ID: 1071595788

View in Genome Browser
Species Human (GRCh38)
Location 10:86922947-86922969
Sequence CAGGCCTGAGACCTTCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071595788 Original CRISPR CAGGCCTGAGACCTTCCCTT AGG (reversed) Intronic
900564390 1:3325179-3325201 CAGGCATGAGAGATTTCCTTGGG - Intronic
900939557 1:5789690-5789712 CAGTTCAGAGACCTTCCCATAGG - Intergenic
904438231 1:30513151-30513173 CAGGCCTGGTCCCTGCCCTTAGG - Intergenic
904499524 1:30906244-30906266 CAGGCCTCACATCTTCCCATGGG - Intronic
904538943 1:31219690-31219712 GTGGCCTGAGACCTTCCTTTGGG - Intronic
905280616 1:36846719-36846741 CAAGCCTGAGAGCATCCCCTAGG + Intronic
905503645 1:38459295-38459317 CAGACCTGAGCCCTGCCCATGGG - Intergenic
905518699 1:38580974-38580996 CAGTCCTCCCACCTTCCCTTTGG - Intergenic
905689301 1:39931057-39931079 CAAGCCTGATACATTTCCTTTGG + Intergenic
906059306 1:42938052-42938074 CATGCCTGACACTGTCCCTTGGG + Intronic
909860103 1:80594266-80594288 CAGGGCTGAGACCTTGCTTTAGG - Intergenic
911939033 1:104018914-104018936 CAGGCCTATGTCCCTCCCTTTGG + Intergenic
914971380 1:152310294-152310316 GAGGCATCAGACCTTCCCTGGGG + Exonic
915903374 1:159861905-159861927 CAGGCCTGAGACCTCAGCCTTGG - Intronic
916331720 1:163625047-163625069 CAGGGCTGAGAACTTGCCTCAGG + Intergenic
916482981 1:165232242-165232264 CTGTCCTGAGCCCTTTCCTTTGG + Intronic
919408053 1:197209118-197209140 CAGGGCTGAGAACTTACCCTAGG + Intergenic
919727825 1:200895322-200895344 CAGGCCTGAGACCTGGCTTTGGG + Intronic
921042679 1:211448703-211448725 CAGGCCTGTCTCCTTTCCTTTGG - Intergenic
922567427 1:226610121-226610143 CAGGGCGGGGCCCTTCCCTTGGG - Intergenic
923541514 1:234891372-234891394 CTGGCCTGACACCTTCCCACAGG + Intergenic
923543117 1:234903710-234903732 CAGGCCTCAGTCCATCCATTGGG + Intergenic
1062973451 10:1665794-1665816 CTGGCCTGAGGCCTTCTCTGGGG - Intronic
1065921873 10:30399920-30399942 CAGGCCTGGGACTCACCCTTTGG - Intergenic
1067295104 10:44971195-44971217 CAGGGCTGTGGCTTTCCCTTCGG + Intronic
1067508217 10:46874271-46874293 CAGGACTGACACTTTCCATTTGG + Intergenic
1067654034 10:48177574-48177596 CAGGACTGACACTTTCCATTTGG - Intronic
1068775564 10:60864490-60864512 CATGCCTGAGACCTTGCCACTGG + Intergenic
1069223378 10:65911023-65911045 CAGACCTGAACACTTCCCTTGGG - Intergenic
1069395053 10:67978551-67978573 CTGGCCTGTGTCCTTCCCTTCGG - Intronic
1069842288 10:71347375-71347397 CAGGACTGAGACCTGCCCCAGGG + Intronic
1071595788 10:86922947-86922969 CAGGCCTGAGACCTTCCCTTAGG - Intronic
1072885154 10:99266245-99266267 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1073104132 10:101022499-101022521 CAGGCCTGAGACCTGCAGTGGGG + Intronic
1074974138 10:118566754-118566776 CATGCCTGAGTCCTGCCCTGTGG + Intergenic
1075967992 10:126629397-126629419 CTGGCCAGAGACCATCTCTTCGG + Intronic
1076534659 10:131168891-131168913 CAGGCCTGAGGGCGTCTCTTGGG - Intronic
1077490946 11:2860721-2860743 CAGGCCTTACAGTTTCCCTTAGG - Intergenic
