ID: 1071596440

View in Genome Browser
Species Human (GRCh38)
Location 10:86930716-86930738
Sequence AAATTAGGATATAAGCACTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071596440_1071596443 28 Left 1071596440 10:86930716-86930738 CCTCAGTGCTTATATCCTAATTT 0: 1
1: 0
2: 2
3: 16
4: 192
Right 1071596443 10:86930767-86930789 TCACCCAGGCTAGTGTGCAGTGG 0: 40
1: 6081
2: 96463
3: 184710
4: 208486
1071596440_1071596442 14 Left 1071596440 10:86930716-86930738 CCTCAGTGCTTATATCCTAATTT 0: 1
1: 0
2: 2
3: 16
4: 192
Right 1071596442 10:86930753-86930775 ACAGTCTTGCACTGTCACCCAGG 0: 14
1: 1400
2: 13986
3: 51238
4: 107671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071596440 Original CRISPR AAATTAGGATATAAGCACTG AGG (reversed) Exonic
902194102 1:14785027-14785049 AGATTAAGATGTAAGCACGGGGG + Intronic
902794139 1:18789712-18789734 CAACTAGGATATAAGCACTGTGG - Intergenic
906550134 1:46658596-46658618 AAATTTGAACATAAGTACTGTGG - Intronic
909021604 1:70437497-70437519 AGATAAGGAAATAGGCACTGAGG + Intronic
910367622 1:86483626-86483648 AAATGAGAATATATGCACTAAGG - Intronic
911554869 1:99331276-99331298 AAATTGGTATATAACCACTTTGG + Intergenic
911958799 1:104272051-104272073 AAATTGGTATATATACACTGTGG - Intergenic
915042813 1:152983035-152983057 AAATGAGGAAATAAACACTGTGG + Intergenic
915215706 1:154339510-154339532 AAATTAGGTTGTAAGCACAAAGG - Intronic
915643570 1:157250080-157250102 AAATTAATAAATAAGCAATGTGG - Intergenic
919442926 1:197661171-197661193 AAATAGCGATCTAAGCACTGGGG - Intronic
921751982 1:218805593-218805615 AAATTAGAACAGAAGGACTGAGG - Intergenic
923295608 1:232591847-232591869 AAATTAGAACATAAGAAGTGAGG - Intergenic
923844029 1:237708307-237708329 AAAGTAACATATATGCACTGGGG - Intronic
924163922 1:241262674-241262696 AAATTGGGAAATAAACACTTAGG - Intronic
1066977166 10:42379520-42379542 TAATTAGCATATGAGCAGTGAGG + Intergenic
1067968133 10:50937471-50937493 AAATTAGTATCTAATCACTTAGG + Intergenic
1068005277 10:51385832-51385854 AAACTAGGAGATAATCCCTGTGG - Intronic
1068010344 10:51441470-51441492 AAATGAGAATATAAGCATTCAGG - Intronic
1069151235 10:64963229-64963251 AAATATGGATAAAAGCAATGAGG - Intergenic
1069273280 10:66558091-66558113 AAATGAGAGAATAAGCACTGGGG + Intronic
1070235883 10:74625722-74625744 AAATTATGGTAAAAGCACTAGGG + Intronic
1070472327 10:76794811-76794833 AAATTTGGAAATAAGCAATCAGG - Intergenic
1071596440 10:86930716-86930738 AAATTAGGATATAAGCACTGAGG - Exonic
1074289697 10:112129171-112129193 AAAAAAGGATAAAAGCACTTTGG - Intergenic
1075190422 10:120302238-120302260 AAAATAGGATATCTGCCCTGAGG + Intergenic
1079487502 11:20950797-20950819 ATTTTAGGAAATGAGCACTGTGG + Intronic
1081908070 11:46681732-46681754 AAATCAGAAAATATGCACTGAGG - Intronic
1084620376 11:70265910-70265932 AAATTATGATAGAAGGAGTGAGG - Intergenic
1084636955 11:70398917-70398939 AAATTGGGGTATCAGCTCTGAGG + Intronic
1087336956 11:96855900-96855922 AAATAAAGATCTGAGCACTGTGG + Intergenic
1089086739 11:115825873-115825895 ACATTATGATATAATCAGTGTGG + Intergenic
1090825498 11:130382409-130382431 ACATTAGGAGATGAGCACTATGG + Intergenic
