ID: 1071586948

View in Genome Browser
Species Human (GRCh38)
Location 10:86832571-86832593
Sequence AGGTAGAAGGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 350}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071586948 Original CRISPR AGGTAGAAGGCAGTGATTGT GGG (reversed) Intronic
902239669 1:15080240-15080262 AAGTATAAAGCAGTTATTGTTGG + Intronic
902701468 1:18175332-18175354 AGGTTGAAGGAGGTGATTTTAGG + Intronic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904072636 1:27813521-27813543 AGGTAGAAGGCTGCCATTGCTGG + Intronic
904776448 1:32910967-32910989 GGGAAGAAGGCAGAGAGTGTGGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906108163 1:43307001-43307023 AGGCAGAGGGCAGAGGTTGTGGG + Intronic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906840883 1:49137993-49138015 AGGGAGCAGGCAGGGATTCTGGG + Intronic
907564911 1:55425652-55425674 AGGTTGGATGCACTGATTGTTGG + Intergenic
907912387 1:58837974-58837996 AGCTAGAATGCAGAGATTTTAGG - Intergenic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909990501 1:82217469-82217491 AGCTAAATGGCAGTGATTTTTGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911986997 1:104639498-104639520 AACTAGAATGCAGTAATTGTTGG + Intergenic
912325003 1:108748894-108748916 AGGTAGAAGCCAGTCAGTGGAGG + Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913359610 1:117965514-117965536 AGGTAGAAGCCATTGATGGATGG - Exonic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916302894 1:163295129-163295151 AGGTAAAATGCAGAGATTGGAGG - Intronic
916678790 1:167086182-167086204 AGTCAGAAGCCAGTGCTTGTAGG - Intronic
917036296 1:170750651-170750673 AGGCAGAAAGCAGGCATTGTAGG + Intergenic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917552241 1:176044464-176044486 ACTTAGAAGGCAGTTAATGTAGG + Intronic
918276127 1:182955268-182955290 TGGGAGAAGGGAGTCATTGTAGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
920717719 1:208356518-208356540 AGGTAGGAAGCAGTGATACTAGG - Intergenic
920743436 1:208602840-208602862 AGGTAGAAGGAACTGTCTGTTGG + Intergenic
920952355 1:210584474-210584496 AGGTAGGAGGCAGTGAATTGTGG + Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
924155270 1:241168817-241168839 AGGTAGAAGTCAGAGACTGCAGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1063255917 10:4327002-4327024 AGGTAGAAAGCAGTTCTTTTTGG - Intergenic
1064106987 10:12508557-12508579 AGGTGGACGGCGGTGATGGTTGG + Intronic
1064846015 10:19654151-19654173 AGGTAGATGGCAGTGCTTATGGG - Intronic
1066455073 10:35565515-35565537 AGGCAAAAGGCAGGGATTATGGG - Intronic
1066694331 10:38064548-38064570 AGAGAGAAGGAAGTGATTCTTGG - Intronic
1067229162 10:44395003-44395025 AGGAGGGAGGCAGTGACTGTTGG - Intergenic
1067327009 10:45279130-45279152 AGGAAGAAGGGAGTGGTTGTTGG - Intergenic
1067487370 10:46663286-46663308 AGGTAGAAGGCAATTACTTTAGG - Intergenic
1068031614 10:51711712-51711734 AGGAAGCTGTCAGTGATTGTGGG + Intronic
1068864997 10:61885600-61885622 AGGTAGGAGACACTGGTTGTAGG - Intergenic
1069173368 10:65260537-65260559 AAGTAATAGGAAGTGATTGTGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069336297 10:67355294-67355316 AGGCAGAAGGAAGTAGTTGTTGG + Intronic
1069914722 10:71780389-71780411 AGGGTGAAGGCAGCAATTGTAGG + Intronic
1070207125 10:74275025-74275047 AGGTGGGAGGCAGACATTGTGGG + Intronic
1071250807 10:83817475-83817497 AGGCAGAAGGCTGGAATTGTGGG + Intergenic
1071280297 10:84095448-84095470 AGGTTGAGGTCAGTGATAGTTGG - Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073067258 10:100770014-100770036 AGGTGATAGGAAGTGATTGTAGG + Intronic
