ID: 1071573049

View in Genome Browser
Species Human (GRCh38)
Location 10:86708446-86708468
Sequence CCTGAGTCAGGGACTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 367}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573049_1071573057 0 Left 1071573049 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG 0: 1
1: 0
2: 5
3: 55
4: 367
Right 1071573057 10:86708469-86708491 ACCTGTAGCTCCTGGGCTGTGGG No data
1071573049_1071573056 -1 Left 1071573049 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG 0: 1
1: 0
2: 5
3: 55
4: 367
Right 1071573056 10:86708468-86708490 GACCTGTAGCTCCTGGGCTGTGG No data
1071573049_1071573054 -8 Left 1071573049 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG 0: 1
1: 0
2: 5
3: 55
4: 367
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573049_1071573055 -7 Left 1071573049 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG 0: 1
1: 0
2: 5
3: 55
4: 367
Right 1071573055 10:86708462-86708484 ACTCAGGACCTGTAGCTCCTGGG No data
1071573049_1071573060 21 Left 1071573049 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG 0: 1
1: 0
2: 5
3: 55
4: 367
Right 1071573060 10:86708490-86708512 GGCAAAGTGTCCTCCAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573049 Original CRISPR CCTGAGTCAGGGACTGGCAC TGG (reversed) Intronic
900573726 1:3372830-3372852 CCTGAGTCAGGGCCACGGACGGG + Intronic
900697350 1:4020572-4020594 ATTGAGTCAGGGACTGGATCGGG + Intergenic
901126670 1:6934315-6934337 CCTCAGTCAGGGCATGGCAGAGG + Intronic
902247562 1:15131062-15131084 CCTGGTTCAAGGTCTGGCACAGG - Intergenic
902888581 1:19424891-19424913 CCGGATTCAGGGCCTGGCCCAGG - Intronic
903450064 1:23447161-23447183 CCTGGGCCATGGACTGGTACAGG - Intronic
903853865 1:26324127-26324149 ACTGATACAGGGGCTGGCACAGG - Intronic
904003916 1:27353505-27353527 CCTGAGACAGGCCCTGGGACAGG + Intronic
904466215 1:30709076-30709098 TCTGTGTCAGGCACTGGCTCAGG - Intergenic
904891461 1:33782720-33782742 CCTAATTCAGTGCCTGGCACAGG - Intronic
905328594 1:37176016-37176038 AGTGAGTCAGGGAGTGACACAGG - Intergenic
906378529 1:45316622-45316644 CCTGAGTCCGTGACTGGCGCCGG - Intergenic
906609366 1:47191083-47191105 CCTTGGTCAGGGGCTTGCACAGG - Intergenic
908311361 1:62887801-62887823 CCTGAGACAGGGTCTCGCTCTGG - Intergenic
908432765 1:64074742-64074764 CCTGTGTTAGAGACTGGCACAGG + Intronic
908794484 1:67817540-67817562 CCTGAGCCAGGGCAAGGCACTGG - Intronic
909729195 1:78872929-78872951 CCTGAGTCTGTGACCGGCGCCGG - Intergenic
911505119 1:98739308-98739330 CCTGGGCCATGGACTGGTACTGG - Intronic
912524121 1:110268195-110268217 GCTGAGTCAGGTACTGGGAGGGG - Intronic
912815535 1:112825322-112825344 CCTGAGTCCGTGACTGGCACCGG + Intergenic
914951420 1:152118335-152118357 GCTGAGTCAGGGCCTGGGCCAGG - Intergenic
915108785 1:153549965-153549987 CCTGACCCAGGGTCTGGCATTGG - Intronic
915352150 1:155233510-155233532 CCTGAGACAGATACTGGCCCTGG + Intergenic
915359844 1:155279262-155279284 CCTCATTCAGAGAATGGCACAGG - Intronic
915608639 1:156972249-156972271 CCTGAGGATGGGACTGGCACAGG - Intronic
916490283 1:165296366-165296388 AGTGAGGCAGGGAATGGCACAGG + Intronic
916839479 1:168584908-168584930 CCTGAGTCAGGTGGTGGCAGTGG + Intergenic
917091467 1:171357812-171357834 ACTGAGGCAGTGGCTGGCACTGG - Intergenic
917789603 1:178491121-178491143 CCTCAGGCAGGGACTGGCAGTGG - Intergenic
918095378 1:181329992-181330014 CCTGAGTCAGGGACTGGGAGGGG - Intergenic
918332838 1:183475673-183475695 CCTGAATAAGGTACTGGCAGTGG + Intronic
918752742 1:188292893-188292915 TCTGAGCCAGGGACTGGAATAGG - Intergenic
919746828 1:201014119-201014141 TCAGAGTCAGGATCTGGCACAGG + Intronic
920184550 1:204151941-204151963 CCTGAGTCATGGACTTCCCCTGG - Exonic
920209017 1:204314669-204314691 CTTGACTCAGGGAAGGGCACAGG - Intronic
922545500 1:226453586-226453608 CCAGAGTCAGGGCCTGGCCCAGG - Intergenic
922551207 1:226495840-226495862 CCTGAGCCAGGACCTGGAACAGG + Intergenic