1093472483 12:19517653-19517675 TATTTGGGATTTAAGCACTGGGG + Intronic
1093526714 12:20112179-20112201 AAGTTATGATAAAGGCACTGTGG + Intergenic
1093621598 12:21296907-21296929 AAGTTAGGCTAAAACCACTGAGG + Intronic
1093767278 12:22979353-22979375 TAATGAGGATATAAACACTACGG + Intergenic
1095696915 12:45154269-45154291 ACAGTTGGATATAAGCACAGGGG + Intergenic
1096200718 12:49680432-49680454 AAAAGAGGATAGAAGCACTGAGG - Intronic
1097782310 12:63722328-63722350 GAATTATGATAAAAGCAATGAGG + Intergenic
1099274977 12:80563457-80563479 ACATTAGGATATAAGGCCTTTGG - Intronic
1101388062 12:104275335-104275357 TAATGAGAATATATGCACTGCGG + Intronic
1101523771 12:105508579-105508601 AAATTAGTATATATGCACTCTGG - Intergenic
1101765193 12:107691525-107691547 AAATTAGGCCAGAAGCAATGAGG + Intronic
1103312243 12:120020093-120020115 AAATTAAAATATGGGCACTGGGG - Intronic
1104215951 12:126734032-126734054 ATGTAAGGATATAAGAACTGGGG - Intergenic
1105954992 13:25273425-25273447 AAATTTGTATAAAAACACTGTGG + Intronic
1106294665 13:28400652-28400674 GTATTTGGATATAAGGACTGAGG - Intronic
1108189902 13:47927660-47927682 ACATTAGGATAGAAGCAGGGAGG - Intergenic
1108345940 13:49547001-49547023 ATTTTAAGATATAAGAACTGGGG + Intronic
1112058535 13:95714268-95714290 AAAATAGTATATAATCACTCAGG + Intronic
1114296110 14:21330776-21330798 AAATTAGTATGTAAGACCTGAGG + Intronic
1114562660 14:23604413-23604435 TAATTAGCGTATAAGCAGTGAGG + Intergenic
1119697353 14:76723928-76723950 AACCTAGTATATAAGCACTTAGG + Intergenic
1119983149 14:79104766-79104788 AAATTAGGATGTGATAACTGGGG - Intronic
1120335198 14:83145517-83145539 AAATTAGGATATAGTCACATAGG - Intergenic
1120389673 14:83889492-83889514 TAATTAGCATATGAGCAGTGAGG - Intergenic
1121314825 14:92954709-92954731 AAATAAGGCTAAAAGCAGTGTGG - Intronic
1123716139 15:23033930-23033952 AAATTGGGATATTAGCTGTGTGG + Intronic
1124130611 15:26982119-26982141 TAATTAGGATGCAAACACTGTGG - Intronic
1125144206 15:36447427-36447449 TATTTAGGATGTAAGCCCTGTGG - Intergenic
1125369641 15:38959151-38959173 ACATTAGGAAATAAGCATTTTGG - Intergenic
1130873556 15:87992346-87992368 AAATTAGAAGATAAGCATTCAGG - Intronic
1132884766 16:2177824-2177846 AACTTAGGAGAGAAGCACGGAGG + Exonic
1133109655 16:3540158-3540180 AAATTAGGATATCACCTTTGTGG + Intronic
1133490078 16:6259655-6259677 AAATAAAGATAAAAACACTGGGG + Intronic
1134377169 16:13687756-13687778 AAATTAGAATATAAGCACCGTGG + Intergenic
1139012840 16:62654000-62654022 AAAATATGATAAATGCACTGAGG + Intergenic
1146224679 17:31055326-31055348 ACATTAGGATAGAAGCATAGAGG - Intergenic
1154084303 18:11287428-11287450 AAGTAAGGATATCAGCACTGGGG - Intergenic
1155424716 18:25695040-25695062 ACATTTGGATATAAGGCCTGTGG + Intergenic
1155781580 18:29844261-29844283 AAATTAGGAAATTAACACTGAGG - Intergenic
1156112747 18:33747051-33747073 TAAATAGGATTTAATCACTGTGG - Exonic
1156378827 18:36538954-36538976 TAAGTAAGATATAATCACTGAGG + Intronic
1162260183 19:9526588-9526610 AAAACAAGATATAAGAACTGTGG + Intergenic
1162293492 19:9796529-9796551 AAATTAGGATATGAGGCCTTAGG + Intergenic
1165338924 19:35196469-35196491 AAACTTGGAAATGAGCACTGTGG - Intergenic