1077498509 11:2898234-2898256 AAGGCCTGGGAGCTTCCCTGGGG - Intronic
1078448409 11:11422261-11422283 CAGGCCTGAGAGTTCCTCTTGGG - Intronic
1081282137 11:41222667-41222689 GAAGCATGAGACCTTCCCCTGGG - Intronic
1081555554 11:44157598-44157620 CAGGCCTGGGTCGCTCCCTTCGG + Intronic
1083164566 11:60875529-60875551 CCAGCCTGAGACCTCTCCTTTGG + Exonic
1083721631 11:64606524-64606546 CAGGCCTGAGCCCCTTCCCTGGG + Exonic
1084954725 11:72685183-72685205 CAGGGCTGAGAGCTGCGCTTTGG - Exonic
1085346930 11:75774228-75774250 CAGGCCTGACTCCTACCCCTGGG - Intronic
1086462870 11:87022961-87022983 CAGGTCTGACAGCTTCCCTGGGG - Intergenic
1087085255 11:94211853-94211875 GAGGCCTGGGACCTGCCCTAGGG - Intergenic
1087467727 11:98530483-98530505 CAGGACTGAGAATTTCTCTTGGG - Intergenic
1087568818 11:99896916-99896938 CAGGCCTCTGATATTCCCTTGGG + Intronic
1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG + Intronic
1091788676 12:3258454-3258476 CAGGCCAGAGACATTCACTGAGG - Intronic
1091967120 12:4754261-4754283 CAGGCCTGTGTCCTTCCTTTCGG + Intronic
1092246775 12:6868164-6868186 CAGATCTGACCCCTTCCCTTCGG + Intronic
1092495133 12:8985984-8986006 AAGGCCAGAGGCCTTCCCCTTGG + Intronic
1093336580 12:17912383-17912405 CAGGCCTGTGATCTGCCTTTGGG - Intergenic
1094741763 12:33297105-33297127 CAGGATTGTGTCCTTCCCTTTGG - Intergenic
1094838425 12:34333009-34333031 TGGGCCTGAGGCCTTCCGTTGGG - Intergenic
1096469967 12:51869574-51869596 GAGGGCTGAGAGATTCCCTTTGG + Intergenic
1096793930 12:54062118-54062140 GAGGCCAGAGGCCTTCCATTTGG - Intergenic
1097202303 12:57289592-57289614 AAAGCCTGAAACATTCCCTTTGG + Intronic
1097616099 12:61886310-61886332 CAGGCCTGACTCCTTTTCTTGGG + Intronic
1102454819 12:113064995-113065017 CAGGCCTGAGACCCTCCTCCAGG - Intronic
1102999036 12:117371103-117371125 CTGTCCGGAGACCTTCCCTGTGG - Intronic
1106995887 13:35478905-35478927 CAGGCCCGCGTCCTTCCCGTTGG - Intronic
1107709996 13:43142191-43142213 CAGGCATGAGACCTTTCCCTGGG + Intergenic
1107885896 13:44873895-44873917 AAGCCCTGAGACCTTCCATCCGG + Intergenic
1107993453 13:45838630-45838652 CATGTCTGAGGCCTTTCCTTAGG + Intronic
1108188909 13:47917271-47917293 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1109022682 13:57118740-57118762 CAGGCCTGTGTCCTTCCTTTAGG + Intergenic
1109422488 13:62131737-62131759 GAGGCCTGACACCTTCCTTGTGG - Intergenic
1110504692 13:76272015-76272037 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1110917193 13:81035926-81035948 CAGGGCTTAGACACTCCCTTTGG + Intergenic
1111657096 13:91167379-91167401 CAGGTTTGAGACCATCTCTTTGG - Intergenic
1112502995 13:99956606-99956628 CAGGCCGGAGGCCAGCCCTTTGG - Intergenic
1112901417 13:104362615-104362637 CAGGCCTGTGTTCTTCTCTTTGG + Intergenic
1113780453 13:112973799-112973821 CACTCCTGAGACCTTGCCTGTGG - Intronic
1113852962 13:113428543-113428565 CAGGGCTGGGCCCTTCCCTCAGG - Intronic
