ID: 1071573048

View in Genome Browser
Species Human (GRCh38)
Location 10:86708445-86708467
Sequence CTGAGTCAGGGACTGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 264}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573048_1071573057 1 Left 1071573048 10:86708445-86708467 CCCAGTGCCAGTCCCTGACTCAG 0: 1
1: 0
2: 3
3: 24
4: 264
Right 1071573057 10:86708469-86708491 ACCTGTAGCTCCTGGGCTGTGGG No data
1071573048_1071573060 22 Left 1071573048 10:86708445-86708467 CCCAGTGCCAGTCCCTGACTCAG 0: 1
1: 0
2: 3
3: 24
4: 264
Right 1071573060 10:86708490-86708512 GGCAAAGTGTCCTCCAATGATGG No data
1071573048_1071573054 -7 Left 1071573048 10:86708445-86708467 CCCAGTGCCAGTCCCTGACTCAG 0: 1
1: 0
2: 3
3: 24
4: 264
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573048_1071573056 0 Left 1071573048 10:86708445-86708467 CCCAGTGCCAGTCCCTGACTCAG 0: 1
1: 0
2: 3
3: 24
4: 264
Right 1071573056 10:86708468-86708490 GACCTGTAGCTCCTGGGCTGTGG No data
1071573048_1071573055 -6 Left 1071573048 10:86708445-86708467 CCCAGTGCCAGTCCCTGACTCAG 0: 1
1: 0
2: 3
3: 24
4: 264
Right 1071573055 10:86708462-86708484 ACTCAGGACCTGTAGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573048 Original CRISPR CTGAGTCAGGGACTGGCACT GGG (reversed) Intronic
900304566 1:1998484-1998506 CTGAGGCAGGGACGGGCACCTGG + Intronic
900363054 1:2299228-2299250 CCGAGGCAGGGACAGTCACTCGG - Intronic
900697351 1:4020573-4020595 TTGAGTCAGGGACTGGATCGGGG + Intergenic
900843334 1:5075178-5075200 CTGAATCATCCACTGGCACTCGG - Intergenic
902528884 1:17077607-17077629 CTGACACAGGGCCTGGCACTTGG + Intronic
903853864 1:26324126-26324148 CTGATACAGGGGCTGGCACAGGG - Intronic
904039838 1:27577424-27577446 CATAGTCTGGGACTGACACTTGG - Intronic
905284406 1:36869873-36869895 CTGAGAATGGGACTGGCAGTGGG + Intronic
905942428 1:41874802-41874824 TTTCCTCAGGGACTGGCACTTGG - Intronic
906262595 1:44405664-44405686 CGGGGGCAGGGACTGGGACTCGG + Intronic
908492050 1:64654872-64654894 CTCAGCCAGGGGGTGGCACTTGG + Intronic
908794483 1:67817539-67817561 CTGAGCCAGGGCAAGGCACTGGG - Intronic
909470295 1:76020250-76020272 CTGAGGGAGGGACTTGTACTGGG - Intergenic
911721787 1:101198996-101199018 CTGGGTTAGGAACTGGCAGTCGG - Intergenic
912524120 1:110268194-110268216 CTGAGTCAGGTACTGGGAGGGGG - Intronic
912883745 1:113447270-113447292 CCAAGTCAGGGACTGGCATCTGG + Intronic
912938195 1:114021932-114021954 CTGAGACAGGTCCTGGCACTAGG - Intergenic
915332184 1:155119908-155119930 CTGGGTGAGGGACTGGCAGGAGG - Intergenic
915673697 1:157511501-157511523 CAGAGACAGGTCCTGGCACTAGG - Intergenic
916143757 1:161722463-161722485 ATGAGACAGTGCCTGGCACTTGG + Intronic
917159128 1:172037752-172037774 CTCAGTCATGGAGTTGCACTGGG + Intronic
