ID: 1071573047

View in Genome Browser
Species Human (GRCh38)
Location 10:86708440-86708462
Sequence TCAGGGACTGGCACTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 431}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573047_1071573055 -1 Left 1071573047 10:86708440-86708462 CCTTTCCCAGTGCCAGTCCCTGA 0: 1
1: 0
2: 2
3: 46
4: 431
Right 1071573055 10:86708462-86708484 ACTCAGGACCTGTAGCTCCTGGG No data
1071573047_1071573060 27 Left 1071573047 10:86708440-86708462 CCTTTCCCAGTGCCAGTCCCTGA 0: 1
1: 0
2: 2
3: 46
4: 431
Right 1071573060 10:86708490-86708512 GGCAAAGTGTCCTCCAATGATGG No data
1071573047_1071573056 5 Left 1071573047 10:86708440-86708462 CCTTTCCCAGTGCCAGTCCCTGA 0: 1
1: 0
2: 2
3: 46
4: 431
Right 1071573056 10:86708468-86708490 GACCTGTAGCTCCTGGGCTGTGG No data
1071573047_1071573057 6 Left 1071573047 10:86708440-86708462 CCTTTCCCAGTGCCAGTCCCTGA 0: 1
1: 0
2: 2
3: 46
4: 431
Right 1071573057 10:86708469-86708491 ACCTGTAGCTCCTGGGCTGTGGG No data
1071573047_1071573054 -2 Left 1071573047 10:86708440-86708462 CCTTTCCCAGTGCCAGTCCCTGA 0: 1
1: 0
2: 2
3: 46
4: 431
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573047 Original CRISPR TCAGGGACTGGCACTGGGAA AGG (reversed) Intronic
900407498 1:2498980-2499002 ACCGGGAGTGGCACTGGGAGTGG + Intronic
900846405 1:5105760-5105782 TCAGGGACTGGCGCTGACAGTGG + Intergenic
901912634 1:12472934-12472956 GCAGGGGCTGGGACTGGCAACGG - Intronic
902073455 1:13762716-13762738 ACAGGCTCTGGCACTGAGAATGG - Intronic
903705662 1:25283946-25283968 TCAGGGTCTGAGACCGGGAAAGG + Intronic
903721578 1:25409474-25409496 TCAGGGTCTGAGACTGGGAAAGG - Intronic
903834541 1:26194607-26194629 TCAGGAACTGGATCTGGGTATGG + Intronic
904309769 1:29621225-29621247 GGTGGGACTGGCAGTGGGAATGG + Intergenic
904477738 1:30775741-30775763 TCAGGCACTGGCACGGGGATGGG - Intergenic
904601901 1:31677803-31677825 TCAAGCACTGGCACTAGGTAAGG + Intronic
904789165 1:33005453-33005475 TCAGCAAATGGCCCTGGGAAAGG + Intergenic
905370446 1:37480054-37480076 GTGGGAACTGGCACTGGGAATGG + Intronic
905717745 1:40167628-40167650 TCAAGGAAGGTCACTGGGAAAGG - Intronic
905867573 1:41384488-41384510 GGAGGAACTGGCATTGGGAAGGG + Intergenic
906262596 1:44405669-44405691 GCAGGGACTGGGACTCGGACTGG + Intronic
907090167 1:51716579-51716601 CCAGGCACTGGCAGAGGGAATGG - Intronic
907137971 1:52157238-52157260 TCAGGTCCAGGAACTGGGAAAGG + Intronic
907417808 1:54326558-54326580 GCAGCTCCTGGCACTGGGAAAGG + Intronic
907762597 1:57376231-57376253 CCAGGGACTGGGAGTGGAAAGGG - Intronic
908323989 1:63005586-63005608 GCAGGGACAGGAACTGAGAAAGG - Intergenic
908853173 1:68394252-68394274 TCAGGGACTGGAAATGAGTAGGG - Intergenic
908927447 1:69273366-69273388 TAAGGCAGTGGCAATGGGAATGG + Intergenic
911679585 1:100699698-100699720 TCAGGCCTTGGCACAGGGAAAGG - Intergenic
912309705 1:108607808-108607830 TGAGGCAGTGGCCCTGGGAATGG - Intronic
912350370 1:109006728-109006750 GCATGGACTGGCACTGGAATTGG - Intronic
912471518 1:109910400-109910422 GCAGGGACAAGCACTGGGAAGGG - Intronic
912580146 1:110713571-110713593 TAAGTGACTGTCACTGGGGAAGG - Intergenic
912883746 1:113447275-113447297 TCAGGGACTGGCATCTGGCAAGG + Intronic
913305179 1:117422204-117422226 TCAGGGGCTGGCAATGGGATAGG - Intronic
913579035 1:120208048-120208070 ACAGGCACTGGTATTGGGAATGG + Intergenic
913629138 1:120690321-120690343 ACAGGCACTGGTATTGGGAATGG - Intergenic
914432604 1:147632515-147632537 TGAGGAAATGGCAGTGGGAATGG + Intronic
914689825 1:150015836-150015858 TCAAGCACTGGCAAGGGGAAGGG - Intergenic
914747092 1:150508954-150508976 ACTGGGACAGGCACAGGGAAGGG - Intronic
914861642 1:151391209-151391231 TCAGAGACTGGCAATGAGAAGGG - Intergenic
915510575 1:156384841-156384863 TCAGGGGCTGGCAGTGGGTTAGG - Exonic
916601228 1:166295432-166295454 TCAGGGTCTAGAACTGGGCAGGG + Intergenic
917143371 1:171860715-171860737 TTAGGGAGTGGCAGTGGAAATGG + Intronic
917647471 1:177043455-177043477 TAAATGACTTGCACTGGGAATGG - Intronic
917802131 1:178580798-178580820 TCAGAGACTGGCACGGGGAGAGG - Intergenic
921700880 1:218267256-218267278 TCAGGGGCTGGCATTTGGCAAGG + Intergenic
922229296 1:223671877-223671899 TCAGGTAGTGGCACTGGGGCTGG + Intergenic
922545871 1:226456335-226456357 TCAGGGACTGTCACAGAGAATGG + Intergenic
922574144 1:226651183-226651205 CCGGGGACTGGAACTGGGAGTGG + Intronic
922730222 1:227945652-227945674 TCCTGGACTGGAGCTGGGAAGGG + Intronic