1115115081 14:29871159-29871181 CTGAGCAGAGACCTTCCCTTTGG + Intronic
1115174572 14:30547644-30547666 CAGGTCTGAGCCCTGCCCTGCGG + Intergenic
1117795394 14:59388455-59388477 CAGGGCAGTGAGCTTCCCTTTGG + Intergenic
1118352445 14:64982907-64982929 CAGGACTGAGACCTGGCCCTTGG + Intronic
1119465803 14:74857344-74857366 CAGGCCTGGGGCCTTCCACTTGG + Intronic
1119768346 14:77204998-77205020 CTGGCCTGAGCTCTTCCCTAAGG + Intronic
1121514207 14:94538484-94538506 CAGGCCTGCCACCTTCCACTGGG - Intergenic
1122231652 14:100309081-100309103 CAGACCTGGGACCTGCCCTCAGG - Intergenic
1123895843 15:24829277-24829299 CAGGCCTGAAACTTGCCCTCTGG - Intronic
1124380682 15:29162404-29162426 CAGGCTTGAGAACTTGCCTCAGG - Intronic
1125316869 15:38441330-38441352 GAGACCTGTGATCTTCCCTTGGG - Intergenic
1126038036 15:44565763-44565785 TAGCCCTGAGACCTTACCTCTGG + Intronic
1126156988 15:45574622-45574644 CAGGCAGGAGCCCTGCCCTTCGG - Intergenic
1127971428 15:63965518-63965540 CAGGCTTGTGTCCTTCCCTCAGG + Intronic
1129604821 15:77019733-77019755 CGGCCCTCAGCCCTTCCCTTGGG - Intronic
1130650239 15:85758329-85758351 CAGGCCTGAGCGCTTCACTCTGG - Intergenic
1131605614 15:93900203-93900225 CAGGGCTGTGACACTCCCTTTGG - Intergenic
1132299046 15:100765265-100765287 CAGGCCTGAGAGCTCCCCCAAGG - Intergenic
1134346067 16:13393061-13393083 CAGGCCTGAAAGCCTCCATTTGG - Intergenic
1135495954 16:22951300-22951322 CTGGACTGAGTCCTTCCCTCGGG - Intergenic
1135929471 16:26724521-26724543 CATGCCTGTGACTTTCCCTGGGG - Intergenic
1136254517 16:29029327-29029349 CAGGCCTCGGCCCTTCCCTAGGG + Intergenic
1136450373 16:30351325-30351347 CACCCCTGAGACCATCCCTGGGG + Exonic
1137444339 16:48522689-48522711 CAGGCCAGAGCCCTTCCCACTGG + Intergenic
1141311006 16:82913233-82913255 CAGACCTGCTACCTGCCCTTTGG - Intronic
1142940492 17:3376672-3376694 CAGGGCTGAGATCTTCCCCCAGG + Intergenic
1146544239 17:33724602-33724624 CAGGCCAAAGCCCCTCCCTTAGG - Intronic
1147453168 17:40518897-40518919 CAGGCCTGCGCCCTTCCCTGAGG + Intergenic
1150163530 17:62919638-62919660 CATGGCTGAGAACTCCCCTTGGG + Intergenic
1151877602 17:76876102-76876124 CCGGCCTGAGTCCCTGCCTTGGG - Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152310986 17:79549636-79549658 CAGGCCTGAGGCCTTCCTGTGGG + Intergenic
1152919961 17:83061662-83061684 AGGGCCTGAAACCTCCCCTTTGG + Intergenic
1153662429 18:7336893-7336915 CAGACCTAGGACCTTCACTTTGG - Intergenic
1155175540 18:23298281-23298303 CGGGCTCGATACCTTCCCTTGGG + Intronic
1156721535 18:40076137-40076159 TAGGCGGGAGACCTTCTCTTAGG - Intergenic
1160130607 18:76221938-76221960 TAGGGTTAAGACCTTCCCTTGGG - Intergenic
1160518957 18:79493686-79493708 CAGGTCTGAGGCCTTCCCCCCGG + Intronic
1160606030 18:80050012-80050034 AGGGCCTGAGACCCTCTCTTAGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162954819 19:14091819-14091841 CAGGCCTGAGAACTCCTCCTGGG + Exonic
1163371621 19:16904188-16904210 CAGCCCTGAGCCCCTCCCTCTGG + Intronic