919813023 1:201420878-201420900 CTGAGTCAGGGACCGCCACACGG + Intronic
921493406 1:215806802-215806824 CTGCCTCAGGGAGTGGCAGTAGG - Intronic
1064268333 10:13843208-13843230 CTGAGTCAGAGGCTGGGAGTGGG - Intronic
1065793129 10:29279954-29279976 CTGACTGAGTGTCTGGCACTAGG + Intergenic
1067175877 10:43945157-43945179 GTGGGTCAGGGACAGACACTGGG - Intergenic
1067524748 10:47031558-47031580 CTGAGCCAGGGAATGACAGTGGG + Intergenic
1067837194 10:49648919-49648941 CTGAGTCAGGGCCAGGCCCACGG + Intronic
1068514168 10:58005388-58005410 CTGTGTCAGGCTCTGGGACTTGG - Intergenic
1071147184 10:82588923-82588945 CTGAATGAGGGAATGGCTCTGGG - Intronic
1071573048 10:86708445-86708467 CTGAGTCAGGGACTGGCACTGGG - Intronic
1072188612 10:93063428-93063450 CTGGGTCCGGGGCTGGCGCTGGG - Intronic
1074366158 10:112859105-112859127 CTGAGTGAGAGACTGGCTCCTGG + Intergenic
1075653323 10:124144640-124144662 CTGAGTGAGGGCCTGGCACCCGG + Intergenic
1076463850 10:130665151-130665173 CAGAGTCAGGGCCTGGAATTTGG - Intergenic
1077244370 11:1528959-1528981 CTGAGTCAGAGAATGGCACTTGG + Intergenic
1077352882 11:2100933-2100955 CTGAGTGGGAGACTGGCACTGGG + Intergenic
1077407036 11:2387283-2387305 CTGAGTCAGGGTTTGTCACCAGG + Intronic
1080283878 11:30586350-30586372 CAGTGACAGGGACTGCCACTGGG + Intronic
1081075593 11:38668880-38668902 CTGAGGCTGTGACTGGCATTAGG - Intergenic
1081504235 11:43698076-43698098 CTGAGACAGGGACTGGGAGAGGG + Intronic
1083755826 11:64791183-64791205 CTGGCTCAGGGCCTGGCACCAGG + Intronic
1084162183 11:67355919-67355941 CTGAGTCAGGGCATGCCAGTTGG - Intronic
1085054407 11:73395394-73395416 CTGAGTCAGGGGCTGGCTTCTGG - Intronic
1085158208 11:74315834-74315856 CTGATTCTGGGACTGGGGCTGGG - Intergenic
1086407303 11:86509269-86509291 CTGAGTCCGTGACTGAAACTTGG + Intronic
1086920252 11:92578667-92578689 GTGATTCAGGGACTAGCAATGGG - Intronic
1088729431 11:112667875-112667897 CTGAGACAGGAGTTGGCACTTGG - Intergenic
1089422440 11:118341958-118341980 CTGAATCTGGGACTGGCCATGGG - Intronic
1089635321 11:119808076-119808098 CTGTGGCAGGGAGTGGCAATAGG + Intergenic
1090382391 11:126336580-126336602 GTGAATCAGGGACTGGCCGTGGG + Intronic
1096971531 12:55670400-55670422 CTGGGGCAGGGACTGGGGCTGGG - Intergenic
1096971567 12:55670575-55670597 CTGGGACTGGGACTGGGACTGGG - Intergenic
1097000161 12:55869511-55869533 CTGAGTCTGGGAGTGGTCCTAGG + Intergenic
1098123398 12:67266211-67266233 CTGAGCCACGGACTGGCCCAGGG + Intergenic
1101600503 12:106205552-106205574 CTGTGGCAGGGACAGGCACCTGG - Intergenic
1104725810 12:131075014-131075036 CAGAGGCGGGGGCTGGCACTGGG + Intronic
1105274412 13:18906239-18906261 CAGAAACAGGAACTGGCACTTGG + Intergenic
1105576884 13:21662022-21662044 CTGAGACAGTTACAGGCACTGGG - Intergenic