922605958 1:226890146-226890168 CCCGAGTCAGGCAGAGGCACGGG - Intronic
922755196 1:228092686-228092708 CATGAGTCAGGGAAGGGAACAGG - Intronic
924015130 1:239712982-239713004 CCTGTGTCAGGGATTGGAAGGGG - Intronic
1063106611 10:2997740-2997762 CCTGAGTCCGTGACCAGCACCGG + Intergenic
1063364906 10:5484459-5484481 CATGAGTCAGGAGCTGGCTCTGG + Intergenic
1064218239 10:13418080-13418102 CCTGGGCCATGGACTGGTACTGG + Intergenic
1065184005 10:23155101-23155123 CCGGGGTCAGGGACTGGCCTTGG + Intergenic
1065261188 10:23925315-23925337 CCTAACCCAGGGCCTGGCACTGG - Intronic
1066437550 10:35407960-35407982 CCCGAGTCCGTGACTGGCGCTGG + Intronic
1066524905 10:36266999-36267021 GCTGAGGCAGGGATTGGCCCTGG + Intergenic
1066566366 10:36725726-36725748 GCTGACTCAGGGGCTGGCAGAGG - Intergenic
1067524747 10:47031557-47031579 CCTGAGCCAGGGAATGACAGTGG + Intergenic
1067616726 10:47762838-47762860 CCTGGGCCAGGGACTGGCTGGGG - Intergenic
1068929318 10:62573048-62573070 CCTGGGCCATGGACCGGCACTGG + Intronic
1071147185 10:82588924-82588946 CCTGAATGAGGGAATGGCTCTGG - Intronic
1071187042 10:83058158-83058180 CCTGAGTCTGTGACTGGTGCTGG - Intergenic
1071573049 10:86708446-86708468 CCTGAGTCAGGGACTGGCACTGG - Intronic
1072188613 10:93063429-93063451 CCTGGGTCCGGGGCTGGCGCTGG - Intronic
1074018788 10:109563173-109563195 CCCGAGTCTGTGACTGGCGCCGG - Intergenic
1074713311 10:116195655-116195677 CCTGGGCCATGGACTGGTACTGG - Intronic
1074764999 10:116694193-116694215 CATGTGTCAGGCACTGTCACGGG + Intronic
1076509648 10:131003614-131003636 CCTGCGTCAGGGGCTTGAACAGG + Intergenic
1076784909 10:132745030-132745052 CCTGAGCCAGCCACTGGCTCGGG - Intronic
1077233328 11:1468379-1468401 CCTGAGGCAGGGACCGGCGCTGG - Intergenic
1077352881 11:2100932-2100954 GCTGAGTGGGAGACTGGCACTGG + Intergenic
1078932235 11:15921472-15921494 GCTCAGTCAGGCACTGGCAGGGG + Intergenic
1079135271 11:17772930-17772952 CCTGAGTCAGAGACTCACACCGG - Intronic
1081504234 11:43698075-43698097 ACTGAGACAGGGACTGGGAGAGG + Intronic
1083909581 11:65698367-65698389 CCTGAGTCAGGGACTGGAGTGGG - Intergenic
1084709580 11:70835736-70835758 CTTGAGTCAGAGACTGACCCAGG - Intronic
1085158209 11:74315835-74315857 CCTGATTCTGGGACTGGGGCTGG - Intergenic
1085428733 11:76427960-76427982 CCTAGCTCAGTGACTGGCACAGG - Intergenic
1085656062 11:78316110-78316132 CCTGACACTGGGACTTGCACGGG + Intronic
1085987751 11:81806883-81806905 CCTGAGTCCGTGACCGGCGCCGG - Intergenic
1086125497 11:83344828-83344850 CCCGAGTCCGTGACCGGCACCGG + Intergenic
1088621154 11:111685326-111685348 CCTGGGTCACGGACCAGCACTGG - Intronic
1089026318 11:115274282-115274304 TCTGAATCACGGAATGGCACAGG + Intronic
1089347216 11:117798006-117798028 GCTGTGTCAGGCACTGGCTCAGG + Intronic
1089422441 11:118341959-118341981 CCTGAATCTGGGACTGGCCATGG - Intronic
1089952999 11:122547342-122547364 CCTGAGTCCGTGACCAGCACCGG - Intergenic
1090107791 11:123870328-123870350 CCTGAGTCCGTGACCGGCGCCGG + Intergenic
1090230928 11:125103093-125103115 CCTGGGCCATGGACTGGTACTGG + Intronic
1090422767 11:126587020-126587042 CCTGAGGCAGGGACTCTCTCTGG - Intronic
1090546745 11:127774162-127774184 CCTTAGTCTGTGACTGGCGCCGG + Intergenic
1090551640 11:127826350-127826372 TCTGGGTCATGGACTGGTACTGG + Intergenic
1093065882 12:14657507-14657529 CCTGGGCCATGGACTGGTACTGG + Intronic
1094316323 12:29140019-29140041 CCTGAGTCCGTGACTGGCGCCGG + Intergenic
1098123397 12:67266210-67266232 GCTGAGCCACGGACTGGCCCAGG + Intergenic
1099058382 12:77873886-77873908 CCTGGGCCATGGACTGGTACCGG + Intronic
1100432290 12:94541690-94541712 TTTGAGTCAGGGACTGGCAGAGG - Intergenic
1101844194 12:108349472-108349494 CCTGAGTCAGAGGCTCCCACAGG - Intergenic
1104006825 12:124898803-124898825 GCTGAGTTAGGGGCTGGCAAGGG - Intergenic
1104035431 12:125094009-125094031 GCTGAGTAAGGACCTGGCACAGG + Intronic
1104963068 12:132497424-132497446 CCTGAGTCAGAGGCAGCCACGGG + Intronic
1105576885 13:21662023-21662045 CCTGAGACAGTTACAGGCACTGG - Intergenic
