ID: 1071598111

View in Genome Browser
Species Human (GRCh38)
Location 10:86942623-86942645
Sequence GTGCTGCGAGGCCGAGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071598111_1071598119 7 Left 1071598111 10:86942623-86942645 CCCCGGCCTCGGCCTCGCAGCAC 0: 1
1: 0
2: 7
3: 35
4: 254
Right 1071598119 10:86942653-86942675 CATTCTTGACGTCGTTGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1071598111_1071598120 13 Left 1071598111 10:86942623-86942645 CCCCGGCCTCGGCCTCGCAGCAC 0: 1
1: 0
2: 7
3: 35
4: 254
Right 1071598120 10:86942659-86942681 TGACGTCGTTGCTCAGGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071598111 Original CRISPR GTGCTGCGAGGCCGAGGCCG GGG (reversed) Exonic
900013602 1:135160-135182 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
900043670 1:491143-491165 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
900065108 1:726146-726168 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
900105870 1:980792-980814 GGGCTGCGAGGAGGAGGACGTGG - Exonic
900110113 1:1001729-1001751 GGGCTGCGAGGCCGGAGCGGGGG + Intergenic
900127789 1:1076041-1076063 GTGCTGGGAGGCTGAGGCTATGG + Intergenic
900127884 1:1076339-1076361 GTGCTGGGAGGCTGAGGCTATGG + Intergenic
900162813 1:1232368-1232390 GCGCTGCGCGGCCGAGCCCGGGG + Exonic
900467644 1:2833583-2833605 GTGCTGCGATGCAGAGGGTGGGG + Intergenic
900513520 1:3070906-3070928 GTCACGGGAGGCCGAGGCCGAGG - Intronic
900858366 1:5204581-5204603 ATGCTGCGAAGCTGAGGCTGGGG + Intergenic
902881044 1:19371955-19371977 GTGCTGGGGAGCCCAGGCCGGGG + Intronic
904199790 1:28812293-28812315 GAGCGGCAAGGCAGAGGCCGCGG - Exonic
905912067 1:41662083-41662105 GGGCTGCCAGGCCGCGGCGGGGG + Intronic
906126635 1:43431063-43431085 GTGCTGAGGGTCCGAGGCCGTGG - Exonic
906504888 1:46371682-46371704 TTGTTGGGAGGCCGAGGCGGGGG - Intergenic
906766078 1:48435720-48435742 GGGCGGCGAGGCCGCGACCGGGG - Intronic
907011488 1:50968133-50968155 CAGGTGCGAGGCCGAGGCCAGGG + Exonic
908951673 1:69568674-69568696 GTGCTGCGGGGGCCCGGCCGCGG + Intronic
911094571 1:94044974-94044996 GTGCTCCCAGGCCAACGCCGAGG + Intronic
913009889 1:114672104-114672126 AGCCTGGGAGGCCGAGGCCGCGG + Intergenic
913565637 1:120069719-120069741 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
913632492 1:120723834-120723856 AGGCGGCGGGGCCGAGGCCGCGG + Intergenic
914286233 1:146229093-146229115 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
914547261 1:148679835-148679857 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
914619242 1:149390508-149390530 AGGCGGCGGGGCCGAGGCCGCGG + Intergenic
915589171 1:156860935-156860957 ATGCTGCGAGGCGGACGGCGCGG + Exonic
920201314 1:204261478-204261500 GTGCTGGGTGGATGAGGCCGAGG - Intronic
922100215 1:222472983-222473005 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
924624254 1:245686645-245686667 GGGCCGCGAGCCCGAGGCCAGGG - Exonic
1062855706 10:778538-778560 GTGCTGCGGGGCTGAGGTTGAGG - Intergenic
1062890544 10:1056686-1056708 GGGCTGCGGGGCGGAAGCCGGGG + Intronic
1065207568 10:23371737-23371759 ATTTTGGGAGGCCGAGGCCGGGG - Intergenic
1066733276 10:38451744-38451766 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1068396266 10:56465925-56465947 GTGCAGCCAGGCAGAGGCCCTGG - Intergenic
1068620510 10:59176709-59176731 GTGATGCGGCGCCGAGGCTGAGG - Exonic
1068684520 10:59855923-59855945 GTCCTGGGAGGCCGAGGCTTTGG + Intronic
1069776818 10:70932164-70932186 GGGCTGAGAGGCCCAGGCCTTGG + Intergenic
1070373144 10:75804648-75804670 GTGCTGCCATTCCGAGGCCTGGG + Intronic
1071598111 10:86942623-86942645 GTGCTGCGAGGCCGAGGCCGGGG - Exonic
1072026761 10:91467489-91467511 GTGTGGCGAGGCTGAGGCCCTGG - Intronic
1072059816 10:91798732-91798754 GAGCGCCGCGGCCGAGGCCGTGG + Exonic
1076900915 10:133336946-133336968 CAGCTGCGAGACCGAGGCTGTGG + Intronic
1076969944 11:127374-127396 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1077296080 11:1826876-1826898 GTGCTGTGAGGCTGTGGCCCAGG - Intergenic