1106125298 13:26895982-26896004 GTGAGATAGGGACTGGCACGGGG - Intergenic
1106627450 13:31434864-31434886 CTGAGTCATTGACTTGGACTGGG - Intergenic
1107980261 13:45728192-45728214 CTGAGGCAGGGGCTGGAACATGG + Intergenic
1110710368 13:78644278-78644300 CTAAATCAGGGACTTGCTCTAGG - Intronic
1111639591 13:90950341-90950363 CTGAGTCATTGATTGACACTAGG + Intergenic
1112258404 13:97856037-97856059 CTGGCACAGGGACTGGCTCTGGG + Intergenic
1112994167 13:105552315-105552337 GTGTGTCAGTGACTTGCACTTGG - Intergenic
1113087341 13:106581870-106581892 AGGAGTCAGGGGCTGGCACAAGG - Intergenic
1113878316 13:113608252-113608274 CAGGGCCAGGGACTGGCACTGGG - Intronic
1116948669 14:50859086-50859108 CTGAGACAGGGACTATCTCTGGG - Intronic
1117375586 14:55115651-55115673 CACAGCCAGGGACTGGGACTTGG + Intergenic
1120608924 14:86614928-86614950 TTGAGACAGGGTCTGGCTCTGGG - Intergenic
1122182432 14:99966010-99966032 CCGAGGCAGGTCCTGGCACTAGG + Intergenic
1122309928 14:100788003-100788025 CTGAGGCAGAGACTTGCATTAGG - Intergenic
1122352227 14:101102923-101102945 CTCAGGCAGGGACTGGAGCTCGG + Intergenic
1122651834 14:103230673-103230695 CTGGGACAGGGGCTGGCTCTGGG - Intergenic
1122965084 14:105119709-105119731 CCCAGACAGGGACTGGAACTGGG + Intergenic
1123035604 14:105470755-105470777 CTGAGTCAGGGAGAGGGACTGGG - Intergenic
1125177605 15:36842649-36842671 CTGAGACAGTGGATGGCACTTGG - Intergenic
1126125960 15:45294530-45294552 CTGAGTTAGAGAGTGGCAGTGGG - Intergenic
1128734730 15:70046837-70046859 CTGTGGCAGGGACTGACTCTTGG + Intergenic
1128787424 15:70408332-70408354 CTAGGACAGTGACTGGCACTTGG + Intergenic
1128889533 15:71318332-71318354 GAGAGCCAGGGAATGGCACTAGG + Intronic
1129615772 15:77098001-77098023 TTGGGGCAGGGGCTGGCACTAGG - Intergenic
1130355891 15:83130068-83130090 CTGCATCAGGGACTGGTACCAGG - Exonic
1131552943 15:93373432-93373454 GTGAGGCAGGGAGTGGCAATTGG + Intergenic
1132594779 16:743814-743836 CTGGCTCAGGGACTAGCACGTGG - Intronic
1132844151 16:1992333-1992355 CTGAGGCAGGGAGTGTCAATGGG + Intronic
1133278944 16:4654318-4654340 CTGTGTCAGGAACTGGGGCTGGG + Intronic
1133284464 16:4684127-4684149 CTCAGGCAGGGCCTGGCTCTTGG + Intronic
1133473366 16:6096873-6096895 CTGAGGAAGGGTCTGGGACTTGG - Intronic
1133707132 16:8365515-8365537 TTGAGTCAGGAACTGGGATTTGG - Intergenic
1134535889 16:15026914-15026936 CTGGTCCAGGGACTGGCATTTGG - Intronic
1135212587 16:20536430-20536452 CTGGGTCAGTGCCTGGCACATGG + Exonic
1136397101 16:29999069-29999091 CTGAGGCAGGGATTGGCATGTGG + Intronic
1137052003 16:35722360-35722382 CTGGGACCGGGACTGGGACTGGG + Intergenic
1137640387 16:50023903-50023925 GTTAGTCAGTGACTGGTACTTGG + Intergenic
1139372901 16:66479662-66479684 CTGAGGCAGAGACTGGCCTTAGG + Intronic
1139860164 16:70013874-70013896 CTGGTCCAGGGACTGGCATTTGG + Intergenic
