ID: 1071582823

View in Genome Browser
Species Human (GRCh38)
Location 10:86789019-86789041
Sequence TCAGGGATGAAAAGGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071582817_1071582823 -5 Left 1071582817 10:86789001-86789023 CCTTGTAGTGGGAAAACCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG No data
1071582813_1071582823 19 Left 1071582813 10:86788977-86788999 CCTTCTCTTACCATGATGCACTT 0: 1
1: 0
2: 1
3: 17
4: 196
Right 1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG No data
1071582812_1071582823 20 Left 1071582812 10:86788976-86788998 CCCTTCTCTTACCATGATGCACT 0: 1
1: 0
2: 1
3: 9
4: 216
Right 1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG No data
1071582814_1071582823 9 Left 1071582814 10:86788987-86789009 CCATGATGCACTTGCCTTGTAGT 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG No data
1071582811_1071582823 27 Left 1071582811 10:86788969-86788991 CCTCTGACCCTTCTCTTACCATG 0: 1
1: 0
2: 2
3: 20
4: 257
Right 1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071582823 Original CRISPR TCAGGGATGAAAAGGGTGTC AGG Intronic
No off target data available for this crispr