1073577291 10:104637727-104637749 AGATATAAGGCAGTGACTCTAGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074758113 10:116642642-116642664 AGGGGCAAGGCAATGATTGTAGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1078641173 11:13098226-13098248 GGGTAGAAAGCAGTGCATGTGGG - Intergenic
1078733395 11:13997500-13997522 AAGTAGGAGGCATTGATTGAGGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1082631442 11:55546858-55546880 AGGAGGAAGAAAGTGATTGTTGG + Intergenic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086061863 11:82708192-82708214 GGGTAACAGGCAGGGATTGTGGG - Intergenic
1086069838 11:82788358-82788380 TGGTACACGTCAGTGATTGTAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1088975997 11:114817025-114817047 TGGTAGAAGGCAGTTAGGGTGGG + Intergenic
1089073697 11:115720188-115720210 AGGTAGAATGCAGTTCTTCTGGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1095747591 12:45676785-45676807 AAGTAGAGGGTAGTGATTCTGGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1098048548 12:66427957-66427979 AGGTAGAAGGCAGAGGTTATAGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099917451 12:88913175-88913197 AGGTAAAATGCATTTATTGTAGG + Intergenic
1100190011 12:92180319-92180341 AGGTGGAAGGCAGACATTATGGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1102462932 12:113111386-113111408 AGGTAGAAAGGAGTGATATTGGG - Intronic
1102803578 12:115759264-115759286 AGACAGAAGGCAGTGAATATCGG - Intergenic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108476969 13:50829834-50829856 TGGTCGAAGGCAATGATTATTGG - Intronic
1108506539 13:51117573-51117595 AGGTAGAAGGCTGAGACTGATGG + Intergenic
1108574028 13:51776631-51776653 AGGAAGAAGACAGTTAATGTAGG - Intronic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114537075 14:23429754-23429776 AGGTGGGAGGCAGGGATTCTTGG - Exonic
1114892558 14:26943458-26943480 AGGTAGAAGCCAGAGAATGGAGG + Intergenic
1115224883 14:31092269-31092291 AGGTACAAGGCATTTATTTTGGG + Intronic
1115871331 14:37806597-37806619 AGGTATAAGAAACTGATTGTTGG - Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116654595 14:47636361-47636383 ATGAAGAAGGCAGTTTTTGTTGG + Intronic
1117195023 14:53331100-53331122 AGGTGAGAGTCAGTGATTGTAGG + Intergenic
1117570111 14:57039599-57039621 AGCTAGTAGGCAGTGAATCTGGG - Intergenic
1117646592 14:57859717-57859739 GGATAGAAGGCAGTGATCGCAGG + Intronic
1118640650 14:67789238-67789260 AGGAAGAAAGCAGTTATTGGAGG - Intronic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1119753000 14:77093779-77093801 AGGCAGAGGCCAGTGATAGTGGG - Intergenic
1119889263 14:78170502-78170524 GGGTAGAAGGGAGGGGTTGTTGG - Intergenic
1121862071 14:97327764-97327786 AGGAAGAAGGAAGTCATTCTGGG - Intergenic
1123540181 15:21281971-21281993 AGCTAGAAGGCAGGATTTGTAGG + Intergenic
1124086561 15:26556029-26556051 AAGTAGAAAGAAGCGATTGTGGG + Intronic
1125000637 15:34766420-34766442 AGGTAGAAGGTGGGGTTTGTTGG + Intergenic
1126065746 15:44825030-44825052 AGGTAGAAGTCAGTGTGTGGAGG - Intergenic
1126094089 15:45075537-45075559 AGGTAGAAGTCAGTGTGTGGAGG + Exonic
1126528488 15:49685702-49685724 TGTTAGAAGGGAGCGATTGTTGG - Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1128117337 15:65118157-65118179 AGGAAGATGGCAGTGGCTGTAGG - Exonic
1131839877 15:96425688-96425710 AGGTAGAAGACAGGTATTGCAGG + Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1135660387 16:24291583-24291605 TGGTGGAAGGCAGTTATTGTGGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139876533 16:70150450-70150472 AGGTAGCAATCAATGATTGTAGG + Intronic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140449453 16:75058719-75058741 GGGTAGATGGCAGTGGGTGTTGG + Intronic