925680510 2:6416058-6416080 AAATTAGGATATCAGAAATGTGG - Intergenic
926662962 2:15488741-15488763 AAATTATGATATCAGTACAGTGG - Intronic
926738467 2:16091966-16091988 AAATAAGGATAGAAGAACTAAGG + Intergenic
926844485 2:17121316-17121338 AGATCAGGATAAAAGCAGTGAGG - Intergenic
927450107 2:23201687-23201709 AAATTAGGATGTCATCACAGTGG - Intergenic
927829256 2:26334324-26334346 AAATTAGGATTAAAGCATTGTGG - Intronic
929365317 2:41147870-41147892 AAAGTAGGATTTAACCAATGAGG - Intergenic
929630104 2:43451323-43451345 AAATGAGGAAATAAGGAGTGTGG - Intronic
929758408 2:44786786-44786808 AAATTGGGATAGAGGCAGTGAGG + Intergenic
930374973 2:50553400-50553422 AAAATTAAATATAAGCACTGAGG + Intronic
931133761 2:59372916-59372938 AAAGTAAGATATAAGTATTGGGG + Intergenic
932638838 2:73420652-73420674 GTATTAGGATTTTAGCACTGGGG + Intronic
934119086 2:88823184-88823206 GAACTAGAATATAAGAACTGGGG + Intergenic
934515954 2:94986720-94986742 AGAGTAGAATATAAGAACTGGGG - Intergenic
937493429 2:122393549-122393571 AAATAAAGTTATAATCACTGGGG + Intergenic
939534496 2:143410628-143410650 AAATTAGGATATAAACTCCATGG - Intronic
939537923 2:143455486-143455508 AAATAAGGATAAAACCTCTGGGG - Intronic
939973605 2:148690516-148690538 AAATTCAGATGTAAGCACAGAGG - Intronic
943397090 2:187352556-187352578 AAATTATGGTATAATTACTGTGG + Intronic
943982606 2:194573595-194573617 AAATTAGGATATTTACTCTGAGG + Intergenic
944988814 2:205210298-205210320 AAATTAGAATATAAGAACACAGG - Intronic
945199292 2:207265206-207265228 AAATTAGGAGCTAGGCAATGTGG - Intergenic
947788370 2:232845530-232845552 AAATTAGGATATATTAACTGAGG + Intronic
1169962821 20:11180903-11180925 AATCTAGAATGTAAGCACTGGGG + Intergenic
1170423995 20:16220181-16220203 TAATTAGCATATGAGCAGTGAGG - Intergenic
1170615440 20:17945432-17945454 AATATAGGATATAATCAATGTGG + Intronic
1170804585 20:19618418-19618440 AAATTAGGATACATGCACAGAGG - Intronic
1177645592 21:23896656-23896678 TAATTAAAATATAAGCACTTAGG - Intergenic
1177733514 21:25059714-25059736 AAATAACAATATATGCACTGTGG + Intergenic
1178326654 21:31651907-31651929 AAATTTGGACATAAGCACACAGG - Intergenic
1179042953 21:37820782-37820804 AGCTTAGGATATAAGAACTTAGG + Intronic
1185107148 22:48879605-48879627 AAATTAGGAGCTATTCACTGAGG - Intergenic
950321446 3:12058606-12058628 AAATCAAGATAAAATCACTGGGG + Intronic
952326474 3:32324840-32324862 AACCTAGTATATAAGCACTTGGG - Intronic
952556770 3:34540491-34540513 AAATTAGGGAATATGCAGTGTGG + Intergenic
955229546 3:57086597-57086619 AAATTAAGACATTAGCTCTGGGG - Intergenic
959781898 3:110243995-110244017 AGATTAAGAGACAAGCACTGTGG + Intergenic
960134757 3:114094019-114094041 GGATTAGGATATAACCACTTAGG - Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
962166637 3:133056103-133056125 AAATAAAGATATAAGAATTGAGG - Intronic
962715625 3:138123631-138123653 GGATTAGGATATAAGTGCTGAGG + Intergenic
963860845 3:150308700-150308722 AAAGTAGGATCTAATCAGTGGGG + Intergenic
965673129 3:171167629-171167651 AAATTAGGAGAAAATCACTCTGG + Intronic
966627781 3:182037121-182037143 TACTTAGGATATAAGGACCGAGG + Intergenic
966729729 3:183140687-183140709 AAATCTGGATATAAGGGCTGGGG + Intronic