1166660975 19:44647190-44647212 CGGGTCTGACACCTTCTCTTCGG + Intronic
1167538547 19:50070961-50070983 CCGGCCTGAGATGCTCCCTTTGG + Intergenic
1167798873 19:51727541-51727563 CAGCCCTGGGCCCTGCCCTTGGG + Intergenic
925787732 2:7449006-7449028 CAGGCCTGATTCTTACCCTTTGG - Intergenic
929506725 2:42534050-42534072 AAAACCTGAAACCTTCCCTTTGG + Intronic
930469558 2:51795228-51795250 CAGGGCTGAGAACTTCCCCCAGG - Intergenic
930527591 2:52549108-52549130 CAGGCCTGTGTCTTTCTCTTTGG - Intergenic
931572293 2:63681316-63681338 CAGGCCTGTGACTCACCCTTCGG - Intronic
932251480 2:70248339-70248361 CAGGGCCGAGGCCTTCCCTCCGG + Intronic
932384939 2:71323571-71323593 CAGGCCTGAGAACTTGCCCCAGG + Intronic
933348905 2:81127866-81127888 CAGACCTGTGTCCTTCCCTTCGG + Intergenic
937980511 2:127611962-127611984 CAGCCCTGAGCCCCTCCCTGGGG + Intronic
938216687 2:129523498-129523520 CAGGGCTGACAACTTGCCTTGGG + Intergenic
938725289 2:134103381-134103403 CAGGTCTGAGCCTTTCCCTTGGG - Intergenic
941357635 2:164512548-164512570 CAGGCTTGTGTCCTTCCCTCAGG - Intronic
941357856 2:164514808-164514830 CAGGGCTGAGAACTTGCCTCAGG - Intronic
941402243 2:165045093-165045115 CAGGGCTGAGAACTTGCCCTAGG + Intergenic
941416985 2:165233171-165233193 GAGGCCTGAGCACTTTCCTTTGG + Intergenic
943909285 2:193542482-193542504 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
944012021 2:194984042-194984064 CAGGCCTGTGATCTGCCCGTAGG + Intergenic
944516764 2:200520438-200520460 CAGGCCCGAGTCCTTAACTTTGG - Intronic
945163724 2:206920243-206920265 CAGGCCTGATACCTTGCCACAGG - Intergenic
945575680 2:211525719-211525741 CAGGCCTGAGACTCACCCTTCGG - Intronic
947301453 2:228692180-228692202 CAGGCCTCTGACCTTCCCTTTGG + Intergenic
948280138 2:236740715-236740737 AAGGCCTGAGAGCTCCCCTGGGG + Intergenic
1169643669 20:7783955-7783977 CAGGCCTGAAGCATTCTCTTTGG + Intergenic
1169946106 20:10990777-10990799 CAGGCCTGGGAGCTACACTTGGG - Intergenic
1171160347 20:22916642-22916664 CAGGCCTGAGAACTTGCCCCAGG + Intergenic
1172884791 20:38223652-38223674 CTGGGCTGACACCTGCCCTTTGG - Intronic
1172920450 20:38477308-38477330 TATGCCTGAGACCTTCTCTGAGG - Intronic
1173858196 20:46264754-46264776 CAGGCCTGAGTCCCTCCTTAAGG + Intronic
1173942275 20:46921507-46921529 CAGACCTGTGACCTCCCCATGGG + Intronic
1174366802 20:50061442-50061464 AAGCCCTGACACCTTCCCTGTGG + Intergenic
1174456033 20:50649508-50649530 CAGTCCTGACACTTTCCCTCTGG + Intronic
1175069039 20:56316370-56316392 CAGGAGTGAGACCGTTCCTTCGG + Intergenic
1175142374 20:56870549-56870571 CAGGACTGAGACAGTCCCTTTGG + Intergenic
1175688049 20:61045642-61045664 CAGGTGTAAGACCTTCCCATGGG + Intergenic
1175828694 20:61950779-61950801 CAGCCCTGTGGCCTGCCCTTCGG - Intergenic
1177847373 21:26306226-26306248 CAGGGCTGAGAACTTGCCTCAGG - Intergenic
1178440576 21:32594906-32594928 CAGGCCTGAGTCCCTCTCATTGG + Intronic
1179284381 21:39964188-39964210 AATGCCTGAGACCTTCCTGTGGG + Intergenic