1106125299 13:26895983-26896005 AGTGAGATAGGGACTGGCACGGG - Intergenic
1106557606 13:30823759-30823781 CTTGATTCAGGGACAGACACAGG - Intergenic
1106975255 13:35204004-35204026 CCTGGGCCATGGACTGGTACCGG + Intronic
1107431569 13:40345213-40345235 GCTGAGCCTGGGACTGACACGGG - Intergenic
1108202419 13:48057080-48057102 CCTGAGTCCGTGACCGGCGCCGG - Intronic
1108804071 13:54132422-54132444 CCCGAGTCCGTGACTGGCGCCGG + Intergenic
1112436869 13:99396750-99396772 CCGGAGTCAGGTATTGGCAAAGG + Intergenic
1113413339 13:110109190-110109212 CAGGAGTCAGGGACTAGCCCCGG + Intergenic
1113878317 13:113608253-113608275 ACAGGGCCAGGGACTGGCACTGG - Intronic
1115248420 14:31320375-31320397 GCTGATTCAGGGGCTGGCATTGG - Intronic
1116639284 14:47440390-47440412 CATGAGTGAGGAAATGGCACAGG - Intronic
1118361763 14:65063002-65063024 CCAGAGGCAGGGGCTGTCACAGG + Intronic
1118943085 14:70356450-70356472 CCTGGGCCACGGACTGGTACTGG - Intronic
1119819422 14:77601887-77601909 CCCGAGTCCGTGACCGGCACCGG - Intronic
1121817275 14:96938274-96938296 CCTGGGCCATGGACTGGTACTGG + Intergenic
1121951064 14:98171616-98171638 CCTGACTCAGGGAGTGGCCCAGG + Intergenic
1121980773 14:98451877-98451899 CCTGAGTCAGTGACCGGCACCGG + Intergenic
1122427441 14:101620161-101620183 CGAGAGTCAGGGTCAGGCACAGG + Intergenic
1122507433 14:102240596-102240618 CCTGAGTCTGTGACTGGTGCTGG - Intronic
1122651835 14:103230674-103230696 CCTGGGACAGGGGCTGGCTCTGG - Intergenic
1123035605 14:105470756-105470778 CCTGAGTCAGGGAGAGGGACTGG - Intergenic
1123065017 14:105614246-105614268 CCTGGGTCATGCACTGGAACCGG + Intergenic
1123069211 14:105633681-105633703 CCTGGGTCATGCACTGGAACCGG + Intergenic
1123115042 14:105890739-105890761 CCTGAGTGAGGGACAGAGACAGG + Intergenic
1123121510 14:105919035-105919057 CCTGAGTGAGGGACAGAGACCGG + Intronic
1123404226 15:20010700-20010722 CCTGAGTGAGGGACAGAGACGGG + Intergenic
1123513565 15:21017346-21017368 CCTGAGTGAGGGACAGAGACGGG + Intergenic
1123882692 15:24690289-24690311 CCCGAGTCCGAGACTGGCGCCGG + Intergenic
1124641964 15:31401417-31401439 CTTGAGTCAGGGCAAGGCACGGG + Intronic
1124951258 15:34323327-34323349 CCTGGGCCATGGACTGGTACTGG + Intronic
1125848886 15:42885489-42885511 CCTGAGTCCGTGACTGGTGCCGG - Intronic
1126530391 15:49704010-49704032 CCTGAGTCCAGGACTGGCGCCGG + Intergenic
1128600105 15:68988863-68988885 CCCGAGTCCGTGACCGGCACTGG - Intronic
1129190514 15:73934945-73934967 CCTGCCTCAGGGCCTTGCACTGG - Intronic
1129318250 15:74759246-74759268 CCTGACTCAGGGAGAGACACAGG - Intergenic
1129654015 15:77510767-77510789 CCTGAGCCAGGGGCTGGCCCAGG + Intergenic
1130843907 15:87726422-87726444 CATCTGTAAGGGACTGGCACAGG - Intergenic
1131472610 15:92709877-92709899 CCAGAGTCTGGGACTGTCACTGG - Intronic
1132735217 16:1382528-1382550 CCTGAGGGAGGGACTGGCCCTGG + Intronic
1132846160 16:2001831-2001853 CATGAGCCCGGGAGTGGCACAGG + Intronic
1133073008 16:3259093-3259115 CCAGAGTCAGGGACGGGTGCTGG - Intergenic
1133651133 16:7815400-7815422 CCCTAGTCCGTGACTGGCACTGG - Intergenic
1133750113 16:8718635-8718657 CCAGAGGCAGGGGCTGGCTCAGG - Intronic
1133937884 16:10283854-10283876 CCCGAGTCCGTGACTGGCGCCGG - Intergenic
1134763386 16:16734065-16734087 AGTGAGTCAGGGACTGCCAGGGG + Intergenic
1134982666 16:18625092-18625114 AGTGAGTCAGGGACTGCCAGGGG - Intergenic
1135104148 16:19632776-19632798 CCTGAGGGAGGGCCTGGGACAGG + Intronic
1136038676 16:27560819-27560841 CCTGGCACAAGGACTGGCACAGG + Intronic
1136529765 16:30860175-30860197 CCCGAGTCCGTGACCGGCACTGG - Intronic
1137065950 16:35843587-35843609 TCTGAGTCAGGGGCTGACATAGG + Intergenic
1137724396 16:50647220-50647242 CCTGAATCAGTCACTGGCAAAGG - Intergenic
1137945368 16:52728927-52728949 CCTGGGCCACGGACTGGTACTGG - Intergenic
1138583004 16:57953690-57953712 CCTGAGCCAGGGAGAGGCAGAGG - Intronic
1138907859 16:61360072-61360094 CCTGGGTCATGTACTGGTACTGG + Intergenic
1139352892 16:66348334-66348356 CCTGAGGCAGGGCTGGGCACTGG + Intergenic
1139659213 16:68409552-68409574 TCTGAGTCGGGCACTGGGACAGG - Intronic