923279935 1:232433868-232433890 CCAGGGTCTGGCAGTGGTAATGG - Intronic
923319452 1:232816233-232816255 TGAGGGACTGGCACTTAGAGAGG + Intergenic
923949029 1:238926342-238926364 TCTGGGACTTGCGCTGGGGAAGG - Intergenic
924583379 1:245341056-245341078 TGAGGCACTGGGATTGGGAAAGG - Intronic
1062760833 10:17398-17420 GGAGGGACTGGCAGTGGGCAGGG - Intergenic
1063274851 10:4554342-4554364 TAAGGGACGGGCACAGGGACTGG + Intergenic
1063434245 10:6017923-6017945 TCAGGGAGTGGCAAAGGGAGAGG - Intronic
1064176472 10:13079761-13079783 CTAGGGAGTGGCAGTGGGAATGG - Intronic
1064563990 10:16621387-16621409 TCAGGGACTGAGGCTGGGTACGG - Intronic
1065866369 10:29918762-29918784 TCAGGGATTTGCTCTGTGAAGGG - Intergenic
1066205056 10:33180739-33180761 TTAGGTACATGCACTGGGAATGG - Intronic
1066446636 10:35490088-35490110 TATGGGCCTGGCACTGTGAATGG - Intronic
1067414308 10:46092015-46092037 GCAGGGACTGGCACAGGGCTGGG - Intergenic
1067434370 10:46266560-46266582 GCAGGGACTGGCACAGGGCTGGG - Intergenic
1067439325 10:46299797-46299819 GCAGGGACTGGCACAGGGCTGGG + Intronic
1067575348 10:47405121-47405143 TCAGGGACAGGCAATGGGACTGG - Intergenic
1067581080 10:47446456-47446478 TCAGGGACAGGCAATAGGACAGG - Intergenic
1067860109 10:49837794-49837816 TCAGGGCCTGGCACATGGGAAGG - Intronic
1068574557 10:58670561-58670583 TCAGGGACAGGCAGTGGTCAAGG + Intronic
1068830310 10:61486489-61486511 CTAGGGAATGGAACTGGGAAAGG + Intergenic
1070503145 10:77090292-77090314 TTGGGGAATGGCACTGGGGATGG - Intronic
1070737299 10:78872000-78872022 ACAGGTAGTGGCCCTGGGAAGGG - Intergenic
1070770485 10:79079619-79079641 ACAGGGCCTGGCACTGGGGCCGG + Intronic
1070829277 10:79408737-79408759 TCAGAGACTGGGAATGGGAATGG - Intronic
1071573047 10:86708440-86708462 TCAGGGACTGGCACTGGGAAAGG - Intronic
1073028067 10:100502872-100502894 GGGGGTACTGGCACTGGGAATGG - Intronic
1073048495 10:100653779-100653801 CCAGGGAATGGCTGTGGGAACGG - Intergenic
1073065286 10:100755074-100755096 TAGGGGACTGTCTCTGGGAAAGG - Intronic
1073598511 10:104823477-104823499 TGAGGCAATGGCAGTGGGAAAGG - Intronic
1074094349 10:110296594-110296616 CCAGGGAGTTGCAATGGGAATGG - Intronic
1074207165 10:111293060-111293082 TCACAAACTGGCACTGGTAAGGG - Intergenic
1075258805 10:120945512-120945534 TCAGGCCCTGGCCCTGGGGAAGG - Intergenic
1075490566 10:122864729-122864751 CCAGGGTCTGGCAGGGGGAAAGG - Intronic
1075953146 10:126499193-126499215 TCTGGGGCTGTCACTGAGAAGGG - Intronic
1076332805 10:129683228-129683250 GCAGGCACTTGCACTGGAAATGG - Intronic
1076916217 10:133424136-133424158 TCAGGGTCTGGAACGGGGACGGG + Intronic
1076936325 10:133568931-133568953 TCAGGGTCTGGAACGGGGACGGG + Intronic
1077474562 11:2780246-2780268 TCAGGGACAGACCCTAGGAAAGG + Intronic
1077909513 11:6562105-6562127 TGAGTGACTGACATTGGGAAGGG + Intronic
1078579641 11:12528166-12528188 TCTGGACCTGGCACCGGGAAGGG - Exonic
1079307268 11:19334267-19334289 CCAGGGACTGGCCTTGGGGATGG + Intergenic
1079994907 11:27285906-27285928 TTAGGTACTGGCCCTGGGAAGGG - Intergenic
1080749894 11:35141790-35141812 GCAGGAACTGGGACTTGGAAAGG + Intronic
1081003105 11:37698948-37698970 CCAGGGAATAGCACTGGCAAAGG - Intergenic
1081965020 11:47164255-47164277 CCAGGGGCCGGCACTGGGCAGGG + Intronic
1082997133 11:59263373-59263395 GCAGGGGCTGGGACTTGGAAGGG - Intergenic
1083372169 11:62190719-62190741 TCCGGGAGTGGCAATGGGAATGG + Intronic
1084589031 11:70079454-70079476 TCTGGGTCTGGCCCTGGGGAGGG - Intronic
1085713782 11:78854014-78854036 TCTGGGACTGACACTGACAAGGG - Intronic
1086606877 11:88706259-88706281 TTAGGGACTGCTTCTGGGAATGG - Intronic
1087451932 11:98334711-98334733 CCAGGGACTGGCAGGGGCAATGG - Intergenic
1088384381 11:109237000-109237022 TCAGAGACTGGAACCAGGAAGGG - Intergenic
1088626051 11:111731494-111731516 TCAGGGCCTGGCACTGAAACAGG - Intronic
1089561443 11:119345336-119345358 TCAGGGAGTGGCAGGGAGAAGGG - Intronic
1089625585 11:119748851-119748873 AGAGGGACTGGCTCTGAGAAGGG + Intergenic
1091633661 12:2181272-2181294 TCAGGAACTGCCTCTGTGAAAGG - Intronic
1092049335 12:5456661-5456683 TGAGGGTCTGGCTCTGGGAGGGG + Intronic
1092693579 12:11144117-11144139 TGAGGGACTGGCAGTGGGTGTGG + Intronic
1092746429 12:11676529-11676551 TCAGGGAGTGGCATGGGCAAAGG - Intronic
1094317847 12:29151492-29151514 ACAGGGCCTTGCACTTGGAAGGG + Intronic
1095791715 12:46175010-46175032 TCAGGGAGTGAGGCTGGGAAGGG + Intergenic
1095986986 12:48005245-48005267 GCAGGGGCAGGCCCTGGGAAGGG + Intergenic