1180055762 21:45358464-45358486 CAGGACTGAGAGCTTCGCTCAGG + Intergenic
1181177527 22:21046143-21046165 CAGGCCCGACTCCTCCCCTTTGG + Intronic
1183367746 22:37416280-37416302 CAGGCCTAACTCCTTCCCTGGGG - Intronic
1184500801 22:44870442-44870464 CAGCCCTGAGCCCTATCCTTCGG + Intergenic
1184671075 22:46012610-46012632 TACGCCTGTGTCCTTCCCTTCGG - Intergenic
1184785252 22:46668468-46668490 CGGGCCTGAGTCCTTCCCAGGGG - Intronic
1184830100 22:46979933-46979955 CAGGCCTGTGGCATTCCCATGGG + Intronic
950362181 3:12457362-12457384 CTGGCCTGGGCCCTTTCCTTAGG - Intergenic
950498184 3:13346947-13346969 CAGCCCTGTGACCTTCCCAAGGG + Intronic
950502568 3:13373572-13373594 CAAGCCCCAGCCCTTCCCTTAGG - Intronic
951294470 3:20917399-20917421 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
953032443 3:39187419-39187441 CAGGCCTCAGGCCGTCCCTGTGG - Exonic
953185253 3:40631570-40631592 CAGGGCTGAGAACTTGCCTTAGG - Intergenic
953456053 3:43043176-43043198 CAGGCCTGGGACCTTCACGGTGG - Intronic
954295371 3:49671734-49671756 CAAGCTTGGGACCTCCCCTTGGG - Intergenic
954296885 3:49679258-49679280 CAGGACTGAGGCCTTCCCCCAGG + Intronic
954380139 3:50214986-50215008 CAGGCCAGAGACTGTCCTTTTGG + Intronic
954880328 3:53831342-53831364 CAGGCTTGTGGCCTTCCCTTTGG - Intronic
955040911 3:55316987-55317009 CAGGACTCAAACCCTCCCTTTGG + Intergenic
955461203 3:59185192-59185214 CAGGCCTGATCACTTCCCTAAGG + Intergenic
955539358 3:59957730-59957752 AAGATCTGAGACCTTCCTTTAGG + Intronic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
956675273 3:71726170-71726192 CAGGCTTGAGGCCTTCACTGTGG - Intronic
958605752 3:96356189-96356211 CAGGTCTGAGAGTTTCCCTAGGG - Intergenic
960153502 3:114274861-114274883 CAGCCCTGAGACTCTCCCTTCGG + Intergenic
960516502 3:118608080-118608102 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
961457092 3:127029635-127029657 CAGGCTTGACACCTGCCCCTGGG - Intronic
961809374 3:129513110-129513132 AAGGCCTGAGAGCCTACCTTTGG + Intronic
962324956 3:134425201-134425223 CAGTGCTGAGACATTCCTTTCGG + Intergenic
964629759 3:158797796-158797818 CATGCCTGAGAACTTCTCCTTGG - Intronic
965466283 3:169034548-169034570 CAGCCCTGAGACATTCCCTTAGG - Intergenic
966076090 3:175937607-175937629 CAGTCCCGAGACCTGCCCTGCGG - Intergenic
967287707 3:187889565-187889587 GAGGTCTGATACCTTGCCTTAGG + Intergenic
967651304 3:191990089-191990111 CAGGGCTGAGAACTTCCCCCAGG - Intergenic
967843853 3:194029275-194029297 CAGACCTGAGTACTTCCCATGGG - Intergenic
969536636 4:7760383-7760405 CTTCCTTGAGACCTTCCCTTGGG - Exonic
970113215 4:12662199-12662221 CAAGTCTGAGACCTTCATTTCGG + Intergenic
970116349 4:12700736-12700758 CAGCCCTGATATCTTGCCTTGGG - Intergenic
970775320 4:19668032-19668054 AAGGCCTGAGAATTTCTCTTAGG - Intergenic
972826749 4:42767862-42767884 CAGGCCTGAGAACTTGCCCCAGG - Intergenic
973573667 4:52264955-52264977 CTGGTCTGTGACCTTCCTTTGGG - Intergenic