1140792293 16:78403660-78403682 CCTCATCCAGGGCCTGGCACAGG - Intronic
1141979335 16:87540376-87540398 CCTGAGTGAGGCACTGGCATAGG - Intergenic
1143497045 17:7318319-7318341 CCTGAGCCAGGGGCTGCCAGTGG - Exonic
1144854000 17:18258262-18258284 CCTGAGTCAGGGCCTGGCTTGGG + Intronic
1145080849 17:19893149-19893171 CCCGAGTCCGTGACCGGCACTGG + Intergenic
1146513782 17:33473182-33473204 CCTGGGGCAGGGACTGGCATGGG + Intronic
1147403457 17:40194528-40194550 CCTGAGTGGGGGACTTGCAAGGG - Exonic
1147686865 17:42291355-42291377 CCTGGGCCATGGACTGGTACAGG - Intronic
1147892245 17:43725571-43725593 CCTGAGACAGGGCCTGGCTCAGG - Intergenic
1148133067 17:45274004-45274026 CCTGACTCAGGGCCTGCTACTGG + Intronic
1148244425 17:46021191-46021213 CCTGAGGCAGGGGAGGGCACTGG + Intronic
1148906092 17:50913177-50913199 CCTGGGTCAGGGAAAGGCAAAGG - Intergenic
1149532513 17:57406927-57406949 CCACAGTGAGGGGCTGGCACAGG - Intronic
1150577849 17:66445820-66445842 CTTGAGACAGGGTCTGGCTCTGG + Intronic
1150860685 17:68797301-68797323 CCTGAGTTCGTGACCGGCACTGG + Intergenic
1152322055 17:79613205-79613227 CCTGAGTCCTGGGCTGGGACTGG - Intergenic
1153103408 18:1500152-1500174 CCTGAGTAAGAGAAGGGCACCGG + Intergenic
1153816704 18:8796819-8796841 CATGAGTGAGGGACTGGCAGAGG + Intronic
1157171463 18:45410270-45410292 CCTGGGTCATAGACTGGTACTGG - Intronic
1157423150 18:47562812-47562834 CCTGGGCCATGGACTGGTACTGG + Intergenic
1157826785 18:50819615-50819637 CCCGAGTCAGGAACGGGCTCCGG - Exonic
1158192670 18:54848111-54848133 CCAAACTCAGTGACTGGCACAGG + Intronic
1159342920 18:67160356-67160378 CCTGAGCCATGGACTGGTGCTGG - Intergenic
1160042521 18:75358855-75358877 CCAGACTCAGAGTCTGGCACAGG - Intergenic
1160215706 18:76928021-76928043 CCTGAGCCAGGTCCTGGCACAGG + Exonic
1160537867 18:79604542-79604564 CCGGAGTCAGGGACTGGTGCTGG - Intergenic
1160678651 19:403809-403831 CCCCAGTCAGGGCCTGGGACGGG - Intergenic
1160857663 19:1224616-1224638 CCTGAGCCAGGACCCGGCACTGG + Intronic
1161034247 19:2075610-2075632 CGTGATTCAGGGCCTGGCACTGG - Intronic
1161375207 19:3936461-3936483 CCTGAGACATGGACAGGCCCCGG + Intronic
1161384349 19:3983071-3983093 CCTGAGGCACGGCCTGGAACCGG - Intronic
1162259865 19:9523877-9523899 CCTGGGCCATGGACTGGTACTGG - Intergenic
1162261802 19:9540038-9540060 CCTGAGTCCGTGACTGGAGCTGG - Intergenic
1163034070 19:14561502-14561524 CCTACCTCAGGGGCTGGCACAGG + Intronic
1163785183 19:19271283-19271305 CCTGAGCAAGGGCCTGGCACAGG - Intronic
1163944642 19:20523799-20523821 CCTGAGTCTAAGACTGGCACCGG + Intergenic
1164202691 19:23031546-23031568 CCCGAGTCTGTGACTGGCGCTGG + Intergenic
1164520057 19:28972262-28972284 CCTGAGTTAGACACTGTCACAGG + Intergenic
1165268443 19:34681757-34681779 CCTGGGCCACGGACTGGTACTGG - Intronic
1165775218 19:38400363-38400385 CCTGTCTCAGGGCCTTGCACTGG - Intergenic
925010778 2:484365-484387 CCTGGGTCAGGCACTGGAGCTGG + Intergenic
925381192 2:3427309-3427331 CCTGGGCCGGGGACTGGAACTGG + Intronic
926599676 2:14828695-14828717 CCTGAGTGAGGGAGTGGCAGTGG + Intergenic
926611563 2:14953105-14953127 ACTCAGTCAGTGACTGGCCCTGG + Intergenic
927049492 2:19313075-19313097 CTTGAGTCACAGACTGGCATAGG + Intergenic
927482847 2:23468159-23468181 CTTGAGGCAGGGACTGGGAGTGG + Intronic
929877332 2:45807759-45807781 CCTGAGTCAGGAGCTGCCAATGG + Intronic
931191159 2:60001712-60001734 CCTGAGCCAGGGTCCTGCACAGG + Intergenic
931718301 2:65047005-65047027 CCTAAGTCATGGACTTGTACAGG - Intergenic
932436430 2:71704882-71704904 CCTGAGTCAGGGACCAGAACTGG + Intergenic
932767677 2:74481817-74481839 GCTGAGTCAGGCACTGGGTCAGG - Exonic
933678481 2:85078306-85078328 CCTGGGTCTGGGGCTGGCAGGGG + Intergenic
933854048 2:86396308-86396330 CCTGATCCAGGGCTTGGCACAGG - Intergenic
934769587 2:96899361-96899383 TCTGTGCCAGGTACTGGCACTGG - Intronic
935197380 2:100825652-100825674 CCTGAGCCAGTCACTGGCAAGGG - Intronic
935328884 2:101961992-101962014 CGGGAGTCAGGGACTGGGATGGG + Intergenic
