385159 3:50240300-50240322 CAGTGCCTGGCCCTGGCAAATGG - Intronic
954554468 3:51507116-51507138 CAGGGCCAGGCACAGGGCAAGGG - Intergenic
955403313 3:58609064-58609086 CAGGGCCTGGTCATGGGAAAGGG + Intronic
955560171 3:60180421-60180443 CAGGGACTGGGATTGGGATGAGG - Intronic
955993860 3:64657790-64657812 CAGTGGCTGCCACTGGGAAGGGG + Intronic
956784987 3:72635050-72635072 CAAGGACTGAAACTGGAAAAGGG + Intergenic
956841239 3:73142173-73142195 CAGGGGCTGGCCTTGGGAAAAGG - Intergenic
957971647 3:87390332-87390354 CAGCCAGAGGCACTGGGAAAAGG + Intergenic
959599092 3:108159115-108159137 CAGGGACTGGGAATGGGACTGGG - Intergenic
960310558 3:116111297-116111319 CAGGCACTGTCACTGAGAAATGG + Intronic
960570284 3:119178896-119178918 TAGGGGCTGGCAGTGGGAATTGG + Intronic
961409555 3:126708825-126708847 CTGGGACTGGGAGTGGGAATGGG - Intronic
961715771 3:128856484-128856506 CAGTGACTGGCATTGGGCCAAGG + Intergenic
962814652 3:138987374-138987396 CAGGGACCAGGGCTGGGAAAGGG + Intergenic
963452445 3:145500841-145500863 CAGGGACTGAGAGTGAGAAAAGG + Intergenic
967299624 3:188000386-188000408 CAGGGCCTGGAACAGAGAAATGG - Intergenic
967971750 3:195004516-195004538 CAGGGCCTGGCACAAGGAAAGGG + Intergenic
968638040 4:1692670-1692692 CAGTGAGTGGCGCTGGGTAAAGG - Intergenic
968709055 4:2099353-2099375 CAGGGACTTGCACTGTCAACAGG - Intronic
968716810 4:2166279-2166301 CAAGGCCTTGCAATGGGAAAAGG - Intronic
968729967 4:2264989-2265011 CAGGTCCTGGCTCTGGGGAAGGG - Intergenic
969080469 4:4613941-4613963 CATGGCCTGGCCCTGGGAATGGG + Intergenic
970228303 4:13882407-13882429 GAGGGAGTGGCCCTGGAAAAGGG + Intergenic
971192754 4:24443399-24443421 CTGGCTCTGGCACTGGGGAAGGG + Intergenic
973767563 4:54177112-54177134 CAGGGACTGACAATGGGCAGGGG + Intronic
974170076 4:58255126-58255148 CAGGGACTTGGATGGGGAAAAGG - Intergenic
974286543 4:59876403-59876425 AGTGGAATGGCACTGGGAAAAGG + Intergenic
974850691 4:67402224-67402246 AAGGGACTGGCAATTAGAAAAGG + Intergenic
975649399 4:76577479-76577501 CAGGGACTGGTATTGGAAGATGG + Intronic
976963186 4:91003801-91003823 CAGCCAGAGGCACTGGGAAAAGG - Intronic
978009243 4:103658772-103658794 CATGGACTGGCAGTGGGTGAGGG + Intronic
982105699 4:152010161-152010183 CAGGAACTGGGAATGAGAAAAGG + Intergenic
982268909 4:153566946-153566968 CAGGGACAGGTGCTGGGCAAAGG + Intronic
983974798 4:173920834-173920856 GAGGGACTGGGAGTGGAAAAAGG + Intergenic
984610294 4:181829713-181829735 TAGGGGCTGGCACTGGGACATGG - Intergenic
984650455 4:182264588-182264610 CCTGGACCGCCACTGGGAAAGGG - Intronic
984731724 4:183074861-183074883 CAAGGAGTGGCACTGGGCATTGG + Intergenic
986332225 5:6726139-6726161 CAGGGCCTGGCCCTCGGTAAGGG - Intronic
986450567 5:7859708-7859730 CAGTGCCTGGCACTGAGAAGGGG + Intronic
986476065 5:8134782-8134804 CAGGGGCTGGCACTGGGACTTGG - Intergenic
987277177 5:16374463-16374485 CAGAGAGTTGCACTGGGGAAGGG - Intergenic
991269869 5:64767410-64767432 CAGGCACTGGTACTGGGCATTGG - Intronic
991423151 5:66462245-66462267 CAGGGACTGTCACCAGAAAAAGG - Intergenic
992945690 5:81807846-81807868 CAGGAACTTGCACTGGGGAAAGG + Intergenic
993602232 5:89941437-89941459 CAGAGACTCTCAGTGGGAAAAGG + Intergenic
994632658 5:102305228-102305250 CAGGGACTAGTACTGGGCCATGG - Intergenic