1141551359 16:84808784-84808806 CTGAGGGAGGGACTGACCCTGGG + Intergenic
1141979334 16:87540375-87540397 CTGAGTGAGGCACTGGCATAGGG - Intergenic
1143497044 17:7318318-7318340 CTGAGCCAGGGGCTGCCAGTGGG - Exonic
1144494450 17:15737553-15737575 CTGCTTCAGGGACTGGGAATCGG + Intronic
1144905815 17:18639123-18639145 CTGCTTCAGGGACTGGGAATCGG - Intronic
1144995254 17:19263685-19263707 CTGGGTCAGTGCCTGGCACATGG + Intronic
1145882338 17:28361301-28361323 CTGAGTCGGTGACTGCCAATTGG - Exonic
1146513783 17:33473183-33473205 CTGGGGCAGGGACTGGCATGGGG + Intronic
1146873414 17:36389922-36389944 CTGGGGCTGGGGCTGGCACTGGG + Intronic
1147264132 17:39225042-39225064 CTGAGCCCGGGACTGGGACCCGG + Intronic
1148133068 17:45274005-45274027 CTGACTCAGGGCCTGCTACTGGG + Intronic
1148725166 17:49783953-49783975 CTGAGTCAACAACTGGCAGTGGG + Intronic
1150494976 17:65600714-65600736 CTGGGAAAGGGACTGGCATTCGG + Intronic
1152568410 17:81110652-81110674 CAGAGTGAGCGACTGTCACTGGG - Intronic
1152665646 17:81567574-81567596 CTGTTTCGGGGTCTGGCACTGGG - Intronic
1152740647 17:82016971-82016993 CAGGGTCAGGGGCTGGCAATGGG - Exonic
1152784676 17:82241569-82241591 CTCAGGCAGGAACTGGAACTTGG + Intronic
1152919122 17:83057032-83057054 CGGAGTCAGGGGCTTGCACATGG + Intergenic
1153248207 18:3094496-3094518 CTGATGCTGGGACTGTCACTTGG + Intronic
1154466098 18:14643494-14643516 CAGAAACAGGAACTGGCACTTGG + Intergenic
1157746658 18:50141847-50141869 GTGAGGCAGGGAATGGGACTGGG - Intronic
1160238778 18:77107316-77107338 CTGGGCCAGGAACAGGCACTTGG - Intronic
1161507037 19:4649719-4649741 CTGACTCAGGGTCTGCCACGTGG + Intronic
1161969550 19:7569549-7569571 CTGACTCTGGGCCAGGCACTGGG - Intergenic
1162316415 19:9941233-9941255 GGGACTCAGGGTCTGGCACTGGG + Intergenic
1163785182 19:19271282-19271304 CTGAGCAAGGGCCTGGCACAGGG - Intronic
1165752692 19:38270397-38270419 GTGAGTCAGTGCCTGGCAATTGG - Intronic
1165920225 19:39292827-39292849 CTGAGTCAGGGAAGTGCTCTAGG - Intergenic
1166677328 19:44748033-44748055 CCGGGGCAGGGACTGGCACTCGG - Intronic
1166810283 19:45510004-45510026 CTGTGTCCGGGACTGGAGCTGGG + Intronic
1167043941 19:47039261-47039283 CTGGGTCTGGGAATGGGACTGGG + Intronic
1167096896 19:47379497-47379519 CTGAGTCAGGGAAGGGGGCTGGG - Intronic
1167153408 19:47723096-47723118 TTGGGTCAGGCACTGGCCCTGGG + Intronic
925381193 2:3427310-3427332 CTGGGCCGGGGACTGGAACTGGG + Intronic
926200007 2:10788120-10788142 CTGAGTTAAGGACTGGATCTAGG - Intronic
926311665 2:11679994-11680016 CTGAGTCTGGGACTAGTCCTTGG + Intronic
927399476 2:22694604-22694626 CTGAGTCAGGGACTGGTCAATGG - Intergenic
927856513 2:26530916-26530938 GTGACTCAGGGTCTGGGACTGGG + Intronic
931173120 2:59825975-59825997 CTGAGGCACAGACTGGCCCTAGG + Intergenic