975718401 4:77227496-77227518 CAGGGCTGAGATCTTGCCTCAGG + Intronic
975970924 4:80035699-80035721 CACGCTTGAGACCTTTCCTATGG - Intronic
976092166 4:81470522-81470544 CAGTTCAGAGACCCTCCCTTCGG + Intronic
976161281 4:82201865-82201887 CAGGACTGGGTCCTTCTCTTTGG - Intergenic
977423812 4:96839341-96839363 TAGGCTTGAAACCTTCCATTGGG - Intergenic
978048385 4:104163692-104163714 CAGTCCTGGGTTCTTCCCTTGGG + Intergenic
979678891 4:123437869-123437891 CAGGCCTGATACTTTACTTTAGG - Intergenic
980712819 4:136591925-136591947 CAGGCTTGTGTCCTTCCCTTTGG - Intergenic
982630514 4:157824200-157824222 CAGGGCTGAGAATTTGCCTTGGG - Intergenic
982719775 4:158847772-158847794 CAGGCCTGGGACTCACCCTTAGG - Intronic
983040114 4:162915037-162915059 CAGGTCTGTGATCTGCCCTTGGG + Intergenic
984166487 4:176308424-176308446 TAGGACTGAGTCCTTCCCTTCGG - Intergenic
984861333 4:184242957-184242979 AAGGACTGAGACCTTATCTTAGG - Intergenic
986290714 5:6396942-6396964 CAGCCCTGTGACCTGCCCTGAGG - Intergenic
986644649 5:9904525-9904547 AAGGCTTGAGACCTACCCATAGG + Intergenic
987927906 5:24365269-24365291 CAGCCCTGTGATCTGCCCTTGGG + Intergenic
989214716 5:38892287-38892309 CTGGCCTGGGATATTCCCTTGGG + Intronic
990492074 5:56312349-56312371 CAGCCCTGAGTCCTTGCCTGAGG + Intergenic
992248923 5:74857855-74857877 CAGGCACAAGAACTTCCCTTGGG + Intronic
994816377 5:104592615-104592637 GAGGTCTGGGACTTTCCCTTTGG - Intergenic
996395824 5:123012884-123012906 CTGGCCAGAGACCTGTCCTTGGG + Intronic
996646816 5:125827076-125827098 CAGCCCTGAGACCCTTCATTAGG - Intergenic
996931579 5:128895831-128895853 CAGGCTTGTGTCCTTCCCTCAGG + Intronic
998577569 5:143333252-143333274 CAGGGCTGAAAACTGCCCTTGGG + Intronic
999108580 5:149095199-149095221 CAGGGCTGAGATCTTGCCTCAGG - Intergenic
999818464 5:155200771-155200793 CAGGCTTGAGAACTTGCCTCAGG - Intergenic
1000024116 5:157343927-157343949 CAGGTCTGTGACCTCCCCTCAGG + Intronic
1001302134 5:170541287-170541309 CAGGCCTGAAGCATTCCTTTTGG + Intronic
1002184277 5:177447019-177447041 CAGGACTGAGCCCTTCCCCGCGG + Intronic
1004908537 6:20259762-20259784 CAGGTCCGAGCCCTTCCCTGCGG - Intergenic
1006420985 6:33934007-33934029 CAGGACTGAGCTCTTCCCGTGGG - Intergenic
1006554149 6:34851681-34851703 CAGGCATGTGTGCTTCCCTTTGG + Intronic
1006633849 6:35448425-35448447 CAGTCCTGAGCGCTCCCCTTGGG - Intergenic
1007570465 6:42886477-42886499 CAGGGCTGAAAACTGCCCTTGGG + Exonic
1007817995 6:44538343-44538365 GAGGAATGAGACCTTGCCTTAGG + Intergenic
1008227262 6:48936191-48936213 CAGGCCTGGGACACACCCTTAGG + Intergenic
1008258810 6:49339485-49339507 CAAACCAGAGACCTTCTCTTGGG + Intergenic
1012203739 6:96436574-96436596 CAGGCCTGAGATCTTGCCCCAGG - Intergenic
1012679021 6:102154580-102154602 CAGGTCTGTGTACTTCCCTTTGG - Intergenic
1016061501 6:139635983-139636005 CAGGCCTGTTTCCTTCCCTTTGG + Intergenic
1018535917 6:164818701-164818723 CAGGCCTATGTCCTTCCCTTTGG - Intergenic
1018881992 6:167893160-167893182 CAGGCCTGCCACCAACCCTTAGG - Intronic