967085944 3:186095433-186095455 GAAATAGGATTTAAGCACTGTGG + Intronic
967722911 3:192834376-192834398 AAATAAGGACATGAGGACTGAGG + Intronic
969428682 4:7140493-7140515 AAATGAGGAAATAGGCACAGAGG + Intergenic
974246580 4:59327927-59327949 AAATTAGGTTATAAGAGCAGTGG - Intergenic
974951426 4:68587415-68587437 AAATGAGTATATATGCACTTTGG - Intronic
975755483 4:77567675-77567697 TAATTAGCAGATAAGCAGTGAGG - Intronic
976094283 4:81490919-81490941 AAACTGCAATATAAGCACTGAGG - Intronic
976228652 4:82817503-82817525 AAACTAGAAAATAAACACTGTGG - Intergenic
976946278 4:90772853-90772875 AAAATAGGATATAAAAACTTAGG - Intronic
978824080 4:113000096-113000118 AAAATGGTATATAAGCCCTGCGG - Intronic
979372623 4:119907646-119907668 AAAGAAGGGTATAGGCACTGGGG - Intergenic
979982934 4:127278465-127278487 AACTTAGAATAAAAGCAGTGAGG + Intergenic
980178947 4:129380808-129380830 AATTTAGGATAAAACCACTGGGG + Intergenic
981987237 4:150872951-150872973 AAATTGGAATATAAGAAATGAGG + Intronic
982588095 4:157268362-157268384 AAATTAGAATATTAGTTCTGTGG + Intronic
982808518 4:159796757-159796779 AAATTAGGAAATAAAAACTTGGG + Intergenic
984339251 4:178433180-178433202 AATGAAGGATAAAAGCACTGTGG + Intergenic
985805905 5:2042974-2042996 AAATTTGTATATAATCACAGAGG - Intergenic
986611775 5:9575589-9575611 ACTTTAGTACATAAGCACTGTGG - Intergenic
987222969 5:15809317-15809339 TAATTAGGAAATGATCACTGTGG + Intronic
987832980 5:23122323-23122345 TAATTAGGATATAGGGATTGAGG + Intergenic
987846885 5:23298413-23298435 AAATTCTGAAATAAGCAATGTGG - Intergenic
987921535 5:24288334-24288356 ATATTAAAATATAAGGACTGTGG + Intergenic
988132945 5:27129374-27129396 AAATTAATATATAAGCAGTAAGG + Intergenic
988643283 5:33065645-33065667 CAATTAGGATCTCAGCACTAAGG - Intergenic
991171491 5:63631264-63631286 AAATAATGATATATGCAATGTGG - Intergenic
993769537 5:91908582-91908604 AAATGAGGATATATCCACAGAGG + Intergenic
994683302 5:102917032-102917054 AAATAAGAATATAAGGCCTGTGG - Intronic
994712024 5:103277324-103277346 AAGTTAGAAAATAAGCACTAAGG - Exonic
995152747 5:108868828-108868850 AAATTAGCACATAAGCTCTTAGG + Intronic
996365250 5:122694238-122694260 AAATGAGGATATTAGGATTGTGG + Intergenic
996867206 5:128138535-128138557 AAATTAGACTATAATAACTGAGG - Intronic
997773345 5:136574854-136574876 AAATTAACAAATAAGCAGTGTGG - Intergenic
1001533834 5:172483988-172484010 AGATGAGGTTGTAAGCACTGTGG + Intergenic
1004464077 6:15867178-15867200 AACTTATGATAAAATCACTGAGG - Intergenic
1004522537 6:16375649-16375671 AAATAAAGATACAAGCATTGTGG - Intronic
1005474058 6:26189922-26189944 AAATTAGGATAAGATCACCGAGG + Intergenic
1005958703 6:30681961-30681983 AACTTGGGATATAAGCAGTCTGG - Intronic
1008308697 6:49937658-49937680 AAATTAGGATGTAAGAAATGAGG - Intergenic
1009246340 6:61243293-61243315 AAAATAGGAAATGAGCACTGAGG + Intergenic
1009800991 6:68536116-68536138 AAATTATGAGTTAAACACTGAGG - Intergenic
1010148210 6:72697565-72697587 AAATTAGGATATAATTCCTTAGG + Intronic
1012672407 6:102071454-102071476 AAATCAGGATGAAAACACTGAGG + Intergenic
1014693708 6:124593369-124593391 GAATTAGGATATATGCATAGCGG - Intronic
1015057054 6:128916250-128916272 AAATTGGGATATGAGAATTGAGG + Intronic