931714647 2:65019567-65019589 CACAGGCAGGGCCTGGCACTGGG + Intronic
932436431 2:71704883-71704905 CTGAGTCAGGGACCAGAACTGGG + Intergenic
932767676 2:74481816-74481838 CTGAGTCAGGCACTGGGTCAGGG - Exonic
934654442 2:96109955-96109977 CTGGGGCAGGGAGTGGCAGTGGG + Intergenic
934769586 2:96899360-96899382 CTGTGCCAGGTACTGGCACTGGG - Intronic
935749150 2:106215130-106215152 CTTAGTCATGGACTGCCTCTGGG - Intergenic
935787081 2:106559120-106559142 CTGTGTCAGAGACTGTGACTTGG + Intergenic
937637175 2:124169258-124169280 CTGGGTTAGGGACTGGCTCGGGG + Intronic
940209087 2:151237826-151237848 GTGAGTCAGGGGCTGGTCCTTGG - Intergenic
941062800 2:160866859-160866881 CTGAATCAGGGATGGGCCCTTGG - Intergenic
942888297 2:180955911-180955933 CTGGGGAAGGGTCTGGCACTTGG + Intergenic
943576504 2:189637309-189637331 CTGTGTCAGGCACTGGAACAGGG + Intergenic
944914685 2:204346310-204346332 CAGATTCAGAGTCTGGCACTTGG - Intergenic
945415005 2:209559797-209559819 CTGACTCCAGGACTGGCACAGGG - Intronic
946433104 2:219635888-219635910 CTGGGTAAGGGACTGGGGCTTGG + Exonic
947518902 2:230829005-230829027 CTGCGTCAGGGACAGTCCCTTGG - Intergenic
947552578 2:231057101-231057123 CTGAGTCAGGGCCGGTGACTGGG + Intronic
947719832 2:232363659-232363681 CTGGGTCAGGGAGGGGCACCGGG - Intergenic
948380482 2:237547091-237547113 CTGAGTAAGGGCCAGGCCCTGGG + Intronic
1169228558 20:3871515-3871537 CTGAGGCAGGGGCTTCCACTAGG + Exonic
1170044983 20:12075324-12075346 ATGGATCAGGGACTGGAACTAGG + Intergenic
1170625661 20:18028127-18028149 CTAGGTCAGGGGCTGGGACTAGG + Intronic
1171993776 20:31716902-31716924 CTGAGTCAGGCAATCCCACTGGG - Intronic
1172693860 20:36808484-36808506 TTGGGCCAGGGACTGGGACTGGG - Intronic
1174001790 20:47380103-47380125 GAGTGTCAGGGACTGGCCCTTGG - Intergenic
1174689913 20:52493594-52493616 CAGAGTCAAGGACTGTCACGTGG - Intergenic
1175082884 20:56436101-56436123 CTGGGTCTGGGCCTGACACTGGG + Intronic
1175412048 20:58776899-58776921 CTGGCTCAGGGCCTGGCACATGG - Intergenic
1175520684 20:59600753-59600775 CTGAGTCAGGAAATGGCTTTGGG + Intronic
1175809019 20:61847469-61847491 CAGAGACAGTGGCTGGCACTGGG + Intronic
1176091087 20:63318949-63318971 CAGCCTCAGGGACTGGCACTGGG + Intronic
1176808487 21:13515102-13515124 CAGAAACAGGAACTGGCACTTGG - Intergenic
1179579158 21:42329219-42329241 CTGAGGCTGGGAGTGGCACATGG + Intergenic
1179730230 21:43363610-43363632 CTGGGTCAGAGAGAGGCACTGGG + Intergenic
1180944986 22:19687909-19687931 CTGGGGCAAGGGCTGGCACTGGG + Intergenic
1181200955 22:21216734-21216756 ATGAGTCAGGGACTGTGCCTGGG - Intronic
1181306466 22:21919972-21919994 CTGAGGCTGGGACTGCCTCTGGG + Exonic
1181371970 22:22425880-22425902 GAAAGGCAGGGACTGGCACTGGG + Intergenic