1096745619 12:53725102-53725124 CCAGTCACTGGCACTGGGCATGG + Exonic
1096807280 12:54148567-54148589 TCAGGGACTGGCAGAGGGAGAGG - Intergenic
1096971568 12:55670576-55670598 ACTGGGACTGGGACTGGGACTGG - Intergenic
1097185325 12:57193517-57193539 TCAGCCACAGGCACAGGGAAAGG - Intronic
1098651240 12:72972340-72972362 TCCAGAACTGGCACTGGGATAGG + Intergenic
1099607620 12:84825602-84825624 TGACGGATTGGCACTGTGAAGGG - Intergenic
1100064312 12:90622743-90622765 TTTGGGACTGGCAGTGAGAATGG + Intergenic
1100678855 12:96897475-96897497 TCAGGCAGAGGCAATGGGAATGG - Intergenic
1103001362 12:117387686-117387708 TCAGGGCCTAGCACTTGGTATGG + Intronic
1103605447 12:122082469-122082491 TCTGGGAATGGAGCTGGGAATGG + Intronic
1103873317 12:124106865-124106887 TTGGGGACAGGCCCTGGGAATGG + Intronic
1104411364 12:128560716-128560738 TCAGTTCCTGGCACAGGGAAGGG + Intronic
1104723893 12:131063630-131063652 TGTGGGACTGGCACAGGGACAGG - Intronic
1105280416 13:18959773-18959795 TCAGGGAGTGTCACAGGGAGGGG + Intergenic
1106105279 13:26727744-26727766 ACAGAGATTGGCTCTGGGAATGG - Intergenic
1106684410 13:32042837-32042859 TCAGGCCCTGGCACTGGGCTGGG + Intronic
1107705850 13:43104188-43104210 GGAGGGATTGGCAATGGGAAGGG - Intronic
1110192292 13:72744251-72744273 TCTGGTACTGGCACTTGAAAAGG - Intronic
1110692529 13:78447914-78447936 TCATGCACTGACACTGGCAACGG + Intergenic
1113448275 13:110387335-110387357 TCAGGGTCTGGCCCTCGGCAAGG - Intronic
1114030763 14:18577912-18577934 GGAGGGACTGGCAGTGGGCAGGG + Intergenic
1114476190 14:22996765-22996787 GCATGGACTGACTCTGGGAATGG - Intronic
1117045119 14:51805770-51805792 TCAGATACTGGCATTGGGCAGGG - Intergenic
1117474318 14:56078533-56078555 TCGGGCAATGGCACTGGAAAGGG - Intergenic
1117983547 14:61365010-61365032 TGAGGGAGTGGCCATGGGAATGG + Intronic
1119112411 14:71987317-71987339 TCAGAGACTGGCAGTGAGGATGG + Intronic
1119205072 14:72788097-72788119 TCAGGGTCAGGCACTGTGAAGGG - Intronic
1119291691 14:73500424-73500446 TGAGAGATTGGAACTGGGAAGGG - Intronic
1119297960 14:73548490-73548512 TCAGGGACTGGATCTGGATATGG - Intronic
1119302250 14:73580687-73580709 TCAGGGACTGGATCTGGATATGG - Intergenic
1119369575 14:74127895-74127917 TGATGGACTGGCTGTGGGAAAGG + Intronic
1121318125 14:92974190-92974212 GCAGGGGCTGGCACTGAGCAGGG + Intronic
1121455427 14:94035823-94035845 CCAGGGCCTGGCACGGAGAAGGG - Intronic
1121729611 14:96177174-96177196 TCCTGGACAGGCACTTGGAATGG - Intergenic
1122803866 14:104247029-104247051 TCAGAGACTGGTCCAGGGAAGGG + Intergenic
1122834871 14:104425662-104425684 TCAGGGACACGACCTGGGAAGGG + Intergenic
1122883133 14:104699034-104699056 TCAGGGGCTTGCACAGGGCAAGG + Intronic
1122984936 14:105207674-105207696 TCTGGTCCTGGCACTGGGAAGGG + Intergenic
1124220793 15:27848175-27848197 CCAGGGACTGGCATAGGGATGGG - Intronic
1124720872 15:32109940-32109962 ACAGGAACTGGGAATGGGAATGG - Intronic
1125046832 15:35251346-35251368 TGAGGCAGTGGCATTGGGAATGG - Intronic
1126663140 15:51051945-51051967 TCAGGCTCTGTCACTGGTAAAGG - Intergenic
1127267481 15:57373928-57373950 TGAGGGAGTGGAACTGGCAAAGG - Intergenic
1128325384 15:66720719-66720741 CCAGGGTCTAGCACGGGGAAGGG + Intronic
1129118201 15:73378136-73378158 ACAGGGACAGGCACTGCGATGGG + Intergenic
1130944098 15:88538048-88538070 TCAGAGCCTAGCACTGGGACTGG + Intronic
1132118314 15:99154556-99154578 CCAGGGACTGGCATTTGGCAGGG - Intronic
1132508510 16:324830-324852 TCGGGGGCTGGGCCTGGGAAGGG - Intronic
1132797519 16:1732591-1732613 TCAGGGACTTGCCCTGAGAACGG + Intronic
1133155689 16:3873948-3873970 TCAGGCACTGCCCCTGGGGAGGG + Intronic
1133224110 16:4332449-4332471 TCAGGTACTGGCCCTGGGCAGGG + Exonic
1133231560 16:4369423-4369445 TCTGGGCCTGCCACTGGGAAGGG + Intronic
1134327977 16:13224489-13224511 TCAGGGACTGTCATTGGAACTGG + Intronic
1135413590 16:22252603-22252625 ACAGGGACTGAGACTGGAAAAGG + Intronic
1138667853 16:58586907-58586929 CCAGGGACTGGCAGTGGGGAGGG + Intronic
1139136007 16:64205612-64205634 TGAGGGACTGACTTTGGGAATGG + Intergenic
1140180008 16:72706233-72706255 TCAAGGATTTGCAGTGGGAAAGG - Intergenic
1140910414 16:79446207-79446229 TCTGGGAGAGGCACTGGGTATGG + Intergenic
1141704752 16:85658677-85658699 TCAGGGACGGGGGCTGGGAGAGG - Intronic
1141788577 16:86217743-86217765 TCAGGGGCTCGCACTCAGAAAGG + Intergenic
1141840909 16:86573513-86573535 TCAGGGACAGCCACTGGGTCTGG + Intergenic