1015407621 6:132855474-132855496 AACCTAGTATATAAGCACTTAGG + Intergenic
1016612995 6:146014286-146014308 AATTGATGATATAAGCACTTGGG + Intergenic
1020579991 7:9985060-9985082 AACTGAGGATATAAGGGCTGAGG + Intergenic
1020729442 7:11863265-11863287 CAATCAGGAAATAAACACTGTGG + Intergenic
1021278016 7:18679976-18679998 AAACCAGGAACTAAGCACTGTGG - Intronic
1021399564 7:20194213-20194235 AAATTAGGATATAAAAAAAGCGG - Intronic
1022940906 7:35238430-35238452 GAATTATGATAAAAGCAATGAGG + Intronic
1026466154 7:70656603-70656625 AAATAAGGGTATAAGAGCTGAGG + Intronic
1026585631 7:71653875-71653897 AAATTTAGAAACAAGCACTGTGG + Intronic
1027352887 7:77329673-77329695 TAGGTAAGATATAAGCACTGAGG - Intronic
1030602118 7:111604305-111604327 AAATTATATTAGAAGCACTGAGG - Intergenic
1031696326 7:124859954-124859976 AAATTAAAATAAATGCACTGTGG + Intronic
1032290518 7:130586248-130586270 AAATTAGGAGCTAAGCTATGAGG + Intronic
1033148606 7:138893291-138893313 AAATTAGGAGATAGGGAGTGGGG + Intronic
1033589769 7:142799545-142799567 AAGTTAGGATATTACCACTTCGG + Intergenic
1035847411 8:2880098-2880120 AAATTAATATATAGACACTGGGG + Intergenic
1037084267 8:14827495-14827517 AAAATGTGATATAAGCACTTTGG - Intronic
1038454097 8:27660961-27660983 AAACTGGGATATCAGCTCTGCGG - Intronic
1038632338 8:29257918-29257940 AAATTTGGATATATGCACATAGG - Intronic
1039036171 8:33361596-33361618 GAATTAGAATGTAAGCCCTGTGG + Intergenic
1039067693 8:33623332-33623354 TAATTAGCATATGAGCAGTGAGG + Intergenic
1041488774 8:58409312-58409334 AACCTAGTATATAAGCACTTAGG - Intergenic
1041840729 8:62267627-62267649 ATATCAGGACACAAGCACTGTGG - Intronic
1043808996 8:84710600-84710622 AAATTACAATATATGAACTGAGG - Intronic
1044074882 8:87808254-87808276 AAATTAGGAGCTAAGCTATGAGG + Intergenic
1045743964 8:105395014-105395036 AATTCAGTATAAAAGCACTGTGG + Intronic
1045780669 8:105859368-105859390 ATATTAGGTTATAAACAATGAGG - Intergenic
1045868924 8:106903147-106903169 GAATTAGGATATAAACATTTTGG + Intergenic
1050107759 9:2183089-2183111 TAATTAGAATATAAGCTTTGAGG - Intronic
1050919073 9:11176745-11176767 AAATTAGAATATAAACTCTAAGG + Intergenic
1051133756 9:13894064-13894086 AAATTAGGAATTAAGCATGGAGG + Intergenic
1051158136 9:14173879-14173901 TAATCAGGCTAGAAGCACTGTGG + Intronic
1054887463 9:70214192-70214214 AAATTAGGGTATAAGGAATGAGG + Intronic
1055667264 9:78565258-78565280 AAAATAGGATATAAGTAATCAGG - Intergenic
1055907046 9:81307288-81307310 CAAATAGGATAAAAGCACTTTGG + Intergenic
1060953007 9:127616771-127616793 AAATTAGGTTATAGAGACTGCGG - Intronic
1185972010 X:4675657-4675679 TAATTAGCATATGAGCAGTGAGG + Intergenic
1186872219 X:13784216-13784238 CAATTAGGACATAATCTCTGGGG - Intronic
1187179646 X:16931878-16931900 TAATTAACATATAAGCAGTGAGG - Intergenic
1195741013 X:108064426-108064448 AAATGAGTATATAAGCAATGAGG - Intronic
1196672153 X:118380203-118380225 TAATTAAGATATAACCACTGGGG - Intronic
1196907876 X:120455818-120455840 AAATTAGGTTGTAAGTAGTGAGG + Intronic
1199685501 X:150261521-150261543 AAACTAGGAAATAAGCTCTCTGG + Intergenic
1200455521 Y:3386379-3386401 AAATTAGCATGTAAGAACAGTGG - Intergenic