1181651086 22:24259645-24259667 CTGAGTCCAGGCCTGGCCCTCGG - Intergenic
1181700786 22:24620239-24620261 ATGAGTCAGGGACTGTGCCTGGG + Intronic
1181959288 22:26611313-26611335 CCGAGTCAGTGCCTGGCACCTGG + Intronic
1182388197 22:29965086-29965108 CTGAGACAGGGACTGGGGTTTGG - Intronic
1182660078 22:31918942-31918964 CTGAGCCAGGAGCTGTCACTGGG + Intergenic
1184235187 22:43179508-43179530 CTGGCTCAGGGCCTGGCACCCGG + Intronic
1184533097 22:45069508-45069530 CTGAGTCAGGGGCTCTCTCTGGG + Intergenic
950097723 3:10339529-10339551 CTGTGACAGGGTCTGGAACTTGG + Intronic
951293515 3:20903500-20903522 CTGAGGAAGGGTCTGGCACAAGG - Intergenic
951496875 3:23338591-23338613 CTGAATTGGGGACTGGGACTGGG + Intronic
952980363 3:38729133-38729155 CTGAGTCAGGGTCTTCTACTGGG + Intronic
954096245 3:48331038-48331060 CTTAGTCAGGGACTGCATCTGGG + Intergenic
954413121 3:50379918-50379940 CTGGGGCAGGGACGGGCAATGGG - Intronic
954863332 3:53708420-53708442 CTGACTCAGGGGCTGGCCCTAGG + Intronic
956035693 3:65088885-65088907 CTTATTCAGGGACTGACACTGGG - Intergenic
959056218 3:101570168-101570190 CTGAATCAGAAACTGGCAATGGG + Intergenic
959882799 3:111464939-111464961 CTTAGTTAGGGGCTGGGACTGGG - Intronic
961032406 3:123618121-123618143 CTAAGTCACGGAGTGGCTCTGGG - Intronic
961644171 3:128383699-128383721 CTGACTCAGGGCCTGGCACGAGG - Intronic
962974825 3:140436931-140436953 CAGAGACAGACACTGGCACTGGG - Intronic
966178090 3:177161230-177161252 AGGAGTCAAGGACTGGCACAGGG - Intronic
966481270 3:180411779-180411801 CTGAGTAAGGGTCTGGCACTAGG - Intergenic
967812920 3:193775549-193775571 GTGAGCCAGGGAGTGGCAGTTGG - Intergenic
969970397 4:11040975-11040997 ATGATTCAGGGCCTGGCATTTGG - Intergenic
970313176 4:14804211-14804233 CCTAGACAGGGACTGGCACAAGG + Intergenic
972071999 4:35032515-35032537 CTGAGCCAGGGAGTGGCTATGGG - Intergenic
981615589 4:146640164-146640186 CTGAGTCCCGGGCTGGCCCTGGG + Exonic
983116839 4:163829012-163829034 CAGAGTTAGGGAAGGGCACTTGG + Intronic
983488548 4:168360713-168360735 CAGAGTCTGGGAAAGGCACTGGG + Intronic
983907109 4:173195329-173195351 CTGAGTGACTGACTGGCTCTGGG + Intronic
984882964 4:184426389-184426411 CTGAGGCAGAGACTGGAAATAGG - Intronic
985722596 5:1497593-1497615 CTGGGTCAGGGACGGCCCCTGGG + Intronic
986981909 5:13457758-13457780 CTCAGTCAGTGGCTGTCACTGGG + Intergenic
993057720 5:83001583-83001605 CTGAGCCAGGAACTAGCTCTGGG + Intergenic
993518237 5:88864450-88864472 CTGAATCTGGGAGTGGAACTTGG + Intronic
995589564 5:113685365-113685387 CTGAATCAGGAACTGGGAATGGG - Intergenic
995998350 5:118327501-118327523 CAGTGTCAGTGACTGGCACATGG + Intergenic
998833600 5:146183728-146183750 CTGAGTCAGGCAATGGGACCAGG - Intergenic
1001097411 5:168786494-168786516 CTGAGTCAAGGACTGGCTCTCGG + Intronic