994819784 5:104634523-104634545 CATGGACTGGTAGTGGGAAGTGG + Intergenic
995216920 5:109605957-109605979 CAGGGTGAGGCACGGGGAAAGGG + Intergenic
995803338 5:116023584-116023606 AAGTCACTGGCACTGGGAAGGGG + Intronic
995981810 5:118113427-118113449 CAGGGACAGGGACAGGGACAGGG - Intergenic
995981812 5:118113433-118113455 CAGGGACAGGGACAGGGACAGGG - Intergenic
997530635 5:134579323-134579345 CAGGGCCTGGGACAGGGAAGGGG - Exonic
998250589 5:140549513-140549535 CAGGGGCTGGAACTGGGGAATGG + Exonic
999408096 5:151324982-151325004 AAGGGAAGGGCACTGGGAGATGG - Intronic
999593207 5:153171894-153171916 CAGGCACTGGCACAGGAACAGGG + Intergenic
999727897 5:154452239-154452261 CAGGGAGGGGCAGAGGGAAAGGG - Intronic
1000371684 5:160542556-160542578 CAGGAAATGGAACTGGGAAGAGG - Intergenic
1001491907 5:172161959-172161981 CAATGACTGGCTCTGGAAAATGG - Intronic
1002026824 5:176401422-176401444 CATGGGCTGGCACAGAGAAAGGG - Intronic
1002201167 5:177529262-177529284 CACGGGCTGGCAGTGGGAGAAGG + Intronic
1002204552 5:177553956-177553978 CTGGGACTGGGACTGGGACTGGG - Intronic
1002573061 5:180154990-180155012 CAGGTGCTGGCACTGGGAGCTGG + Intronic
1003186140 6:3832487-3832509 CAGGGACAGGCAGTGAGAAGAGG - Intergenic
1003595775 6:7472954-7472976 GTGGGACAGGCACTGGGAACAGG - Intergenic
1003763300 6:9207667-9207689 CAGGAAATGGGACTGGGATATGG + Intergenic
1005262160 6:24072447-24072469 CTTGGCATGGCACTGGGAAAGGG - Intergenic
1006320180 6:33315471-33315493 GAGGGACTGGCAGTGGGGACGGG - Exonic
1006333027 6:33405643-33405665 TGGGCACTGGAACTGGGAAATGG + Intronic
1006550643 6:34820405-34820427 CAGTAACTGACACTGGGAGAGGG - Intronic
1006668136 6:35712513-35712535 TTGGGCCTGGCACTAGGAAAGGG + Intronic
1006678410 6:35779728-35779750 CAGGGGCTGGGTCTGGGAAAGGG + Intergenic
1006952112 6:37831385-37831407 AAAGGACTGGCTCTGGAAAATGG - Intronic
1007334229 6:41140217-41140239 CAGGGCCTAGCACTAGGAAGAGG - Intergenic
1007504281 6:42322965-42322987 CAGAGAATGGCACTGGGAGGGGG + Intronic
1008528697 6:52434259-52434281 CAGCCAGAGGCACTGGGAAAAGG - Intronic
1008631935 6:53370430-53370452 CAGGGACCGGCTGTGGGAGAAGG + Intergenic
1008819533 6:55613765-55613787 CAGGGCCTGCCAGTGGGACAAGG + Intergenic
1011148822 6:84245597-84245619 CAGGGACAGGGACAGGGAGAGGG + Intergenic
1011425188 6:87220575-87220597 CAGAAACTGACAATGGGAAAAGG - Intronic
1011909287 6:92415531-92415553 CAGGGAGTTGGACTGGGAGAAGG + Intergenic
1011954910 6:93015159-93015181 CAGGGAAAAGCACTGGGAAAAGG + Intergenic
1013228596 6:108140184-108140206 CAGGGGCTGGTATGGGGAAATGG + Intronic
1016349943 6:143156026-143156048 AAGGGAGTGGTACTGGGACAGGG + Intronic
1016566247 6:145458208-145458230 CAAGGATTGGCACTGAGGAATGG - Intergenic
1017981722 6:159406660-159406682 CAGAGACTTGCACTGGGGAGAGG + Intergenic
1018302659 6:162419781-162419803 CAGGGACAGGGACAGGGACAGGG + Intronic
1020157117 7:5736113-5736135 CAGGGACAGGGACAGGGAGAGGG - Intronic
1020488494 7:8749195-8749217 CAGTGGCTGGCATTTGGAAAGGG - Intronic
1022137925 7:27466620-27466642 CAGGGACAGGGACAGGGACAGGG + Intergenic
1022137927 7:27466626-27466648 CAGGGACAGGGACAGGGACAGGG + Intergenic