1142777538 17:2153356-2153378 TCAGGGACTGGGGTTGGGAAGGG + Intronic
1143318111 17:6047988-6048010 GCAGGGACAGGCACTGGGCTGGG + Intronic
1143610282 17:8014030-8014052 TCAGGGGCTGGGAGTGGGCAAGG + Intronic
1144182939 17:12769878-12769900 TCATGGACTGGCAGTAGGGAAGG + Intergenic
1145799063 17:27671902-27671924 TCTGGGTCTGGTGCTGGGAAGGG - Intergenic
1146318793 17:31830428-31830450 TGAGGGTCTGTCACTGGGCAGGG - Intergenic
1147011579 17:37453464-37453486 TCAGGGACTACTTCTGGGAAAGG + Intronic
1147187853 17:38722264-38722286 TGGGGGGCTGGCTCTGGGAAGGG + Intronic
1147900508 17:43780339-43780361 TCAGGGACAGGTCCCGGGAAGGG - Intergenic
1148618214 17:49015451-49015473 TCTCAGACTGGCAGTGGGAAGGG - Intronic
1148795792 17:50196112-50196134 TCAGGGCCTGGGAGTGGGGAGGG - Intronic
1149278487 17:55072965-55072987 TCAGAGACAGGCACATGGAATGG + Exonic
1149455181 17:56781986-56782008 TGAGGGAATGGCTCAGGGAAAGG - Intergenic
1150485054 17:65537595-65537617 GCAGGGAGTGGTACTGCGAATGG + Exonic
1151129712 17:71883659-71883681 TAATGCAGTGGCACTGGGAAGGG + Intergenic
1151464374 17:74275133-74275155 CCAGGGACTGGCACATAGAAGGG - Intronic
1151815730 17:76470527-76470549 TGAGGCACTGGCACAGGGAGTGG + Intergenic
1152020697 17:77778901-77778923 GCAGCAACAGGCACTGGGAAAGG + Intergenic
1152408227 17:80109360-80109382 TGTGGGACTGGCTCAGGGAAGGG - Intergenic
1152605266 17:81286452-81286474 CGAGGGATTGACACTGGGAATGG - Intronic
1152656817 17:81523686-81523708 TCAGGGCCTGGCACTGAGGTGGG + Intronic
1152740645 17:82016966-82016988 TCAGGGGCTGGCAATGGGGAAGG - Exonic
1152953740 18:17752-17774 GGAGGGACTGGCAGTGGGCAGGG - Intergenic
1153838878 18:8988742-8988764 TCAGGGACTCCCACAGGAAAGGG - Intergenic
1153979214 18:10295031-10295053 TCAGGAAGTGGCTCTGGGAAAGG + Intergenic
1154020681 18:10661886-10661908 TTGGGGCCTGGCACAGGGAATGG + Intergenic
1154147307 18:11876924-11876946 CCAGGGAATGGCACTTGGATGGG + Intronic
1156496552 18:37529544-37529566 TGGGGGACTGGCAGTAGGAAAGG + Intronic
1156861719 18:41844341-41844363 TCAGGGGCTAGCAGTGGGCATGG - Intergenic
1157746656 18:50141842-50141864 GCAGGGAATGGGACTGGGCAGGG - Intronic
1157992953 18:52519539-52519561 TGAGGGACAGGCAATGGGATGGG + Intronic
1158204418 18:54975691-54975713 TCAGAGCCTGGAAATGGGAAGGG - Intergenic
1159734703 18:72080679-72080701 TCAGGACCATGCACTGGGAAAGG + Intergenic
1160682324 19:417563-417585 TCTGAGACAGGCACTGGGATCGG - Intronic
1160707334 19:535735-535757 TCAGGCACCAGCACTGGGAGTGG + Intronic
1160887508 19:1357615-1357637 TGAGTGTCTGGCACTGGGAAAGG + Intronic
1162909096 19:13839965-13839987 TCAGAGGGTGGCACTGGGTAGGG + Intergenic
1163430345 19:17263537-17263559 ACTGTGACGGGCACTGGGAAAGG + Intronic
1163505266 19:17702048-17702070 ACAGGGACTGGCGTTGGGCATGG - Intergenic
1163514747 19:17756055-17756077 TCAGGGCCTGCAACTGGGGAAGG - Intronic
1163641977 19:18467120-18467142 GCAGGGACTGGCACTGGGCTGGG - Intronic
1164451517 19:28370073-28370095 TCATGGACTGGGAGTGGGAAAGG - Intergenic
1164840111 19:31386969-31386991 ACGGGGTCTGGCACAGGGAAAGG - Intergenic
1166140417 19:40802368-40802390 GCAGGGACTGGGACAGTGAAGGG - Intronic
1166378563 19:42342884-42342906 TCAGTGACTGGCTCAGGGAGGGG - Intronic
1166583407 19:43923754-43923776 TCAGGGGCTGGGAGGGGGAATGG - Intronic
1166820265 19:45574950-45574972 TCTGGAACTGGCACTGGGACTGG - Intronic
1167596151 19:50429195-50429217 ATAGGGAGTGGCACTAGGAAGGG - Exonic
1167934228 19:52893195-52893217 CCAGGGGCTGGCACTGGGCAGGG + Intronic
1168547422 19:57264959-57264981 ACATGGAATGGCACTGGGAAGGG - Intergenic
1168622191 19:57888570-57888592 ACAGGGACTGGCGCGGGCAAAGG - Intronic
925817420 2:7767362-7767384 TAAGGGACTCGCGCTGGGCACGG + Intergenic
927217383 2:20675716-20675738 TCTGGGACTGGGATTGGGAGAGG - Intergenic
927474865 2:23405532-23405554 TCAGGGACTGGTTCTGGTCAGGG + Intronic
927491664 2:23525265-23525287 TCAGGGACAGGCAGTGGGCAAGG - Intronic
928272932 2:29873442-29873464 TCAGGTGCAGGCACTGAGAATGG + Intronic
928920193 2:36519131-36519153 TAAGGGAGTGGCACTGGGGGAGG + Intronic
930770194 2:55122803-55122825 GCAGGGACAGGCTCTGGGGATGG - Intergenic
932405048 2:71507115-71507137 TGAGGAGCTGGCACTGGGCACGG + Intronic
932493072 2:72133732-72133754 GAAGGGGCTGGCACTGGGAGTGG - Intronic
932541849 2:72663684-72663706 TCAGGGACTGGGAAAGGGAGGGG + Intronic
932572495 2:72945434-72945456 CCAGGGAATGGCCCTGGGCAGGG - Intronic
933271405 2:80237070-80237092 ACATGGACTGACAATGGGAAGGG - Intronic