1001424702 5:171615662-171615684 ATGAGGCAGGGCCTGTCACTTGG + Intergenic
1001966592 5:175914097-175914119 CTCCGTTAGGGCCTGGCACTCGG - Intergenic
1002204552 5:177553956-177553978 CTGGGACTGGGACTGGGACTGGG - Intronic
1002609307 5:180403947-180403969 CTGAGTGTGGGTCTGACACTTGG - Intergenic
1007412970 6:41675390-41675412 CTGGGTCAGGCCCTGGCTCTTGG + Intergenic
1007777800 6:44233469-44233491 CTGTGTCTGGGTCTGGCACTGGG + Exonic
1007901783 6:45420257-45420279 CAGAGTCCGCGACTGGCACCAGG + Intronic
1009661502 6:66617911-66617933 ATGATTCAGGGAGTGGCAATTGG - Intergenic
1010057088 6:71579143-71579165 CTGAGTCAGAAACTGGAACTGGG + Intergenic
1010748559 6:79592296-79592318 CCTAGTCAAGGACTGGCACAAGG - Intergenic
1011077213 6:83449868-83449890 CTTAGTCAGGGACTGCATCTGGG - Intergenic
1011208866 6:84932919-84932941 ATGATTCAGAGCCTGGCACTAGG + Intergenic
1011248805 6:85348653-85348675 CTGATCCTGGGACTCGCACTGGG - Intergenic
1016639923 6:146336772-146336794 CAGAGTCGGGTACTGGAACTGGG - Intronic
1016833368 6:148454261-148454283 CTGGGTCAGGGGCTGGCATGGGG - Intronic
1018810326 6:167294007-167294029 CTTAGACAGTGACGGGCACTCGG + Intronic
1019330652 7:459025-459047 CTGAGTCAGAGACTGGAAGGCGG - Intergenic
1019469801 7:1213139-1213161 CAGAGTGAGGGAAAGGCACTTGG - Intergenic
1019688134 7:2393828-2393850 CTGAGTCGGGGCTTGGCACGTGG - Intergenic
1019734932 7:2645904-2645926 CTGAGACGGGGACGGGCTCTGGG + Intronic
1023938110 7:44754187-44754209 CTGAGTCAGGCTATGGGACTGGG + Intronic
1024007641 7:45238984-45239006 CTGAGACAGGTCCTGGCACGAGG - Intergenic
1024649198 7:51389981-51390003 GTGAGGCAGGAACTGACACTTGG + Intergenic
1025986746 7:66459871-66459893 CTTAGCCAGGGATTGGAACTGGG - Intergenic
1026003271 7:66580119-66580141 CTTAGCCAGGGATTGGAACTGGG - Intergenic
1026028268 7:66765549-66765571 CTTAGCCAGGGATTGGAACTGGG + Intronic
1027050039 7:75016134-75016156 CCCACTCAGGGCCTGGCACTAGG + Intronic
1027182656 7:75951800-75951822 CTGTTTCAGGGACTCTCACTTGG + Intronic
1029382999 7:100225534-100225556 CCCACTCAGGGCCTGGCACTAGG - Intronic
1030337733 7:108343957-108343979 CTTAGTCATGGACTGCCTCTGGG - Intronic
1033652513 7:143353497-143353519 CTGGGTGGGGGACTGGCAGTGGG + Exonic
1034629106 7:152516711-152516733 CTGGGACAGTGACTGGCACAGGG + Intergenic
1039032432 8:33324882-33324904 CTGAGACAGAGCCTAGCACTGGG - Intergenic
1039697914 8:39931903-39931925 GTGAGAGAGGGACTGACACTGGG + Intergenic
1040991322 8:53353213-53353235 CTGAGGCAGGTCCTGGCCCTAGG + Intergenic
1041413540 8:57582447-57582469 CTTGGTCTGGGACTTGCACTTGG + Intergenic
1043044880 8:75310150-75310172 CTGTCTCAGAGACTGCCACTAGG + Intergenic
1044021500 8:87111146-87111168 CTGTTTCAGGGACTTGCACTTGG + Intronic
1044335074 8:90973175-90973197 CTGAGTCAGGGTATCGAACTTGG + Intronic
