ID: 1071585708

View in Genome Browser
Species Human (GRCh38)
Location 10:86819024-86819046
Sequence GGTAATGCATGTAAAGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071585704_1071585708 5 Left 1071585704 10:86818996-86819018 CCTCCGAATTGTTTTGGGGATGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG No data
1071585702_1071585708 9 Left 1071585702 10:86818992-86819014 CCTGCCTCCGAATTGTTTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG No data
1071585705_1071585708 2 Left 1071585705 10:86818999-86819021 CCGAATTGTTTTGGGGATGAAAT 0: 1
1: 0
2: 2
3: 22
4: 356
Right 1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG No data
1071585698_1071585708 20 Left 1071585698 10:86818981-86819003 CCCGAAGAATTCCTGCCTCCGAA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG No data
1071585699_1071585708 19 Left 1071585699 10:86818982-86819004 CCGAAGAATTCCTGCCTCCGAAT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071585708 Original CRISPR GGTAATGCATGTAAAGCATT GGG Intronic
No off target data available for this crispr