1141795627 16:86271671-86271693 AGGATGAAGGAAGTGTTTGTGGG + Intergenic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143643649 17:8215136-8215158 AGGGAGCAGGCAGAGATGGTTGG + Intergenic
1144029399 17:11305902-11305924 AGGGAGAAGGCATTATTTGTGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145960599 17:28884574-28884596 AAGTAGAAAGAAGTGGTTGTGGG + Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151441315 17:74131047-74131069 AGGGAGAAGGCATTGATGGCAGG - Intergenic
1152052920 17:77996417-77996439 AGGTAGCAGGCACTGATGGCAGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153971572 18:10231880-10231902 AGGCAGGGGGCAGTGATTATAGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155885871 18:31207258-31207280 AGGTAGAAGGAGGGGATTGAGGG - Intergenic
1155904098 18:31428662-31428684 AGAAAGAAGGCTGTGGTTGTAGG + Intergenic
1156966747 18:43103729-43103751 AGGTAGATGACAGTGATGGAAGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158526776 18:58221496-58221518 AGGTAGAAAGAAATGCTTGTTGG - Intronic
1159938906 18:74390475-74390497 AGGTAAAAGGCAGTAACTTTGGG + Intergenic
1160227819 18:77024932-77024954 GGGTGGAAGGCAGCGTTTGTGGG - Intronic
1160825143 19:1076453-1076475 AGGTAGAAACCTGTGATTGTTGG + Intronic
1162623147 19:11860717-11860739 AGATAGAAGGGGGTGGTTGTAGG + Intronic
1162624201 19:11871151-11871173 AGGGAGGAGTCATTGATTGTCGG + Intronic
1164530016 19:29041514-29041536 AGGGAGGAGGCAGAGTTTGTGGG + Intergenic
1167616080 19:50534629-50534651 GGTTAGAAGGCAGTCATTGATGG - Intronic
1167742343 19:51331277-51331299 GGGAAGAAGGCAGTGATAGAGGG + Intergenic
1168181912 19:54667235-54667257 AGGTAAAGGGCAGAGAGTGTGGG + Intronic
1168448961 19:56448178-56448200 AGGAAGAATGGAGTGATGGTGGG + Intronic
925748256 2:7063382-7063404 AGTTAGATGGGAGTGATTATGGG + Intronic
927323308 2:21773548-21773570 AGTAAGGTGGCAGTGATTGTTGG - Intergenic
929641757 2:43587556-43587578 AGGGATGAGGCAGTGATTGCTGG - Intronic
929705426 2:44207146-44207168 AGTTTGAAGGCAGTGAAGGTTGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930381089 2:50630315-50630337 AAGTAGAAATCAGTGATTCTTGG - Intronic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930845605 2:55900323-55900345 ACGAAGAAGGCAGTGAGAGTTGG - Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
931012736 2:57936012-57936034 GGGGAGAAGGAAGTGATGGTAGG + Intronic
931942696 2:67270302-67270324 ATGAAGAAGCTAGTGATTGTTGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935692229 2:105742362-105742384 AGTTGGAAGGCAGTAGTTGTGGG + Intergenic
936824015 2:116558496-116558518 AGGTAGAAGGGAGAGATGGTAGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937058790 2:118966032-118966054 GGGTAGCAGGCAGTGCTGGTAGG - Intronic
937058804 2:118966084-118966106 GGGTAGCAGGCAGTGCTGGTAGG - Intronic
937121838 2:119445707-119445729 CGGGAGAAGCCAGTGATTATAGG - Intronic
937680588 2:124640374-124640396 AGGTGGAAGGCAGTAATGGACGG + Intronic
937697009 2:124819107-124819129 AAGTAGAAGGCAGAGAGTGAAGG - Intronic
938079513 2:128362234-128362256 TGGCTGAAGGCAGTGATTGGAGG + Intergenic
939852386 2:147317485-147317507 AGGGAGGAGGCAATGATTTTTGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942793959 2:179794087-179794109 ATATAGAAGGCAGTCATTGGAGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943238205 2:185348964-185348986 AGATAGAGGGAAGGGATTGTTGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