1047881168 8:129195304-129195326 CTGAAGCAGGAACTGGCACATGG - Intergenic
1050081477 9:1920354-1920376 CTGAGGAATGGAGTGGCACTGGG - Intergenic
1051162967 9:14229718-14229740 CTCAGTGAGGGTCTTGCACTGGG - Intronic
1053071436 9:35104400-35104422 CAGAGTCAGGGCCAAGCACTGGG - Exonic
1053158718 9:35798737-35798759 CTGAGGCAGGGCCTGAGACTGGG + Intronic
1056715337 9:89023943-89023965 CTGAGTCAGGAACTCGGAATGGG - Intronic
1057009505 9:91589268-91589290 CTGCGTCAGGGACTTTCTCTTGG - Intronic
1057274770 9:93670437-93670459 CTGAGTCAGGGGCCTGCCCTGGG - Intronic
1057792213 9:98131907-98131929 CTGAGTCTGGGACCAGGACTAGG - Intronic
1058915634 9:109561715-109561737 CTGTGCCAGAGGCTGGCACTTGG + Intergenic
1060233207 9:121840898-121840920 ATGAATCAGGCACTGGCACGAGG + Intronic
1060521602 9:124297194-124297216 CTGAGGCAGGGACTTGCCCAGGG - Intronic
1060854261 9:126902353-126902375 CTGAGACAGGTCCTGGCACTAGG + Intergenic
1061313197 9:129777350-129777372 CTCAGGCAGGGACTGGCCCTGGG + Intergenic
1061807382 9:133144042-133144064 CTGAGGCAGGGTCTGGGGCTGGG + Intronic
1061808964 9:133151563-133151585 ATGAGTCAGGGACTCCCACCCGG + Intergenic
1062090915 9:134678451-134678473 CTGAGTCAGGGACACACACCGGG - Intronic
1062197673 9:135283152-135283174 CAGGGTCAGGGGCTGGCACAGGG + Intergenic
1062598299 9:137308983-137309005 CTCAGTCGGGGGCTGGCACGGGG - Intronic
1062598449 9:137309580-137309602 GTGTGTCAGGGTCAGGCACTGGG - Intronic
1185892956 X:3836414-3836436 CTGGGACTGGGACTGGGACTGGG - Intronic
1185898065 X:3874834-3874856 CTGGGACTGGGACTGGGACTGGG - Intergenic
1185903184 X:3913265-3913287 CTGGGACTGGGACTGGGACTGGG - Intergenic
1186047046 X:5547886-5547908 CTGAGTAGGGGACTGGGACTGGG + Intergenic
1190294589 X:49017893-49017915 TTGAGACAGGGTCTGGCTCTTGG - Intergenic
1190594112 X:52035874-52035896 CTGAGTCACAGTCTGGCACTTGG - Intergenic
1191166615 X:57399073-57399095 CTTAGTCATGGACTGCAACTGGG + Intronic
1192372583 X:70526815-70526837 CTGATTCCGGGTCTGGCACAGGG + Intergenic
1192390216 X:70718567-70718589 CTGAGTCAGGGATTTTCCCTTGG + Intronic
1192968742 X:76207907-76207929 CTGAGACAGGTCCTGGCACTAGG - Intergenic
1195095125 X:101494123-101494145 CTGAGTCTGGGGCTGGGATTTGG + Exonic
1196058895 X:111386368-111386390 CTTGGTCCGGGGCTGGCACTTGG - Intronic
1196164912 X:112528210-112528232 TTGAGTCAGGGACTGTTTCTAGG + Intergenic
1196761215 X:119202593-119202615 CAGAGCCAGGGACTGGCTCAAGG - Intergenic
1196893474 X:120311289-120311311 CTGAGTCAGGGACTGATGCATGG + Exonic
1197998590 X:132407837-132407859 CTGATGGAGGGAGTGGCACTTGG + Intronic
1198542311 X:137652820-137652842 TTGAGTCATGGACTGGGGCTTGG + Intergenic
1199753425 X:150842885-150842907 CTTAAGCAGGGACTGGCGCTTGG + Intronic
1200960804 Y:8994162-8994184 CTGAGGCAGGCTCTGGCACTTGG - Intergenic