1019268628 7:133695-133717 CAGGTCTGAATCCTTCCCTCGGG - Intergenic
1021202506 7:17742022-17742044 CAGGCCTGTGATCTTCCCTCTGG + Intergenic
1021901366 7:25288998-25289020 CAGGCCTGAGTGCTTCTCTCTGG - Intergenic
1023159670 7:37284966-37284988 GAGGCCTGAGGCCTTCCCCATGG - Intronic
1023295755 7:38713670-38713692 CAGGCATGAGACAGGCCCTTGGG - Intergenic
1024632227 7:51259394-51259416 CAGGGCTGAAAACTGCCCTTGGG - Intronic
1024799641 7:53061238-53061260 CATGTCTGACTCCTTCCCTTTGG - Intergenic
1027715000 7:81659009-81659031 GAGGCCTGTGACATTCCCTCAGG + Intergenic
1029116817 7:98241836-98241858 CAGGCCTAGGAGCCTCCCTTCGG + Intronic
1029360868 7:100087948-100087970 CAAGCATGAGACCTTCTCCTTGG + Intergenic
1031374530 7:121007909-121007931 GATGCCTGAGACCTGCCCTAAGG - Intronic
1032658246 7:133954990-133955012 CAGGGCTGTGACATCCCCTTTGG - Intronic
1032781233 7:135166704-135166726 CAGGCCTCAGCCCTTCCCAGAGG - Exonic
1034581751 7:152049980-152050002 CAGGCCTGAGACTCTCCCTTCGG + Intronic
1035235940 7:157497786-157497808 CAGGCCTGAAACCCTCCCATTGG + Intergenic
1035708905 8:1697685-1697707 CAGGCCTAAAACTTTCCCTGTGG - Intronic
1036129583 8:6096729-6096751 GAGGCCTGAGACCCTCACCTGGG + Intergenic
1036467850 8:9018308-9018330 CAGAGCTGATACCTTCCCTCAGG + Exonic
1037384001 8:18318150-18318172 CAGGCAGGGGACCTTCCCGTAGG + Intergenic
1037390402 8:18386760-18386782 GAGGCCTGAGAGCTTCCCAGAGG - Intergenic
1038217810 8:25578626-25578648 CTGGCCTCAGACCCTTCCTTTGG - Intergenic
1038275605 8:26118346-26118368 CATGCCTGAGCCCCTCCCATTGG + Intergenic
1038420427 8:27430811-27430833 CAGGTCTCACTCCTTCCCTTAGG - Intronic
1039001042 8:32980137-32980159 CAGGGCTGAGAACTTGCCTCAGG + Intergenic
1040384899 8:46908016-46908038 CAGGCCTGCCTCCTTCCCTCTGG - Intergenic
1040468569 8:47717330-47717352 CAGAGCTGAGACCTTCACTGTGG - Intronic
1040967060 8:53093252-53093274 CAGGACTGAGAACTTGCCCTGGG + Intergenic
1041616119 8:59908078-59908100 CAGGCTTTTGCCCTTCCCTTAGG - Intergenic
1043134142 8:76500364-76500386 CAGGCTTCTGGCCTTCCCTTTGG + Intergenic
1043584159 8:81748041-81748063 CAGTCCCGAGACCTACCCATAGG + Intronic
1044273363 8:90272463-90272485 CAGCCTTGAGACCACCCCTTCGG - Intergenic
1044432824 8:92128486-92128508 CAGAACTGAGACTCTCCCTTGGG + Intergenic
1045841902 8:106590799-106590821 CAGGGCTGAAAACTGCCCTTGGG - Intronic
1048201095 8:132374380-132374402 CTTGCCTGAGGCTTTCCCTTAGG + Intronic
1048314468 8:133351873-133351895 CTGCCCTGAGACTTTCCCTTTGG - Intergenic
1050068378 9:1785367-1785389 CAGGCCTAAGAACTTCCCTTTGG - Intergenic
1053276662 9:36788354-36788376 CAGGGCTTAGATCTTGCCTTTGG - Intergenic
1054761796 9:69011461-69011483 CAGGCCTGAGAGCTCCTCCTGGG + Intergenic
1056456679 9:86767073-86767095 AAGCCCTTAGAACTTCCCTTCGG + Intergenic
1058103037 9:100937870-100937892 CAGGCCTGTGATCTTCCTTCAGG - Intergenic
1058580954 9:106456527-106456549 CAGGCATGAGTCCTTACCCTTGG - Intergenic