947389400 2:229623606-229623628 AGGAAGAAGACAGAAATTGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168941732 20:1718635-1718657 AGGGAGGTGGCAGTCATTGTTGG - Intergenic
1169602214 20:7274572-7274594 AGGGAGAAGGGAGAGATTCTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170038687 20:12017594-12017616 AGGTAGAAGGAAATGGTTGATGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170495618 20:16921730-16921752 AGGTGAAAGGGAGTGATAGTAGG + Intergenic
1173127929 20:40357428-40357450 AGTTGGAAGGCAGTGAGTTTGGG - Intergenic
1173325116 20:42026190-42026212 AGGGAGCAGGGAGTGATTGGAGG + Intergenic
1173615357 20:44399969-44399991 ATGTAGAAGGCAGAGAGTGAGGG - Intronic
1174212304 20:48889787-48889809 AAGAAGAAGGCAATGACTGTTGG - Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178541163 21:33451864-33451886 AGGTAGTAGGCAGGGAGTGGAGG + Intronic
1179072819 21:38088991-38089013 TGGTAGAATGCATTTATTGTTGG + Intronic
1179264971 21:39795290-39795312 CAGTGGAAGGGAGTGATTGTTGG + Intronic
1182191397 22:28464376-28464398 TGGTTGAAGGAAGTGTTTGTAGG + Intronic
1182357991 22:29730829-29730851 AGGGAGAAGGGAGTGAGCGTGGG + Exonic
1184048685 22:41988519-41988541 AGGAACCAGGCAGTGATGGTAGG + Intronic
949410542 3:3758668-3758690 AGATAGAAGGCATTTATTTTTGG + Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951594079 3:24298301-24298323 ACCTAGAAGGGAGGGATTGTAGG - Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957567456 3:81903586-81903608 TGGTTGAAGGCAATGATTGGAGG - Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960177030 3:114529702-114529724 AGGTAGAAGGTAGGGATGATGGG + Intronic
960265978 3:115621582-115621604 AGGGAGGAGGCAGAGAATGTGGG - Intergenic
960412583 3:117346014-117346036 AGGTTGAAGACAGTGTTTGGTGG - Intergenic
960931355 3:122854086-122854108 GGATAGAAGGAAGTGTTTGTGGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963760109 3:149279515-149279537 AGGTAGAAGTCATAGAATGTTGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964400107 3:156289910-156289932 AGGAAGAAGGCAGTGATCCCAGG - Intronic
964706461 3:159623922-159623944 AGGTGGAAGGCAGTGGGAGTAGG - Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965965233 3:174481130-174481152 AGATAGAAGGAAGAGATTATAGG + Intronic
965970279 3:174546196-174546218 GGGTAGAAGGAATTGATTGAAGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968657473 4:1784935-1784957 AGGCAGAAGGCACTGGTTCTAGG - Intergenic
969096533 4:4736741-4736763 TGGTAGAAGGCAGAGAATGGAGG + Intergenic
971068045 4:23057508-23057530 GGGTAAGAGGCAGTGATGGTGGG - Intergenic
972032670 4:34480894-34480916 AGGTAGAAGGAACTGATTGGAGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975373657 4:73617115-73617137 TGGTTGCAGTCAGTGATTGTTGG + Intronic
977094908 4:92729026-92729048 ATGCAACAGGCAGTGATTGTTGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978098507 4:104808142-104808164 AGGCAGAAGGCAGAGATAATTGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979149436 4:117291204-117291226 TTCTAGAAGGCAGTGATTATTGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979585655 4:122413000-122413022 AGGTGGGAGGCAGAGGTTGTGGG + Intronic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
982057891 4:151571288-151571310 AGGTAGAAAGAAGTCATTCTGGG - Intronic
982281702 4:153689875-153689897 AGGTAGATGGCTGTGTTTGATGG + Intergenic
982863296 4:160481563-160481585 AGGAAGACGGCAGTGAAAGTAGG + Intergenic
983327720 4:166279550-166279572 AAGTAGAAGGTAGTTATTGAGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
984938890 4:184914316-184914338 AGGTAGGATCCAGTGAGTGTAGG + Intergenic