935810446 2:106792226-106792248 CCTGGGCCATGGACTGGTACTGG + Intergenic
937637174 2:124169257-124169279 CCTGGGTTAGGGACTGGCTCGGG + Intronic
938038021 2:128052821-128052843 CCAGGGTCCGGGACTGGTACTGG + Intergenic
938106027 2:128530376-128530398 CCTGTGCCAGGGTCAGGCACTGG - Intergenic
941919173 2:170832087-170832109 CCAGTGTCAGGGACAGGCAAGGG - Intronic
942502627 2:176607535-176607557 CCTGAGCCATGGACAGGTACTGG - Intergenic
943449935 2:188034230-188034252 CCCGAGTCTGTGACTGGCGCCGG - Intergenic
943460374 2:188165601-188165623 CCTGAGTCCATGACTGGCGCCGG + Intergenic
943576503 2:189637308-189637330 TCTGTGTCAGGCACTGGAACAGG + Intergenic
944459558 2:199932465-199932487 CCTGAGCCAGTCACTGGCAAAGG - Exonic
945415006 2:209559798-209559820 GCTGACTCCAGGACTGGCACAGG - Intronic
946840576 2:223815820-223815842 CAAGAGTCAGGGACAGGCAGTGG + Intronic
947685693 2:232082328-232082350 CCTGGGCCATGGACTGGTACTGG + Intronic
947719833 2:232363660-232363682 CCTGGGTCAGGGAGGGGCACCGG - Intergenic
948205206 2:236159785-236159807 CCTGAGGCAGGGCCGGGCCCGGG - Intergenic
948380481 2:237547090-237547112 CCTGAGTAAGGGCCAGGCCCTGG + Intronic
948535737 2:238645218-238645240 CCTGGGCCATGGACTGGCACTGG + Intergenic
948695210 2:239729769-239729791 CCTCAGGCAGGCACTGCCACAGG + Intergenic
948794975 2:240397825-240397847 CCTGAGGCAGGGCCTCGCCCTGG - Intergenic
948916433 2:241036911-241036933 CCTGGGTGAGTGACTGGCCCAGG + Exonic
1170119510 20:12896219-12896241 CCTGAGGGAGGGGCTGACACTGG - Intergenic
1171245345 20:23606197-23606219 CCAGAGTCAGAGCCCGGCACAGG + Intergenic
1171993777 20:31716903-31716925 CCTGAGTCAGGCAATCCCACTGG - Intronic
1172019818 20:31906190-31906212 CCTGAGTCAGGGACTCTTACAGG + Intronic
1173651774 20:44670965-44670987 CCTGAGTCTGTGACCGGCCCTGG - Intergenic
1174142876 20:48428892-48428914 CCTGTTTCATGGACTGGTACCGG - Intergenic
1174367152 20:50063588-50063610 CCTGAGCCAGGAGCTGTCACAGG + Intergenic
1174551272 20:51363444-51363466 CCTGGGCCATGGACTGGTACTGG - Intergenic
1175078040 20:56392408-56392430 CCTGGGGCTGGGACTGCCACAGG - Exonic
1175082883 20:56436100-56436122 CCTGGGTCTGGGCCTGACACTGG + Intronic
1175121122 20:56717041-56717063 GCTGAGTCTGGGCCTGGCAAAGG - Intergenic
1175520683 20:59600752-59600774 CCTGAGTCAGGAAATGGCTTTGG + Intronic
1175721378 20:61289572-61289594 CCAAAGGCAGGGACTGCCACTGG - Intronic
1175767973 20:61604214-61604236 CCTGAGTCAGTGACTGTCTCCGG + Intronic
1176091086 20:63318948-63318970 GCAGCCTCAGGGACTGGCACTGG + Intronic
1177832219 21:26151829-26151851 CCTGGGCCATGGACTGGTACCGG - Intronic
1177861921 21:26464324-26464346 TCTGGCTCAGGGACTGTCACAGG - Intergenic
1178694751 21:34783179-34783201 CCTGAGTCAGCGCCAGGCACAGG + Intergenic
1179015498 21:37591762-37591784 CTTGAGTCCGTGACTGGCGCTGG + Intergenic
1180943374 22:19675085-19675107 CCTCAGTCAAGGACTGTCCCAGG - Intergenic
1181042132 22:20197167-20197189 CCTGAGGGAGGGACTTCCACAGG + Intergenic
1181368316 22:22397089-22397111 AGGGAGTCAGGGACTGGCACTGG + Intergenic
1181612557 22:24027762-24027784 CCTTTGCCAGGTACTGGCACTGG + Intronic
1183405677 22:37629554-37629576 CCTGACCCTGGGACTGGGACAGG - Intronic
1183635868 22:39062244-39062266 CCCGAGTCCGTGACTGGCGCCGG + Intronic
1184572556 22:45335264-45335286 CCTGAGGCAGTGACTGGGAACGG - Intronic
1185081886 22:48714056-48714078 CCTGGGCGAGGGCCTGGCACGGG - Intronic
949516079 3:4808075-4808097 CCTGCGTCAGGCACTGGCACTGG - Intronic
950104420 3:10379152-10379174 CCAGAGACAGAGACTGGCAAGGG - Intronic
950143923 3:10634485-10634507 CTGGAGTCAGGGACTGGCTTGGG - Intronic
950518662 3:13483355-13483377 CCTGGGGCAGGGGCTGCCACAGG + Intronic
950707469 3:14791909-14791931 CCTGTGGCAGGGACAGCCACTGG - Intergenic
951044669 3:18024768-18024790 TCTGAGTCAAGGACCAGCACAGG - Intronic
952210153 3:31222292-31222314 CCTGGGTCAGGGGCGGGCTCTGG - Intergenic
952296616 3:32068200-32068222 CCCGAGTCCGTGACTGGCGCCGG - Intronic
953874746 3:46660310-46660332 CCTGTCTCAGGCACTAGCACAGG - Intergenic
