ID: 1071592749

View in Genome Browser
Species Human (GRCh38)
Location 10:86891162-86891184
Sequence TGGTGGTGGTGGGCTCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071592739_1071592749 20 Left 1071592739 10:86891119-86891141 CCTGCATGACGGTCATCGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1071592749 10:86891162-86891184 TGGTGGTGGTGGGCTCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071592749 Original CRISPR TGGTGGTGGTGGGCTCTGCG TGG Intronic
No off target data available for this crispr