985144501 4:186880912-186880934 ATATAGAAGGAAGTAATTGTAGG + Intergenic
985430100 4:189871030-189871052 ACCAAGAAGGCAGTGAATGTGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986764540 5:10912773-10912795 TGGTAGAAAACAGTGATAGTGGG + Intergenic
987037291 5:14031381-14031403 AGGAAGAAGGCATTGATTTCAGG - Intergenic
987311133 5:16682080-16682102 AGGAAGAAGGCACTGAGTCTCGG - Intronic
988860902 5:35277482-35277504 AGGCAAAAGGCAGAGATTCTTGG - Intergenic
989512293 5:42302149-42302171 AGGTAGAAGGCAGACATTATTGG - Intergenic
989543238 5:42642304-42642326 AAGTAGAAGGAGGTGATTATGGG - Intronic
991057317 5:62334620-62334642 GGGTACAAGGCAGTGGTGGTGGG - Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991317660 5:65327625-65327647 AGGTACAAGCCATTCATTGTAGG + Intronic
991578664 5:68131423-68131445 AGGTACACAGCAGTGCTTGTTGG - Intergenic
992400465 5:76406448-76406470 TGGAAGAAGGAAGTGATAGTAGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997628834 5:135350837-135350859 ATGTAGAAGTCAGTGTTTGTCGG + Intronic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
1001553120 5:172618634-172618656 AGGATGAAGGGAGTGATTGGAGG - Intergenic
1002286984 5:178170084-178170106 AGGTAGAAGGCTATATTTGTGGG + Intergenic
1003683224 6:8276199-8276221 AGGTGGAAGGCAGGGATGGAGGG + Intergenic
1003780484 6:9419476-9419498 AGGTAACAGGGAGTGATTGAAGG - Intergenic
1004925094 6:20408721-20408743 AGGTAGAAAGCAGTGAGAATTGG + Intronic
1005164152 6:22899959-22899981 AGATAGAAGGCACTTATTATTGG - Intergenic
1005764688 6:28999452-28999474 AGGTAGAAAGCATTAAGTGTAGG + Intronic
1006229110 6:32567075-32567097 AGCAAGAAGGGAGTGGTTGTCGG + Intronic
1008057738 6:46962698-46962720 AGGTAGAGGGGAGAGATTTTAGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009728163 6:67560771-67560793 GGGTTGGAGGGAGTGATTGTTGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010089628 6:71965313-71965335 GGGTAGAAGGTAGTGATTGCAGG + Intronic
1011495940 6:87936655-87936677 AGGCAGAAGGCAGTGAGAATGGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012441962 6:99269159-99269181 AGGTAGAAGGCTGTGAAGATTGG - Intergenic
1012779286 6:103536186-103536208 AGGCAGAAGGCAGACATTATGGG - Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018648310 6:165968829-165968851 AGGCAGAAGGCAGAGCCTGTAGG + Intronic
1018862464 6:167720963-167720985 CGGTAGAAGGCTGTGATGGGGGG - Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021277061 7:18664580-18664602 TGGTAGAAGGCAGAGTCTGTGGG - Intronic
1021803669 7:24333565-24333587 AGCTACAAGGTAGTGCTTGTAGG - Intergenic
1021859660 7:24893835-24893857 TGGGAGAAGCCAGTGATTCTAGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022055480 7:26728902-26728924 AGGTAGAAGGCATAGGTTTTAGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023290087 7:38659624-38659646 TGGTTCAGGGCAGTGATTGTGGG + Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023923901 7:44651064-44651086 AGGTAGGGGGCAGTGATGGAGGG + Intronic
1024694976 7:51846675-51846697 AGGTAGAAGGTAGAGAATTTTGG - Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024852388 7:53735339-53735361 AGGTAGAAGTGAAGGATTGTTGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026420358 7:70230480-70230502 AAGCAGAAGGCAGTGATTTAGGG - Intronic
1026426453 7:70299273-70299295 AGGCACAAGGAAGAGATTGTAGG - Intronic
1026977619 7:74508044-74508066 AGGGAGGAGGCAGTGGTGGTGGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031009409 7:116509910-116509932 AGAAAGATGGCAGTGATTATGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031676228 7:124615767-124615789 AGGTTGATGGCAGTGAGGGTCGG - Intergenic