953901333 3:46845770-46845792 CCTGTGTGAGGGGCGGGCACCGG + Intergenic
954424041 3:50434052-50434074 CCTGAGGCTGGGACTGGGGCAGG - Intronic
954631916 3:52052385-52052407 CCAGACTCAGGGACTGACAGGGG + Intronic
954644465 3:52122520-52122542 CCTCAGTGAAGGACTGGCAAGGG - Intronic
956035694 3:65088886-65088908 GCTTATTCAGGGACTGACACTGG - Intergenic
956344550 3:68263714-68263736 CCTGAGACAGAGAATGGCAGGGG - Intronic
957394204 3:79618943-79618965 CCTGAGTTCGTGACTGGCGCTGG - Intronic
959510995 3:107212030-107212052 CCTGAGTCAGGCACTGGACTAGG - Intergenic
959543903 3:107571394-107571416 CCTGAGTCCGTGACTGGCGCCGG + Intronic
959580196 3:107975661-107975683 CCTGAGGCATGGTCTGGAACTGG - Intergenic
960447086 3:117762266-117762288 GCTGAGTCAGGGGGTGGCAGGGG + Intergenic
961343813 3:126248051-126248073 CCCGAGTCCATGACTGGCACTGG - Intergenic
961380113 3:126491560-126491582 CATGATTCTGGGGCTGGCACCGG - Intronic
961829508 3:129616244-129616266 CCTGAGACAGGGGCTTTCACAGG - Intergenic
962974826 3:140436932-140436954 CCAGAGACAGACACTGGCACTGG - Intronic
963058333 3:141205624-141205646 CCTGAGTCTGTGACCGGCACCGG - Intergenic
963319540 3:143798256-143798278 CCCGAGTCTGTGACTGGCGCCGG - Intronic
964983407 3:162713223-162713245 CCCGAGTCCGTGACTGGCACCGG - Intergenic
965070074 3:163908252-163908274 CCTGAGTCCGTGACCGGCGCCGG - Intergenic
965805475 3:172537106-172537128 TCTGAGTCAGGGAATGGCAATGG + Intergenic
965833793 3:172828914-172828936 GCTGGTTCAGGGACTGGCATTGG - Intergenic
966178091 3:177161231-177161253 AAGGAGTCAAGGACTGGCACAGG - Intronic
968472036 4:786760-786782 CCTGCGCCAGGGACTGGCCCAGG + Intronic
968493577 4:903433-903455 CCTGAGACAGGGCCAGGCAGAGG + Intronic
968610019 4:1552660-1552682 CATTCGTCAGGGACTGGCCCTGG - Intergenic
968672952 4:1862217-1862239 CCTGAGTTAGGGACTGACCAGGG - Intergenic
969621639 4:8281699-8281721 CCTGAGGCATGCAGTGGCACGGG - Intronic
973014655 4:45123102-45123124 GCTGATTCAAGGACTGGGACAGG - Intergenic
973650801 4:52995419-52995441 CCTGGGCCACGGACTGACACTGG - Intronic
974080876 4:57211186-57211208 CCTGGGCCATGGACTGGTACTGG + Intergenic
977338842 4:95731351-95731373 CCTGAGTCAGACAGTGGCAAAGG - Intergenic
977486273 4:97650244-97650266 CCTGGGCCACGGACTGGTACTGG - Intronic
978303424 4:107295155-107295177 CCCAAGTCCGTGACTGGCACTGG + Intergenic
980164811 4:129213154-129213176 CCTGGGTCATGGACTGGTACTGG + Intergenic
981615588 4:146640163-146640185 CCTGAGTCCCGGGCTGGCCCTGG + Exonic
983488547 4:168360712-168360734 CCAGAGTCTGGGAAAGGCACTGG + Intronic
984846266 4:184110528-184110550 CCTGAGTCTGGCCCTGGCTCTGG + Intronic
984889263 4:184476401-184476423 CCTGGGCCAGGCACTGTCACAGG - Intergenic
986112265 5:4731030-4731052 CCTGGGTCATGGACTGGTACTGG + Intergenic
987053089 5:14164928-14164950 CCTGGGTCTGGAACAGGCACAGG + Intronic
987119199 5:14750630-14750652 CCTGAATAAGGGACTGGGATTGG + Intronic
989746795 5:44839210-44839232 CCTGGGCCAGGGACAGGCCCAGG + Intergenic
991639479 5:68738718-68738740 CCTGGGTCAGGGACAGGGAGAGG - Intergenic
992788680 5:80194294-80194316 CCTGCATCAGGGGCTGGCATAGG - Intronic
994556700 5:101315743-101315765 CCTTAGTCCGTGACTGGCACTGG - Intergenic
995391986 5:111649808-111649830 CCTGAGTCTGGCACTGGAAATGG - Intergenic
996052862 5:118951933-118951955 CCCAAGTCTGTGACTGGCACCGG + Intronic
996125972 5:119726316-119726338 CCAGAGTCAGGGAAGGGTACAGG + Intergenic
996915120 5:128703197-128703219 CCTGAGTCAGGGACTGGGGCAGG - Intronic
997422402 5:133779814-133779836 CCTGACTCAGGGTCTGTCCCAGG + Intergenic
998959414 5:147469124-147469146 CCAGAGCCAGGGACTGGCCAAGG - Intronic
999099372 5:149010225-149010247 GCTGAGACAGGTCCTGGCACGGG - Intronic
1001086470 5:168703333-168703355 CCTGGGACATGGACTGGTACCGG + Intronic
1001710181 5:173772146-173772168 CCTGAGACAGGGTCTGCCACTGG + Intergenic
1003075911 6:2983428-2983450 CCTTAGCCAGGCACTGGCAATGG + Intergenic
1003612061 6:7622634-7622656 CTTGAGTCAGGGACTAACTCAGG - Intergenic