1022137929 7:27466632-27466654 CAGGGACAGGGACAGGGACAGGG + Intergenic
1022137931 7:27466638-27466660 CAGGGACAGGGACAGGGACAGGG + Intergenic
1022137933 7:27466644-27466666 CAGGGACAGGGACAGGGACAGGG + Intergenic
1022137935 7:27466650-27466672 CAGGGACAGGGACAGGGATAGGG + Intergenic
1022274703 7:28843708-28843730 CAGAGCTTGGCACTGAGAAAAGG + Intergenic
1022536409 7:31101371-31101393 CAGGGACAAGTACTTGGAAATGG + Intronic
1022632407 7:32097743-32097765 CTGAGACTCACACTGGGAAATGG + Intronic
1023784537 7:43693006-43693028 CAGGGGCTAGGACTGGGAAATGG + Intronic
1024231367 7:47366453-47366475 CCGGGCCAGGCACTGGGATAGGG + Intronic
1024475366 7:49803269-49803291 CAGGGGCTCTCACTGGGAATAGG - Intronic
1024742791 7:52372981-52373003 CAAGGGCTGGCACTGGGAGAAGG - Intergenic
1026980927 7:74526218-74526240 CAGGAACTGACATTTGGAAAAGG - Intronic
1027051892 7:75025867-75025889 CAGGGACAGGCAGTGGGAATCGG + Intergenic
1027977316 7:85175306-85175328 CAGAGACTGGGGCTGGGATAGGG + Intronic
1029104756 7:98165995-98166017 CAGGGCCGGGCACTGGAACAGGG - Intronic
1031197268 7:118631680-118631702 CAGGGACTGTCTCTGACAAAAGG + Intergenic
1031769670 7:125828326-125828348 CAGAGAATGGCACTGAGTAAGGG + Intergenic
1033030473 7:137821025-137821047 GAGGGACTGTCACTGGGGAGAGG - Intronic
1033097382 7:138442743-138442765 CAGGGACAGGGACAGGGAAGTGG - Intergenic
1033240545 7:139675769-139675791 CATGAACTGGGACTGGGAGAAGG + Intronic
1034042450 7:147893883-147893905 CAGGGACTGGAAATGGAAACAGG - Intronic
1034127748 7:148689025-148689047 CAAGAACAGACACTGGGAAAAGG + Intergenic
1034350011 7:150409396-150409418 CAAGGTCTGGCAGTGAGAAAGGG + Intronic
1034385660 7:150738586-150738608 GAGGGTCTGGCTCAGGGAAAAGG - Intronic
1034443422 7:151099650-151099672 CGGGGACTGGCACCGGGACCGGG + Intronic
1034738136 7:153447781-153447803 CAGGCATTTGCACTGGGACAGGG - Intergenic
1035481735 7:159192401-159192423 CAGCGACTGGCCCTGGCACAAGG - Intergenic
1036030237 8:4962948-4962970 CATGGGTTGGCGCTGGGAAAAGG + Intronic
1038421366 8:27436108-27436130 CAGGGACTGGGCTGGGGAAATGG - Intronic
1038745060 8:30247906-30247928 CAGGGACAGGGACAGGGACAGGG + Intergenic
1038745062 8:30247912-30247934 CAGGGACAGGGACAGGGACAGGG + Intergenic
1039098221 8:33910498-33910520 CAAGAACTTACACTGGGAAAAGG + Intergenic
1039573886 8:38608292-38608314 CAGGGACATGCTCTGGGAGATGG + Intergenic
1039905293 8:41781852-41781874 CAGGGGCTGGTACTAGGAGAGGG + Intronic
1040043694 8:42940501-42940523 CAGGGACAGGGACAGGGACAGGG + Intronic
1040043696 8:42940507-42940529 CAGGGACAGGGACAGGGAGAGGG + Intronic
1042993846 8:74671153-74671175 CAGGGAAAGGAAGTGGGAAAAGG + Intronic
1043276321 8:78399625-78399647 CAGTGACTGACTCTAGGAAAGGG - Intergenic
1044919027 8:97148382-97148404 CAGGGAATGGCAGTAGGCAAGGG - Intronic
1044932307 8:97261728-97261750 CAGGAACAGGCAATAGGAAAGGG - Intergenic
1045298040 8:100889316-100889338 CAGGGGCTGGCCCAGGGGAATGG + Intergenic
1045477794 8:102568170-102568192 CAGGGACTGGCCCTGGGCTTTGG + Intergenic
1045495002 8:102700683-102700705 AAGGGACTGGGCCAGGGAAAGGG + Intergenic
1046452468 8:114412022-114412044 CAGGAACTGGCGTTGGGGAATGG - Intergenic
1047101410 8:121680316-121680338 GAGGCAATGGCAGTGGGAAAAGG - Intergenic