933285637 2:80381742-80381764 TGCGGGGCTGGCAATGGGAAAGG + Intronic
934903407 2:98178801-98178823 TCAGGGGATGCCACTGTGAAAGG + Intronic
935047183 2:99492960-99492982 ACAGGGTCTGGCACAGGGACAGG - Intergenic
935417914 2:102838002-102838024 ACAGGGCCTGGCGCTGAGAAGGG - Intronic
936074726 2:109394462-109394484 ACAGGGGCAGGCTCTGGGAAGGG + Intronic
937355251 2:121194446-121194468 CCAGGGTCTGGCACTGGGTTGGG - Intergenic
938288927 2:130139224-130139246 CCAAGGGCTGGGACTGGGAAGGG + Intergenic
938467607 2:131533707-131533729 CCAAGGGCTGGGACTGGGAAGGG - Intergenic
938497442 2:131807855-131807877 GGAGGGACTGGCAGTGGGCAGGG - Intergenic
938573753 2:132585384-132585406 TCAAGGACTGGGACTGGCAGAGG - Intronic
940152509 2:150617830-150617852 TCAGGAACTGTCACTGGCAAGGG - Intergenic
940962931 2:159805216-159805238 TCAGGGCCTGGAACAGGAAAAGG + Exonic
941120437 2:161523686-161523708 TGAGGGACTGGCACAGGGTCTGG - Intronic
941568080 2:167133343-167133365 TCAGGGCCTGGCAAGGGGTAAGG - Intronic
942996815 2:182272278-182272300 TCAGGGCCTTGCACTTGGGAGGG + Intronic
944617128 2:201472565-201472587 CCAGGGACTGGGAGTGGGGATGG + Intronic
944744596 2:202642427-202642449 TGGGGGAATGGCAGTGGGAATGG + Intronic
945039598 2:205733034-205733056 TGAGGGACTTGAACTTGGAAGGG - Intronic
946158386 2:217821681-217821703 TCCGGGCCTGGGACTGGGACGGG - Intronic
946635156 2:221716911-221716933 TCAGGTACTTGCACTGGTGATGG + Intergenic
946820037 2:223619918-223619940 GCAGGGACTGGCAGCGGGAGGGG - Intergenic
947251836 2:228115353-228115375 TCAGGCACTGGAAGTGGGGAAGG - Intronic
948094256 2:235321059-235321081 GCAGGGATTGGCTCTGCGAAGGG + Intergenic
948712243 2:239832534-239832556 TCAGTGAGATGCACTGGGAAGGG + Intergenic
948745369 2:240088734-240088756 TCAGGGACTGTTACTGGAGAAGG + Intergenic
948934228 2:241151815-241151837 TAAGGTACTGGCAATGGGAATGG - Intronic
1169316401 20:4594120-4594142 TGAGGAATTGGGACTGGGAAGGG - Intergenic
1171008516 20:21492040-21492062 TCAGGGAGTGAAAATGGGAAGGG - Intergenic
1171888832 20:30688134-30688156 TCAGGGACCTGCAGTGAGAATGG + Intergenic
1172206524 20:33166650-33166672 TCAGAGCCTGGCACTGGGCTTGG - Intronic
1172847798 20:37940276-37940298 GCAGGGCCTGGCACTAGGGAGGG + Intronic
1173021720 20:39273057-39273079 ACAGGGCCTGGCACAGGGCAGGG + Intergenic
1173223586 20:41148281-41148303 TCAGGGAGTGGCAGAGGGGAAGG + Intronic
1173941322 20:46913687-46913709 TGAGGGATTGGCTCTGGGAAGGG + Intronic
1174420194 20:50394406-50394428 TCAGCGCCTGGCATCGGGAAGGG + Intergenic
1174561471 20:51433586-51433608 TCAGTGACTGGTGCTGGGCAGGG - Intronic
1175614033 20:60377387-60377409 TCAGGGACCGGCAATCTGAATGG + Intergenic
1176091090 20:63318954-63318976 TCAGGGACTGGCACTGGGGCTGG + Intronic
1176882670 21:14216279-14216301 TCAGGTACCGTCTCTGGGAAGGG + Exonic
1179813240 21:43885672-43885694 TAAGAAACTGGCACTGGGCACGG - Intronic
1179914640 21:44468148-44468170 CCAGGGACAAGGACTGGGAAGGG + Intergenic
1180454877 22:15504968-15504990 GGAGGGACTGGCAGTGGGCAGGG + Intergenic
1180709965 22:17832846-17832868 TCAGGGATTGGCACGTGGTAGGG - Intronic
1180955319 22:19738826-19738848 CCAGCGGCTGGCCCTGGGAATGG - Intergenic
1181590766 22:23883699-23883721 TCTGGGGCAGGCAATGGGAAGGG - Intronic
1182013760 22:27022061-27022083 TCATGGACTGGTCCTGGGACAGG + Intergenic
1182414186 22:30210446-30210468 TCAGGGGCTGGCTCTGGGCAGGG + Intergenic
1182487473 22:30648006-30648028 TGAGGGAATGGCACTGGGCTCGG - Intronic
1182645454 22:31805294-31805316 TGAGGCACTGGCACTGGCAGAGG - Intronic
1183211205 22:36452490-36452512 TCAGGGTCTGGCAGAGGGAGGGG + Intergenic
1183332964 22:37231237-37231259 GCAGGGCCTGGCACTGGCCAAGG - Exonic
1183370816 22:37431193-37431215 TCAGGGCCAGGCACTGTGCAAGG + Intergenic
1183836653 22:40459746-40459768 TCAGTGCCAGGCACTGGGGACGG + Intronic
1184244870 22:43230860-43230882 TCAGGGGCTGGCACGGGGCAGGG - Intronic
1184432529 22:44449861-44449883 TCTGGGCCAGGCACTGGGCAGGG - Intergenic
1184694293 22:46131166-46131188 AGAGGGACTGGTCCTGGGAATGG - Intergenic
1184746979 22:46461843-46461865 GCAGGCACTGGCTCGGGGAAGGG + Intronic
1184832260 22:46996294-46996316 TCAGGGAGTGACACTGGGGATGG - Intronic
1185230307 22:49676927-49676949 TGAGGGCCTGGCATTGGGGAGGG - Intergenic
1185248041 22:49783709-49783731 TCAGAGCCCGGCAGTGGGAATGG - Intronic
1185347067 22:50315116-50315138 GCTGGGCCTGGCCCTGGGAATGG + Intronic
1185370419 22:50458415-50458437 GCAGCCACTGGCACTGGGGATGG + Intronic