1004074149 6:12329794-12329816 CCTGAGTCAGTCACCTGCACAGG - Intergenic
1004121206 6:12823970-12823992 CCCGGGCCAGGGACTGGTACTGG + Intronic
1005932766 6:30496210-30496232 CCTGGGCCATGGACTGGTACCGG - Intergenic
1006180285 6:32150148-32150170 CCAGAGTCAGGGCCTGGGAGGGG - Intronic
1006262181 6:32884168-32884190 CCTGTGTCAGGGACTGCTTCTGG + Intergenic
1006562620 6:34926756-34926778 CCCCAATCAGGGACTGGCTCTGG - Intronic
1007777799 6:44233468-44233490 CCTGTGTCTGGGTCTGGCACTGG + Exonic
1009750506 6:67873672-67873694 CCTGAGTCTGTGATTGGAACCGG + Intergenic
1010057087 6:71579142-71579164 ACTGAGTCAGAAACTGGAACTGG + Intergenic
1010123326 6:72405138-72405160 CCTGGGCCACGGACTGGTACTGG + Intergenic
1010369384 6:75089711-75089733 CTTTATTCAGGGTCTGGCACTGG - Intronic
1011368122 6:86603156-86603178 CATGAGTCCATGACTGGCACCGG + Intergenic
1012824589 6:104131191-104131213 GCTGATTCTAGGACTGGCACAGG - Intergenic
1016702301 6:147067486-147067508 CCTGGGCCATGGACTGGTACTGG - Intergenic
1016833369 6:148454262-148454284 TCTGGGTCAGGGGCTGGCATGGG - Intronic
1016937129 6:149455700-149455722 CCAGAGTCAGGGCCAGGCAGGGG + Intronic
1017967901 6:159282224-159282246 CATGAGCCAGGGAGTGCCACGGG + Intergenic
1018302656 6:162419774-162419796 CCAGAGACAGGGACAGGGACAGG + Intronic
1018376412 6:163217545-163217567 CCCGGGCCATGGACTGGCACTGG + Intronic
1018992280 6:168683245-168683267 CCTGAGTCTGGCACTGTCTCTGG - Intergenic
1019734931 7:2645903-2645925 CCTGAGACGGGGACGGGCTCTGG + Intronic
1021133419 7:16938036-16938058 CCTGGGGCAGGGACTGGCAGGGG + Intergenic
1023938109 7:44754186-44754208 CCTGAGTCAGGCTATGGGACTGG + Intronic
1024635980 7:51290836-51290858 CCTGCTTCAGGGAGTGGCACTGG - Intronic
1025986747 7:66459872-66459894 CCTTAGCCAGGGATTGGAACTGG - Intergenic
1026003272 7:66580120-66580142 CCTTAGCCAGGGATTGGAACTGG - Intergenic
1026028267 7:66765548-66765570 CCTTAGCCAGGGATTGGAACTGG + Intronic
1026152329 7:67798729-67798751 CCTCAGCCATAGACTGGCACTGG - Intergenic
1027158028 7:75782248-75782270 CCCGAGTCCGTGACTGGCGCCGG - Intronic
1027354208 7:77340644-77340666 CCCGAGTCTGTGACTGGCGCCGG - Intronic
1027489365 7:78804185-78804207 TCTGAGTCAGTGACTGGAAATGG + Intronic
1028712155 7:93921780-93921802 CCTGAGTCAGGGCCTGTCCGTGG + Exonic
1028955887 7:96689839-96689861 CCAGAGTCAGAGTCTTGCACTGG - Intronic
1028995283 7:97093298-97093320 CCTGAGGCAGGGACAGGCCTGGG - Intergenic
1031355471 7:120782149-120782171 CCTGAGTCCATGACTGGCGCCGG + Intergenic
1031546178 7:123053514-123053536 CCTGAGCCATGGACTGGTACTGG + Intergenic
1032491310 7:132326547-132326569 CCTGATGCAGGGGCTGGCAGAGG - Intronic
1033652512 7:143353496-143353518 CCTGGGTGGGGGACTGGCAGTGG + Exonic
1034629105 7:152516710-152516732 CCTGGGACAGTGACTGGCACAGG + Intergenic
1034907007 7:154958177-154958199 CCAGGGTCAGGGACTGGAGCTGG - Intronic
1035468935 7:159097554-159097576 CTTGAGTCAGGGTCAGGCAGGGG - Intronic
1035489212 7:159257593-159257615 CCTGAGTCAGGGGTTGGGGCAGG - Intergenic
1035774346 8:2176226-2176248 ACTGAGTCAGGACCTGCCACTGG + Intergenic
1036472613 8:9064455-9064477 CCCTAGTCCGTGACTGGCACCGG + Intronic
1036549465 8:9803916-9803938 CCTGAATCCATGACTGGCACTGG - Intergenic
1036683941 8:10895714-10895736 CCCGAGTCAGGGACGGGGAGAGG + Intergenic
1036902913 8:12684994-12685016 CCAGATTCAGGGACAGGGACAGG + Intergenic
1037525765 8:19722671-19722693 CCAGAGTCATGGATGGGCACTGG + Intronic
1039886864 8:41659729-41659751 CCTCTGTCAGTGACAGGCACAGG - Intronic
1039958310 8:42224058-42224080 CCTGGGCCACGGACTGGTACTGG + Intergenic
1040039912 8:42905547-42905569 CCTGAGTCAGTCACTGGTAGAGG + Intronic
1040976066 8:53195624-53195646 CCAGGCTCAGGGACTGGCAAGGG - Intergenic
1041250509 8:55929886-55929908 CCTGGGCCATGGACTGGTACTGG + Intronic
1041618721 8:59939020-59939042 CTTCAGTGAGGGACTGGCAGGGG + Intergenic
1042174158 8:66022383-66022405 GATGAGTCAGGGCCTGGCGCTGG - Intronic
1042705876 8:71665343-71665365 CCTGAGTTCGTGACCGGCACTGG - Intergenic