1032669179 7:134067812-134067834 AGGTAGAAAGAAGTGCTTGTGGG - Intergenic
1032722663 7:134563397-134563419 AGTTAGATGGGAGTGATGGTGGG + Intronic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033130293 7:138740192-138740214 AGGTAGAAAGCAGGGATGCTGGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035147372 7:156833024-156833046 AGGTAGAATGCACTGTTTATTGG + Intronic
1037684135 8:21123675-21123697 AGTTAGTATGCAGTGTTTGTAGG + Intergenic
1038735624 8:30166637-30166659 AGGTAGCTGCCAGTGATTGGTGG + Intronic
1038992875 8:32888679-32888701 AGTTAGAAGCCACTGATTCTGGG + Intergenic
1041273058 8:56127759-56127781 AATTAAAAGGCAGAGATTGTTGG + Intergenic
1042665196 8:71196425-71196447 AGGGTGAAGGAAGTCATTGTGGG + Intergenic
1042734386 8:71971257-71971279 AGCTAGCAGGCAAAGATTGTGGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045434113 8:102142536-102142558 AATTAAAAGGCAGAGATTGTCGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047257680 8:123228004-123228026 GGGTGGAAGGCAATGATTTTAGG - Intronic
1047761015 8:127954591-127954613 AGGTAGAAGTGAGTACTTGTTGG - Intergenic
1048412034 8:134185098-134185120 AGGTAGAAGGAGATGACTGTGGG + Intergenic
1050911970 9:11082684-11082706 AGGATGAAGGCAGGGATTGAAGG + Intergenic
1050958972 9:11703290-11703312 AGGTAGAAGGAATGGAGTGTGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1054891829 9:70259514-70259536 ATGTAGCAGGTAGTGGTTGTAGG + Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056304085 9:85272085-85272107 AGATACAAGGTAGTGATTATGGG + Intergenic
1057317046 9:93976185-93976207 AGGAACAAAGCAGTGATTCTGGG - Intergenic
1057751082 9:97793738-97793760 AGGTAGCAGGCAGAGAATGTAGG + Intergenic
1058142184 9:101368534-101368556 AGGTAGAAGGCTGAAAGTGTTGG - Intronic
1058154182 9:101493833-101493855 AGGAATAAGGCAGTTTTTGTTGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058639249 9:107067145-107067167 AGGTGAAAGGCAGTGGTGGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1062051690 9:134450581-134450603 ATGGGGAAGGCAGTGAGTGTGGG + Intergenic
1185932841 X:4222005-4222027 AGGTTGAAGGAAGTGACTGAAGG + Intergenic
1186423217 X:9443346-9443368 AGGTACAAGGCGGGGGTTGTGGG - Intergenic
1187116644 X:16359153-16359175 AGAACGAAGGCAGTGATGGTTGG + Intergenic
1187713419 X:22076990-22077012 AGGAAGAAGCCAGTGCCTGTGGG + Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188927682 X:36065983-36066005 AGGTGTAAGGCAGTAAATGTAGG + Intronic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193700721 X:84757321-84757343 AGTAAGAAGTCTGTGATTGTTGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194078331 X:89425966-89425988 AGGAAGAAGGCATTGAGAGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194764102 X:97829287-97829309 AGGAGGAAGGTAGTGATTCTGGG - Intergenic
1194921475 X:99771447-99771469 AGGGAGAAGGGAGTGAAGGTAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196013649 X:110914783-110914805 AGATAGCAGGCAGTGGATGTGGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196489444 X:116249327-116249349 AGGGAGGAGGCAATGATTTTTGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197621246 X:128752247-128752269 AGGTAAAATGCAGTAATTGGTGG + Intergenic
1197849649 X:130844060-130844082 AGGCTGAAGGCAAAGATTGTGGG - Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200140343 X:153898142-153898164 AGTTAAAAGGCAGAGACTGTTGG + Intronic
1200430974 Y:3081498-3081520 AGGAAGAAGGCATTGAGAGTGGG + Intergenic
1201179404 Y:11331812-11331834 ATGAAGAAGGCAGTGCCTGTGGG - Intergenic