950360046 3:12443724-12443746 TGAGGGAATGGCACTGGCATTGG + Intergenic
950455933 3:13092797-13092819 GGAGGGGCTGGCACTGGGACAGG - Intergenic
950555869 3:13695686-13695708 TCAGGAACAGGCACGGAGAAGGG - Intergenic
950568642 3:13786608-13786630 TCAGGGGAAGGCAGTGGGAATGG - Intergenic
951496876 3:23338596-23338618 TTGGGGACTGGGACTGGGACTGG + Intronic
951509999 3:23489730-23489752 CCACGGACTGGTACTGGGAGTGG + Intronic
952430692 3:33219894-33219916 TCAGGGTCTAGCACAGGGACAGG - Intergenic
952863272 3:37832695-37832717 TCCAGGACTGGCAGTGGGGAAGG + Intergenic
953794824 3:45976514-45976536 TCAGGCTCTGGCTCTGGGTAGGG + Intronic
953920397 3:46947542-46947564 CCAGAGACTGGCAGGGGGAAAGG + Intronic
954035848 3:47850749-47850771 TCATGGACTGACACAGGTAATGG + Intronic
955403312 3:58609063-58609085 TCAGGGCCTGGTCATGGGAAAGG + Intronic
955611753 3:60765090-60765112 AAAAAGACTGGCACTGGGAATGG + Intronic
955650804 3:61191905-61191927 TCAGACACTGGCACGCGGAATGG - Intronic
955993859 3:64657789-64657811 ACAGTGGCTGCCACTGGGAAGGG + Intronic
956189023 3:66590741-66590763 AGAGGGACTAGCACTGGCAAAGG - Intergenic
959599093 3:108159116-108159138 CCAGGGACTGGGAATGGGACTGG - Intergenic
959629048 3:108487611-108487633 TTAGGGACTGGGGCTGGGAAAGG + Intronic
960345859 3:116531658-116531680 TCAGGTATTGCCTCTGGGAAGGG + Intronic
960624674 3:119670253-119670275 TCTGGGATAGGCACTGGGAGAGG - Intronic
960882879 3:122363811-122363833 TCAGGGCCTGGCAATGGAATTGG - Intronic
961195547 3:124998508-124998530 TCAGTGCCTGGCACAGGGACTGG + Intronic
961300698 3:125920287-125920309 CCACGGGCTGGCACTTGGAAAGG - Intergenic
961409556 3:126708826-126708848 CCTGGGACTGGGAGTGGGAATGG - Intronic
964767962 3:160196980-160197002 CCAGGGACTGCTGCTGGGAATGG - Intergenic
965115138 3:164478436-164478458 TCAGGCACTGGCACGGGCAATGG - Intergenic
966928295 3:184659715-184659737 TCAGGGCCTGGCTGGGGGAAAGG + Intronic
967971749 3:195004515-195004537 ACAGGGCCTGGCACAAGGAAAGG + Intergenic
968657872 4:1786450-1786472 TCAGCCGCAGGCACTGGGAAGGG - Intergenic
968682427 4:1930177-1930199 TCAGGTACAGGCCCTGGGCAGGG - Intronic
969080468 4:4613940-4613962 CCATGGCCTGGCCCTGGGAATGG + Intergenic
969239415 4:5888956-5888978 TCAGGGAGAGGCACTCGGGAAGG - Intronic
969389122 4:6877573-6877595 TTTGGGACTGGGACTGGGACTGG - Intronic
969582895 4:8076159-8076181 ACAGTGACTGGGACTGGGATGGG + Intronic
969757066 4:9156947-9156969 CCACGGGCTGGCACTTGGAAAGG - Intergenic
970384823 4:15545692-15545714 TCAGGGCCTGGCAGTAGAAATGG + Intronic
970723130 4:19010943-19010965 CCAGGGACTGTCACTCAGAAAGG - Intergenic
971192753 4:24443398-24443420 TCTGGCTCTGGCACTGGGGAAGG + Intergenic
972800745 4:42473537-42473559 TCAGACACTGGGAATGGGAAGGG - Intronic
973767562 4:54177111-54177133 ACAGGGACTGACAATGGGCAGGG + Intronic
976439218 4:85054733-85054755 TGAGGGACTGCCACGAGGAATGG + Intergenic
981288415 4:143046318-143046340 GCAGGGACTGGCTCTGAGAAGGG + Intergenic
981688559 4:147481397-147481419 TCGGGGACTGGGACTGGGGCGGG + Intronic
982355317 4:154460571-154460593 TCAGGGACTAGGACTGGAAAGGG + Intronic
983922868 4:173366043-173366065 TCAGGGACTTGCAGTGGCACAGG - Intergenic
984770085 4:183429766-183429788 ACAGGGACTGCCAGAGGGAAAGG + Intergenic
986008977 5:3695053-3695075 TTAGGAGCTGCCACTGGGAATGG + Intergenic
986163540 5:5252421-5252443 TCAGGGATTGGGATAGGGAAAGG + Intronic
986450566 5:7859707-7859729 ACAGTGCCTGGCACTGAGAAGGG + Intronic
986957777 5:13175791-13175813 TAAGGGAGTGGCACGGGAAAAGG - Intergenic
986981910 5:13457763-13457785 TCAGTGGCTGTCACTGGGAATGG + Intergenic
987020409 5:13864499-13864521 TGATGGAGCGGCACTGGGAAAGG - Exonic
988541924 5:32117999-32118021 CCAGGCAGTGACACTGGGAATGG + Intergenic
989251947 5:39327385-39327407 TAAGGCAGTGGCAGTGGGAATGG + Intronic
990120179 5:52441938-52441960 TCAGGGACTGTCACTTGAAAAGG + Intergenic
992957189 5:81922220-81922242 TAAGGTAATGGCAGTGGGAATGG - Intergenic
993605762 5:89989186-89989208 TCAGAGAGTGACACAGGGAATGG + Intergenic
995803337 5:116023583-116023605 CAAGTCACTGGCACTGGGAAGGG + Intronic
996915118 5:128703191-128703213 TCAGGGACTGGGGCAGGCAAGGG - Intronic
997530636 5:134579324-134579346 GCAGGGCCTGGGACAGGGAAGGG - Exonic
997851164 5:137333658-137333680 TCAGGCACTGGTACTTGGCAAGG + Intronic
997990614 5:138542449-138542471 TCAGGGAAGGGCCCTGGGAAAGG + Intronic
998039639 5:138944201-138944223 TCAGGGATGGGCAGTTGGAAGGG - Intergenic