1044310872 8:90690542-90690564 CCTGAGGCAGGGAATTGCAATGG + Intronic
1045249176 8:100468835-100468857 CCTGGGTCACTGACTGGTACAGG - Intergenic
1047502919 8:125455927-125455949 CCTGAGCCAGGGAAAGGCAAGGG - Intergenic
1048066077 8:130970156-130970178 CCTGGGCCATGGACTGGTACTGG + Intronic
1048398077 8:134034075-134034097 GCTGAGTCAGGGACTGTCCCAGG - Intergenic
1049426464 8:142540083-142540105 CCTGAGGCAGTGACAGGCAGTGG + Intronic
1049572574 8:143376151-143376173 CCTGCATCAGGGCCTGGCAAAGG - Intronic
1049786888 8:144455356-144455378 CCTGAGGCAGGGAGTGAGACTGG + Intronic
1050081478 9:1920355-1920377 CCTGAGGAATGGAGTGGCACTGG - Intergenic
1050194259 9:3063921-3063943 CCTGAGATAGAGACTAGCACTGG - Intergenic
1050412795 9:5383836-5383858 CCTGGGCCACGGACTGGTACTGG - Intronic
1051261754 9:15271673-15271695 CCTGAGCCGTGGACTGGTACTGG - Intronic
1053158717 9:35798736-35798758 CCTGAGGCAGGGCCTGAGACTGG + Intronic
1053215384 9:36266264-36266286 CCTGGGCCATGGACTGGTACTGG - Intronic
1056363514 9:85881663-85881685 CCCGAGTCGGTGACTGGCGCCGG - Intergenic
1057141237 9:92727870-92727892 CCTGCCCCAGGGACAGGCACGGG + Intronic
1057197236 9:93121853-93121875 CCTGAGACAGAGGCTGGCCCTGG + Exonic
1058000878 9:99863693-99863715 CCAGAGTAAGGGACAGGCTCTGG + Exonic
1058786861 9:108396556-108396578 CCTGAGTCAGGTTCTGACTCAGG + Intergenic
1058818590 9:108708564-108708586 GCTGCGCCAGGGACTGGAACAGG - Intergenic
1059416175 9:114163838-114163860 CCTGAGTCAGTCACTGGGGCGGG + Intronic
1059887997 9:118768409-118768431 CCTGAAGCAGGGACTGGGATTGG - Intergenic
1060062978 9:120477570-120477592 CCTGAGCCAGAGCCAGGCACAGG - Intronic
1060106197 9:120875064-120875086 CCTGAGACAGGGAGTGGTTCAGG - Intronic
1060216890 9:121743820-121743842 CCTCAGTGAGTGACTGTCACAGG + Intronic
1060521603 9:124297195-124297217 CCTGAGGCAGGGACTTGCCCAGG - Intronic
1060533004 9:124359628-124359650 CTTGAGTCAGGGACTAGCTGAGG - Intronic
1061309550 9:129753221-129753243 CCAGAGCCAGGGACTGGGTCCGG - Intergenic
1061313196 9:129777349-129777371 ACTCAGGCAGGGACTGGCCCTGG + Intergenic
1061625376 9:131838157-131838179 CCTGGGTCAGCGCCTGGCTCTGG + Intergenic
1061807381 9:133144041-133144063 CCTGAGGCAGGGTCTGGGGCTGG + Intronic
1061874434 9:133536829-133536851 CCTGGGTAGGGGACTGGCATGGG - Intronic
1061959068 9:133978912-133978934 CCTGAGCCTGGGGCTGGCCCCGG + Intronic
1062012926 9:134276489-134276511 CCTGAGTCTGGGGCCGGCAGGGG - Intergenic
1062090916 9:134678452-134678474 CCTGAGTCAGGGACACACACCGG - Intronic
1062197672 9:135283151-135283173 GCAGGGTCAGGGGCTGGCACAGG + Intergenic
1062313357 9:135952082-135952104 CCTGACTCAGGGACAGGCGGAGG + Intronic
1062598300 9:137308984-137309006 CCTCAGTCGGGGGCTGGCACGGG - Intronic
1186047045 X:5547885-5547907 GCTGAGTAGGGGACTGGGACTGG + Intergenic
1186480941 X:9895663-9895685 CCTGGGTCAGGGAGTGCAACAGG - Exonic
1188430827 X:30104329-30104351 CCTGAGTCTGTGACTGGCGCCGG - Intergenic
1189098835 X:38168202-38168224 CCTAGGTCTGGAACTGGCACAGG - Intronic
1189294171 X:39907271-39907293 CATGAGCCAGGGACAGCCACAGG + Intergenic
1189387620 X:40550262-40550284 CCTGAGTGTGGGCCTGGCGCGGG - Intergenic
1190616648 X:52240552-52240574 CCTGGGCCACGGACTGGTACTGG - Intergenic
1191014390 X:55793004-55793026 CCCGAGTCCATGACTGGCACTGG + Intergenic
1192372582 X:70526814-70526836 ACTGATTCCGGGTCTGGCACAGG + Intergenic
1192914332 X:75636988-75637010 CCCGAGTCCGTGACTGGCACCGG + Intergenic
1194874069 X:99164448-99164470 CCCGAGTCCGTGACCGGCACCGG + Intergenic
1195174855 X:102305626-102305648 CCTGAGTCAGGGTGTGGAGCCGG - Intergenic
1195184010 X:102381467-102381489 CCTGAGTCAGGGTGTGGAGCCGG + Intronic
1196525755 X:116725959-116725981 CCTGAGTCCGTGACCGGCGCCGG + Intergenic
1196584911 X:117418620-117418642 CCCAAGTCCGTGACTGGCACCGG - Intergenic
1200596335 Y:5145942-5145964 CCTGGGCCATGGACTGGTACTGG + Intronic
1201304950 Y:12542196-12542218 CCTGGGTCAGGGAGTGCAACAGG - Intergenic
1201307692 Y:12564632-12564654 CCTGAGTCTGTGACTGGTGCTGG + Intergenic