ID: 1071573054

View in Genome Browser
Species Human (GRCh38)
Location 10:86708461-86708483
Sequence GACTCAGGACCTGTAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573048_1071573054 -7 Left 1071573048 10:86708445-86708467 CCCAGTGCCAGTCCCTGACTCAG 0: 1
1: 0
2: 3
3: 24
4: 264
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573049_1071573054 -8 Left 1071573049 10:86708446-86708468 CCAGTGCCAGTCCCTGACTCAGG 0: 1
1: 0
2: 5
3: 55
4: 367
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573046_1071573054 -1 Left 1071573046 10:86708439-86708461 CCCTTTCCCAGTGCCAGTCCCTG 0: 1
1: 0
2: 3
3: 39
4: 449
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573044_1071573054 14 Left 1071573044 10:86708424-86708446 CCATAAGCCTCTGCTCCCTTTCC 0: 1
1: 0
2: 2
3: 42
4: 428
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573047_1071573054 -2 Left 1071573047 10:86708440-86708462 CCTTTCCCAGTGCCAGTCCCTGA 0: 1
1: 0
2: 2
3: 46
4: 431
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data
1071573045_1071573054 7 Left 1071573045 10:86708431-86708453 CCTCTGCTCCCTTTCCCAGTGCC 0: 1
1: 0
2: 3
3: 77
4: 711
Right 1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573054 Original CRISPR GACTCAGGACCTGTAGCTCC TGG Intronic
No off target data available for this crispr