998216999 5:140244931-140244953 TCACTGACTGGAGCTGGGAAGGG + Intronic
999593206 5:153171893-153171915 TCAGGCACTGGCACAGGAACAGG + Intergenic
999818537 5:155201137-155201159 AGAGGGACTGGCAGTGGGCATGG - Intergenic
1001207851 5:169780653-169780675 CCAGTAACTGGCACTGGGATAGG + Intronic
1001315480 5:170638529-170638551 TCAGAGACTGCCACTCAGAATGG - Intronic
1001884477 5:175276755-175276777 TTAGGTTCTGCCACTGGGAATGG - Intergenic
1002066333 5:176653836-176653858 TCAGGGCCTGGCTCTGGGTCCGG - Intronic
1002204553 5:177553957-177553979 ACTGGGACTGGGACTGGGACTGG - Intronic
1002570940 5:180139011-180139033 TCAGTACCTGGCACAGGGAAAGG + Intronic
1003529079 6:6922683-6922705 ACAGGCACTGGCACTGTGCAAGG + Intergenic
1004871095 6:19904922-19904944 CCAGGGACTGGGTCTGGGGAAGG - Intergenic
1005927142 6:30453235-30453257 TCCTGGACTGGGGCTGGGAAGGG + Intergenic
1006320181 6:33315472-33315494 GGAGGGACTGGCAGTGGGGACGG - Exonic
1006678409 6:35779727-35779749 GCAGGGGCTGGGTCTGGGAAAGG + Intergenic
1007337812 6:41167329-41167351 ACAGGGGCTGGCACTGGCCATGG - Intergenic
1007504280 6:42322964-42322986 GCAGAGAATGGCACTGGGAGGGG + Intronic
1009895053 6:69738349-69738371 TCAGGGTCTGCCATTGAGAAAGG - Intronic
1011011367 6:82707058-82707080 TCAGGGACTGGGAGGGAGAAGGG - Intergenic
1011761347 6:90569306-90569328 TAAGGCAATGGCAGTGGGAATGG - Intronic
1012499827 6:99875983-99876005 TCATGGACTGGTACTGGGTTGGG + Intergenic
1013157374 6:107506313-107506335 TCAGGGCTTGCCACTGGAAATGG + Exonic
1013295371 6:108753883-108753905 TCAGCGCCTGGCACAGAGAAGGG - Intergenic
1014284994 6:119487192-119487214 AGAGGGACTGGCAGTGGGCAGGG - Intergenic
1014851381 6:126343528-126343550 TTGGGGACTGGGACTGGGACTGG - Intronic
1015864443 6:137713426-137713448 TCATGTCCTGGCTCTGGGAAAGG + Intergenic
1016761934 6:147747318-147747340 TGAGGGACTGGCCCTGCAAATGG + Intergenic
1017016105 6:150100737-150100759 TTTGGGACTGGCCCTGAGAATGG - Intergenic
1017048522 6:150369602-150369624 CCAGGGCCTGGCACAGGGAAAGG - Intronic
1017156827 6:151330030-151330052 CCAGGGATTGGGACTGGGCACGG + Intronic
1017516800 6:155163749-155163771 TCAGGGACTGTAAATGTGAAGGG + Intronic
1018340845 6:162849415-162849437 TCAGCAGCAGGCACTGGGAATGG - Intronic
1018829130 6:167429126-167429148 TCAGACACAGGGACTGGGAAGGG - Intergenic
1019387695 7:767672-767694 GCAGGAACTCGCACTGGGAGGGG + Intronic
1022419428 7:30206553-30206575 TCAGTGACTGGCACAAGGACAGG - Intergenic
1023227654 7:37987916-37987938 CTAGGGAGTGGCAGTGGGAAGGG - Intronic
1023829045 7:44028699-44028721 CCAGGGACAGCAACTGGGAAGGG + Intergenic
1023901581 7:44485133-44485155 TCCTGGACTGGAACTGGGACTGG + Exonic
1024340322 7:48250916-48250938 TCAGGGACTTGGACAGGAAATGG + Intronic
1029409901 7:100402404-100402426 TCAGGTCCTGGCACTGAGATGGG + Intronic
1029543824 7:101200105-101200127 TCAGGCAGTGGGACAGGGAATGG - Intronic
1029739346 7:102482956-102482978 CCAGGGACAGCAACTGGGAAGGG + Intronic
1029757347 7:102582135-102582157 CCAGGGACAGCAACTGGGAAGGG + Exonic
1029775287 7:102681196-102681218 CCAGGGACAGCAACTGGGAAGGG + Intergenic
1030899084 7:115099954-115099976 ACAGGGATTGGGAGTGGGAAAGG - Intergenic
1031530130 7:122866044-122866066 TCTGGGAATGTGACTGGGAATGG + Intronic
1032417040 7:131743783-131743805 TCTGGGGCTGGGCCTGGGAATGG - Intergenic
1033033874 7:137852357-137852379 TGAGGCACTGGCAATGGCAATGG + Intergenic
1033463389 7:141568117-141568139 TGAGAGACTGCCAGTGGGAAGGG + Intronic
1034443421 7:151099649-151099671 CCGGGGACTGGCACCGGGACCGG + Intronic
1036073896 8:5473432-5473454 CCAGGGCTTGCCACTGGGAAAGG - Intergenic
1036133763 8:6140186-6140208 TCGGGGAGTGGCCCTGGCAAAGG + Intergenic
1036380296 8:8232262-8232284 CCACGGGCTGGCACTTGGAAAGG - Intergenic
1036849264 8:12190398-12190420 CCACGGGCTGGCACTTGGAACGG + Intronic
1036870624 8:12432672-12432694 CCACGGGCTGGCACTTGGAACGG + Intronic
1038237111 8:25769663-25769685 AGAGGGACTGGCAGTGGGCAGGG - Intergenic
1041071162 8:54127194-54127216 TCAGAGAATGGCCATGGGAATGG + Intergenic
1042715560 8:71768999-71769021 TCTGGCACTGGCACTGGAAATGG - Intergenic
1042715568 8:71769063-71769085 TCTGGAACTGGCACTGGAACTGG - Intergenic
1042715717 8:71770300-71770322 TCTGGAACTGGCACTGGAAGTGG - Intergenic
1042715753 8:71770556-71770578 TCTGGAACTGGCACTGGAACTGG - Intergenic
1043738408 8:83775795-83775817 TCAGGCAGTGGCAGTGGGATCGG - Intergenic
1044091523 8:88008291-88008313 TCAGGCACTGGCATTGGGTGAGG + Intergenic