1049144222 8:140986036-140986058 CAGGGACTTGCACTGGTACGTGG - Intronic
1049411721 8:142476597-142476619 CAGGGACTGGCTCCGGGAGCTGG - Exonic
1049460163 8:142723310-142723332 GAAGGAGGGGCACTGGGAAAGGG + Intergenic
1049661968 8:143823575-143823597 CAGGGGGTGGGACTGGGACATGG - Intronic
1050059343 9:1688857-1688879 CAGGGAGGGACACAGGGAAATGG - Intergenic
1051194996 9:14554450-14554472 CAGAGACTGGACTTGGGAAAAGG + Intergenic
1055409833 9:76017192-76017214 CGTGGGCTGGAACTGGGAAATGG - Intronic
1056923729 9:90814602-90814624 CAAGGAGTGGCACTGAGAACTGG - Intronic
1056961635 9:91129881-91129903 CAGCTACTGGCACTGGGCACCGG + Intergenic
1057833410 9:98425179-98425201 TAGGGAATGGCAGTGAGAAATGG + Intronic
1058010904 9:99975952-99975974 CAGGTATTGGCATTGGGCAAGGG + Intergenic
1058914175 9:109549665-109549687 CAGGAAATATCACTGGGAAATGG + Intergenic
1059307215 9:113363482-113363504 CAGGGAATAGGATTGGGAAAGGG - Intronic
1060662379 9:125411828-125411850 CAGGGTCTGGCACCCTGAAAGGG + Intergenic
1060967959 9:127722150-127722172 CAGGCAATGCCACTGGGAACAGG - Intronic
1061313198 9:129777356-129777378 CAGGGACTGGCCCTGGGCTGCGG + Intergenic
1061632283 9:131880037-131880059 CAGGGCCTGGCAGTGGCACAGGG + Intronic
1061995047 9:134178942-134178964 CACGGACTGGCAGTGGCAGAGGG - Intergenic
1062034542 9:134377072-134377094 GAGGGGCTGGCACTGGGAATGGG + Intronic
1062197674 9:135283158-135283180 CAGGGGCTGGCACAGGGACCTGG + Intergenic
1062261975 9:135667392-135667414 CAGGCACTGGCTCTGGGGACAGG - Intergenic
1062317230 9:135973970-135973992 CAGGGACTGGCGCTGGGGAATGG - Intergenic
1062372087 9:136245341-136245363 CAGGGACTGGCTCTGCGGTAAGG + Intronic
1062528378 9:136987878-136987900 CACTGAGTGGCACTGGGAGAAGG - Intergenic
1062698676 9:137888165-137888187 CAGGGAGTGGCGCTGGAGAACGG + Intronic
1185892956 X:3836414-3836436 CTGGGACTGGGACTGGGACTGGG - Intronic
1185892958 X:3836420-3836442 GAGGGACTGGGACTGGGACTGGG - Intronic
1185898065 X:3874834-3874856 CTGGGACTGGGACTGGGACTGGG - Intergenic
1185898067 X:3874840-3874862 GAGGGACTGGGACTGGGACTGGG - Intergenic
1185903184 X:3913265-3913287 CTGGGACTGGGACTGGGACTGGG - Intergenic
1185903186 X:3913271-3913293 GAGGGACTGGGACTGGGACTGGG - Intergenic
1186138685 X:6547951-6547973 AAGGGCCTGGCAGTGGGAAGTGG - Intergenic
1186832309 X:13403306-13403328 GATGGACTGGCAAGGGGAAATGG + Intergenic
1187273735 X:17801275-17801297 TAGGGACTGGCACAGGCAAGGGG + Exonic
1187506945 X:19886598-19886620 CAGGGTCTGGGACCTGGAAATGG - Intronic
1189079551 X:37956445-37956467 CAGGGACTGGCAGGGGGAAATGG - Intronic
1190136671 X:47804967-47804989 CAGGGCCTGACAATGGGAAGAGG - Intergenic
1190326468 X:49209902-49209924 CAGGGGCTGGCGCGGGGAACTGG + Intronic
1190632194 X:52398930-52398952 CAGCCAGAGGCACTGGGAAAAGG - Intergenic
1193423821 X:81316551-81316573 CAGTCAGAGGCACTGGGAAAAGG - Intergenic
1194179773 X:90697347-90697369 CAGTGACTGACCCTGGTAAAAGG + Intergenic
1194714854 X:97276277-97276299 CAGGGACAGGGACAGGGAGAGGG + Intronic
1198316473 X:135471715-135471737 CAGACACTGGCAGTGGGGAAAGG + Intergenic
1198623117 X:138535658-138535680 CAAGAACTTTCACTGGGAAAAGG + Intergenic
1202583150 Y:26402818-26402840 CAGGGACAGGGACAGGGACAGGG + Intergenic