1058957762 9:109964798-109964820 CAGGCCATGGAGCTTCCCTTGGG + Intronic
1059776959 9:117485499-117485521 CAGCCCTGAGACAGTCTCTTTGG - Intergenic
1061152612 9:128837493-128837515 CAGCCCTCAGGCCTTCCCTGGGG + Intronic
1062211221 9:135365363-135365385 CATGCCTCAGACCCTCCCTGGGG + Intergenic
1062278243 9:135740638-135740660 CAGGGCTGAGACCCTCTCCTGGG + Intronic
1062406998 9:136401357-136401379 CAGGCCACAGGCCTTCCCTGAGG - Intergenic
1062541460 9:137043460-137043482 CAGACCTGGGCCCTTCCCTCTGG - Intronic
1062713528 9:137990050-137990072 CAGGGCTGAGAACTTGCCTGTGG - Intronic
1185626248 X:1484345-1484367 TGGGCCTGAGAACCTCCCTTAGG - Intronic
1186030648 X:5365742-5365764 CAGGCATGATTCCTTCCCCTTGG - Intergenic
1187261064 X:17685784-17685806 GATGCCTGAGACCATCCCTAGGG + Intronic
1188046168 X:25428166-25428188 CAGGCCTGTGTCCTTCCTTCAGG + Intergenic
1188871856 X:35382620-35382642 CAGGCCTGTGATCTGCCCTGGGG - Intergenic
1189353418 X:40294136-40294158 CAGGTCTGAGACCATTCCTGAGG + Intergenic
1190897356 X:54633806-54633828 CAGGGCTGAGATCTTGCCTCTGG + Intergenic
1190911736 X:54777387-54777409 CAGGCCTGTGTCCTTCACTTTGG - Intronic
1192763339 X:74118959-74118981 CAAGCCTGTGATCTTCCCTTAGG + Intergenic
1192953553 X:76044068-76044090 CAGGCATGTGATATTCCCTTGGG - Intergenic
1192968221 X:76202572-76202594 CAGGGCTGAGAACTTGCCTCAGG + Intergenic
1193087013 X:77455805-77455827 CAGGCCTGAGACCCTTCATTAGG + Intronic
1193210076 X:78797184-78797206 CAGGCTTGTTTCCTTCCCTTTGG + Intergenic
1193260864 X:79404594-79404616 CAGGCTTGTGTCCTTCCCCTAGG - Intergenic
1193467519 X:81867198-81867220 CAGGGCTGTGACTTTCTCTTTGG - Intergenic
1193877778 X:86883611-86883633 CAGTCCTGTGTCCTTCCCTTTGG + Intergenic
1193931768 X:87561917-87561939 CAGGACTGGGTCCTTCCCCTTGG - Intronic
1194387806 X:93278420-93278442 CAGGCCTGGGTCTCTCCCTTCGG - Intergenic
1194476962 X:94369928-94369950 CAGGTCTGTGACTTTCCCTTTGG - Intergenic
1194481031 X:94424622-94424644 CAGGCCTGTGTCCTTCCCTTCGG + Intergenic
1194510081 X:94783206-94783228 CAGGTCTGAGAACTTGCCCTAGG - Intergenic
1194532784 X:95071809-95071831 CAGTGCTGAGAACTTGCCTTAGG - Intergenic
1195045993 X:101055122-101055144 CAGGCCAGAGAATTTACCTTTGG + Intergenic
1196467888 X:115991663-115991685 CAGGCCTGTGTCCTTCCCTTTGG - Intergenic
1197304729 X:124827594-124827616 AAGGTCTGTGACCTTCCCTGTGG + Intronic
1198515128 X:137399794-137399816 CAGGCTTGTGTTCTTCCCTTCGG + Intergenic
1199239218 X:145526819-145526841 CAGGCCTGTGTCCTTCCGTTCGG - Intergenic
1199304012 X:146245597-146245619 CAGACTTGTGCCCTTCCCTTTGG - Intergenic
1199908531 X:152260317-152260339 CAGGCCTGTGTCCTTCCATTTGG - Intronic
1199948063 X:152683079-152683101 CAGGCCAGGGACCTCTCCTTGGG - Intergenic
1199961616 X:152785375-152785397 CAGGCCAGGGACCTCTCCTTGGG + Intergenic
1200249517 X:154545369-154545391 CAGGCCTCAGATCCTGCCTTTGG + Intronic
1201930904 Y:19345798-19345820 CAGGGCTGAGATCTTGCCTTAGG + Intergenic