ID: 1071573758

View in Genome Browser
Species Human (GRCh38)
Location 10:86711604-86711626
Sequence AGAGGGCGGGGAGCCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071573746_1071573758 7 Left 1071573746 10:86711574-86711596 CCCTCCAGGCTCTTCGGATCCGG No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573745_1071573758 11 Left 1071573745 10:86711570-86711592 CCTTCCCTCCAGGCTCTTCGGAT No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573736_1071573758 24 Left 1071573736 10:86711557-86711579 CCCCCTCCGCTCCCCTTCCCTCC No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573738_1071573758 22 Left 1071573738 10:86711559-86711581 CCCTCCGCTCCCCTTCCCTCCAG No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573734_1071573758 30 Left 1071573734 10:86711551-86711573 CCGAGCCCCCCTCCGCTCCCCTT No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573744_1071573758 12 Left 1071573744 10:86711569-86711591 CCCTTCCCTCCAGGCTCTTCGGA No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573735_1071573758 25 Left 1071573735 10:86711556-86711578 CCCCCCTCCGCTCCCCTTCCCTC No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573737_1071573758 23 Left 1071573737 10:86711558-86711580 CCCCTCCGCTCCCCTTCCCTCCA No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573739_1071573758 21 Left 1071573739 10:86711560-86711582 CCTCCGCTCCCCTTCCCTCCAGG No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573748_1071573758 6 Left 1071573748 10:86711575-86711597 CCTCCAGGCTCTTCGGATCCGGG No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573741_1071573758 18 Left 1071573741 10:86711563-86711585 CCGCTCCCCTTCCCTCCAGGCTC No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573750_1071573758 3 Left 1071573750 10:86711578-86711600 CCAGGCTCTTCGGATCCGGGCGT No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data
1071573742_1071573758 13 Left 1071573742 10:86711568-86711590 CCCCTTCCCTCCAGGCTCTTCGG No data
Right 1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071573758 Original CRISPR AGAGGGCGGGGAGCCCGCGC GGG Intronic