1044914220 8:97095066-97095088 TAAGGGACTGGCACAAGGAAGGG - Intronic
1045314967 8:101035666-101035688 TCTGGTACTGGCACTGCCAAGGG + Intergenic
1046721771 8:117628147-117628169 TAAGGGAGTGGCATTGGGAATGG + Intergenic
1047921159 8:129636000-129636022 TCAGGAAATGCCAATGGGAAAGG + Intergenic
1048933459 8:139335906-139335928 TTAGAGACTGGTGCTGGGAAGGG - Intergenic
1049071467 8:140358895-140358917 CCAGGGCCTGGCACGGGGACAGG + Intronic
1049107982 8:140625455-140625477 TCAGGGGCTGGGGCTGGGGAGGG - Intronic
1049217109 8:141413243-141413265 TCAGGGACTGGGGCGGGGAGAGG + Intronic
1049442872 8:142617223-142617245 TCAGGGACGGGCACGGGGTGGGG - Intergenic
1049572572 8:143376145-143376167 TCAGGGCCTGGCAAAGGGACCGG - Intronic
1049597127 8:143489952-143489974 TCAGGGACAGGCCCAGGGACCGG - Intronic
1050084575 9:1951220-1951242 TGAGGGTATGGCACTGTGAAAGG + Intergenic
1050428205 9:5534416-5534438 TCAGGGACTGGAGGTGGGAGAGG + Intronic
1052125935 9:24774483-24774505 GCAAGGAATAGCACTGGGAAAGG - Intergenic
1053135153 9:35646308-35646330 TGAGGGTCTGTCCCTGGGAACGG + Intronic
1053385566 9:37684629-37684651 TCAGGCAGTAGCACTGAGAAAGG + Intronic
1055420609 9:76137112-76137134 TTATGGACTGGAACAGGGAAGGG + Intronic
1056708836 9:88973496-88973518 GCAGGGGCCGGCAGTGGGAAGGG - Intergenic
1057003854 9:91538175-91538197 AGAGGGACTGGCAGTGGGCAGGG - Intergenic
1057218341 9:93242049-93242071 TCAGTGACTGGGACTTGGACTGG + Intronic
1057830298 9:98401101-98401123 TCGGGGACTGGCACAGAGAAGGG - Intronic
1058091055 9:100805843-100805865 GGAGGGATTGGCAATGGGAAAGG + Intergenic
1059307216 9:113363483-113363505 TCAGGGAATAGGATTGGGAAAGG - Intronic
1059425821 9:114220368-114220390 CCAGGGCCTGGAGCTGGGAAGGG - Intronic
1059450996 9:114371465-114371487 TCAGGCCCTGGCACTGGGTGTGG - Intronic
1059918583 9:119132228-119132250 TCAGAGACTGGCATTCAGAAAGG + Intergenic
1060303688 9:122391961-122391983 TCAGGGACTGGGTCTAGGGAAGG - Intronic
1060784948 9:126443878-126443900 CCAGGGACTGGCGATGGGGAGGG - Intronic
1060854262 9:126902358-126902380 ACAGGTCCTGGCACTAGGAATGG + Intergenic
1060877856 9:127096119-127096141 GCAGGAAGTGGCACTGGCAAAGG - Intronic
1060942225 9:127549583-127549605 TCAGTGAGTGGGACTGGGGAGGG + Intronic
1061771199 9:132923526-132923548 TCAGGCACTGGCACCAGGATCGG + Intronic
1061796523 9:133088611-133088633 ACAGGGACAGTCACTGGGAGAGG - Intergenic
1062034541 9:134377071-134377093 TGAGGGGCTGGCACTGGGAATGG + Intronic
1062035424 9:134380565-134380587 CCAGGGACTGGACTTGGGAAGGG + Intronic
1062280895 9:135751167-135751189 CCTGGGACAGGCACTGGGGAAGG - Intronic
1062396097 9:136353500-136353522 TCAGTGCCTGGTACGGGGAAAGG - Intronic
1062523816 9:136970326-136970348 GCAGGGGCTGGCAGTGGGCAGGG - Intronic
1062598448 9:137309575-137309597 TCAGGGTCAGGCACTGGGTCTGG - Intronic
1203584616 Un_KI270746v1:53521-53543 TTAGAGAAAGGCACTGGGAAAGG - Intergenic
1185892957 X:3836415-3836437 ACTGGGACTGGGACTGGGACTGG - Intronic
1185892959 X:3836421-3836443 AGAGGGACTGGGACTGGGACTGG - Intronic
1185898066 X:3874835-3874857 ACTGGGACTGGGACTGGGACTGG - Intergenic
1185898068 X:3874841-3874863 AGAGGGACTGGGACTGGGACTGG - Intergenic
1185903185 X:3913266-3913288 ACTGGGACTGGGACTGGGACTGG - Intergenic
1185903187 X:3913272-3913294 AGAGGGACTGGGACTGGGACTGG - Intergenic
1186957616 X:14700424-14700446 TCAGAGACAGGCAGGGGGAAAGG + Intronic
1186976351 X:14910256-14910278 TTAGGGAGTGGCAGTGGGCATGG - Intronic
1187273734 X:17801274-17801296 ATAGGGACTGGCACAGGCAAGGG + Exonic
1189972340 X:46430977-46430999 TGAGGGACGTGCATTGGGAATGG + Intergenic
1190472591 X:50797879-50797901 ACAGTGATTGCCACTGGGAAGGG + Intronic
1190894783 X:54606428-54606450 TTAGGGAGTAGTACTGGGAAGGG + Intergenic
1192570564 X:72200755-72200777 TCATAGACTGTCTCTGGGAATGG + Intronic
1193135149 X:77962545-77962567 TCAGGGTCAGCCACAGGGAAGGG - Intronic
1193635967 X:83949090-83949112 ACTGGGACTGGCACCAGGAAGGG + Intergenic
1194244994 X:91500139-91500161 CCAGGCAGGGGCACTGGGAAAGG - Intergenic
1198161941 X:134016759-134016781 TAAGGCAATGGCAGTGGGAATGG + Intergenic
1198526744 X:137509139-137509161 AGAGGGACTGGCAATGGGCAGGG + Intergenic
1198595343 X:138229851-138229873 TCAGGGATTGGAACTGGTAGAGG + Intergenic
1199504222 X:148543377-148543399 TCAGTTACTGGCACAGGGTAGGG - Intronic
1199745105 X:150767458-150767480 TCAAGGGCACGCACTGGGAATGG + Exonic
1200563969 Y:4741449-4741471 CCAGGCAGGGGCACTGGGAAAGG - Intergenic