ID: 1071592739

View in Genome Browser
Species Human (GRCh38)
Location 10:86891119-86891141
Sequence AGACACGATGACCGTCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071592739_1071592742 3 Left 1071592739 10:86891119-86891141 CCTGCATGACGGTCATCGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1071592742 10:86891145-86891167 GTTTGCTGCTTGTCCCCTGGTGG No data
1071592739_1071592749 20 Left 1071592739 10:86891119-86891141 CCTGCATGACGGTCATCGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1071592749 10:86891162-86891184 TGGTGGTGGTGGGCTCTGCGTGG No data
1071592739_1071592743 6 Left 1071592739 10:86891119-86891141 CCTGCATGACGGTCATCGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1071592743 10:86891148-86891170 TGCTGCTTGTCCCCTGGTGGTGG No data
1071592739_1071592744 9 Left 1071592739 10:86891119-86891141 CCTGCATGACGGTCATCGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1071592744 10:86891151-86891173 TGCTTGTCCCCTGGTGGTGGTGG No data
1071592739_1071592745 10 Left 1071592739 10:86891119-86891141 CCTGCATGACGGTCATCGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1071592745 10:86891152-86891174 GCTTGTCCCCTGGTGGTGGTGGG No data
1071592739_1071592741 0 Left 1071592739 10:86891119-86891141 CCTGCATGACGGTCATCGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1071592741 10:86891142-86891164 TAGGTTTGCTGCTTGTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071592739 Original CRISPR AGACACGATGACCGTCATGC AGG (reversed) Intronic
917338567 1:173950557-173950579 AGACAGGATCTCCCTCATGCTGG - Intronic
924610768 1:245571974-245571996 AGACAAGATGAGCGTGCTGCTGG + Intronic
1071465334 10:85934739-85934761 AGACAGGATGCCAGTCACGCTGG + Intronic
1071592739 10:86891119-86891141 AGACACGATGACCGTCATGCAGG - Intronic
1072597123 10:96884428-96884450 AGAAAGGATGACAGTCTTGCTGG - Intronic
1077057952 11:604954-604976 AGGCATGATGACCGACAAGCAGG - Intronic
1094161629 12:27396917-27396939 AGACAAAATGACCCTCAAGCAGG - Intronic
1096601040 12:52729729-52729751 AAACACGATGACCAAGATGCAGG + Intergenic
1128251421 15:66166622-66166644 AGACAGGAGGACCATCAGGCTGG - Intronic
1130728309 15:86464136-86464158 GGACACGAAGACCGTCTTTCTGG - Intronic
1141744733 16:85918381-85918403 GGACACGATGACGGTGCTGCGGG - Intronic
1158000500 18:52613051-52613073 AGACAGGATGGACATCATGCTGG + Intronic
1162349075 19:10137951-10137973 AGACACGATGTCCGACCTGCCGG - Exonic
926156893 2:10460627-10460649 AGCCACGATGAACGGCGTGCGGG + Intergenic
1170924537 20:20711656-20711678 AGACAGCATCACTGTCATGCCGG + Intronic
1179615245 21:42579347-42579369 AGACAAGAGGACCATAATGCGGG - Intronic
955767903 3:62364052-62364074 AGAAACAATGACAGTCATGTTGG + Intergenic
956178021 3:66492452-66492474 AAACACGATGAACGTAATGCAGG - Intronic
956643300 3:71434603-71434625 GGACACGGTGACCCTCATGAGGG + Intronic
956695702 3:71917402-71917424 ACACACCATGGCCGTCATCCTGG - Intergenic
969954151 4:10871028-10871050 AAGCAAGATGACCGTGATGCTGG + Intergenic
970293294 4:14600681-14600703 AGAGACTATGACAGTCAGGCAGG - Intergenic
972560898 4:40227735-40227757 AGAAACAATGACCGTCTTGCTGG + Intronic
986169237 5:5302357-5302379 AGACATGATGAGCCTCCTGCTGG + Intronic
1002981690 6:2144325-2144347 AGACAGGAGGCCCGCCATGCAGG + Intronic
1022488875 7:30801358-30801380 ACACAGGATGACCGGCATGCTGG - Intronic
1024155917 7:46625005-46625027 AGACATGATGACTGTTATGTTGG - Intergenic
1037396404 8:18448521-18448543 ATACAGGATGAATGTCATGCTGG + Intergenic
1055065371 9:72113273-72113295 AGACAAAATGGCAGTCATGCTGG + Intergenic
1187200184 X:17127211-17127233 AGAAAAGATGACGGTCATGTAGG - Intronic