1078758794 11:14235202-14235224 GTCCTCCGAGGCCCAGTCCGTGG - Intronic
1079172420 11:18108948-18108970 GAGTTGGGAGGCCGAGGCGGTGG - Intergenic
1082810521 11:57476641-57476663 GTACGGGGTGGCCGAGGCCGGGG + Exonic
1083923366 11:65792110-65792132 GTGCTGGGAGACCGGGGCCAGGG - Intronic
1083924122 11:65795703-65795725 GTGCTGAGAGGCGGGGGCAGTGG - Exonic
1084616589 11:70240490-70240512 GTGCTCAGAGGAGGAGGCCGTGG + Intergenic
1084653812 11:70503787-70503809 GGGCTGGGAGGCAGAGGCCAAGG - Intronic
1084751171 11:71205193-71205215 GTGCTGAGAGTCCGTGGCCTGGG - Intronic
1085717991 11:78889904-78889926 GTGCTGCGGGGCAGGGGTCGGGG + Exonic
1089778403 11:120855805-120855827 ATTTTGCGAGGCCAAGGCCGGGG - Intronic
1089868167 11:121650090-121650112 GTGCTGGGGGGCCGGGGCTGCGG + Intergenic
1090056764 11:123430699-123430721 GTGCCGCGGGGCCGAGGGTGGGG + Exonic
1091198696 11:133753667-133753689 GTGCTGGGAGTCCCAGGCAGTGG + Intergenic
1091274581 11:134341944-134341966 GTGCTGGGTGGCTGAGTCCGGGG - Intronic
1092256072 12:6927600-6927622 GTTGGCCGAGGCCGAGGCCGAGG - Intronic
1092377899 12:7970766-7970788 GTGCTGGGATTCCGAGGGCGGGG + Intergenic
1092761368 12:11813821-11813843 GTGGTTCGAGGCCAGGGCCGTGG + Intronic
1096350717 12:50898092-50898114 ACTCTGGGAGGCCGAGGCCGAGG + Intergenic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1102682315 12:114698987-114699009 GTGCTGCCAGGCTGAGGTTGAGG - Intergenic
1103521285 12:121538038-121538060 GCGCTGCCAGGCCCCGGCCGAGG + Intronic
1103719083 12:122963952-122963974 CTGCTGCAATGCAGAGGCCGTGG + Intronic
1105031418 12:132887176-132887198 GAGGTGCGGGGCTGAGGCCGGGG - Exonic
1107697093 13:43011171-43011193 GTGCTGTGGGGCCAAGGCCAAGG - Intergenic
1108484372 13:50909798-50909820 GAGCCGCGAGGGAGAGGCCGCGG + Exonic
1108573075 13:51769222-51769244 GCGCTCCGAGGCCCAGGGCGCGG - Exonic
1108701563 13:52948476-52948498 GTGCTGTGAGGCTGAGGTCAGGG - Intergenic
1110567622 13:76972148-76972170 ACCCTGGGAGGCCGAGGCCGGGG + Intergenic
1110860538 13:80341143-80341165 AGGCAGCGAGGCCGAGGCGGGGG + Intergenic
1113788534 13:113015499-113015521 GTGCCCCGATGCCGAGGACGCGG + Intronic
1117145902 14:52836633-52836655 GCACTGGGAGGCCGAGGCGGCGG + Intergenic
1118972750 14:70651224-70651246 ATGCTGGGAGGCCAAGGCAGGGG - Intronic
1119615889 14:76099035-76099057 GTGCTGCGGGCCCCAGGCTGGGG - Intergenic
1121909773 14:97778243-97778265 TTGCTGTGAGGCCGAGGCATTGG - Intergenic
1122258921 14:100500745-100500767 GTACTGCGAGGCAGGGGCCTGGG + Intronic
1122292575 14:100687551-100687573 GTGCAGGGAGGGCGAGGCGGGGG + Intergenic
1122603047 14:102930653-102930675 GTTCGCCGGGGCCGAGGCCGAGG + Exonic
1122623690 14:103073705-103073727 CTGCTGGGAGGCCGGGGCTGGGG + Intergenic
1122783773 14:104154726-104154748 GAGCTGCGAGACCGAGGCTCTGG + Intronic
1122920739 14:104878958-104878980 GTGCAGCGGGGCTGAGGCGGGGG + Intronic
1122957549 14:105077888-105077910 GAGCTGCCTGGCTGAGGCCGAGG - Intergenic
1122976295 14:105172229-105172251 GTGCTGGGCGGCCCAGGCTGAGG + Intergenic
1124575492 15:30904062-30904084 CTGCTGCGGAGCCGAGGCCCCGG - Intronic
1128944017 15:71809539-71809561 GAGCTGTGAGGCCGAGTTCGGGG + Intronic
1129413382 15:75361774-75361796 GTGCTGAGGGGCTGAGGCTGGGG - Intronic
1133197795 16:4183604-4183626 GCGCCAGGAGGCCGAGGCCGGGG - Intergenic
1133270014 16:4606535-4606557 CTGGGCCGAGGCCGAGGCCGAGG - Intergenic
1134157046 16:11852150-11852172 GCTCTGGGAGGCCGAGGCGGAGG + Intergenic
1134901808 16:17944749-17944771 CTCCAGCGAGGCCGAGGCTGAGG + Intergenic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1139576827 16:67847160-67847182 GTCCTGTGAGGCGGCGGCCGGGG + Intronic
1140454984 16:75099762-75099784 GTGCTGCGAGGCCCCCGCCATGG + Intronic
1142031277 16:87839701-87839723 GTCGTCCGAGGCCGTGGCCGTGG - Exonic
1142144001 16:88485141-88485163 GTGATGCCAGGCGGAGGCCGTGG + Intronic
1142395215 16:89828237-89828259 GGGGCGCGGGGCCGAGGCCGGGG - Intronic
1142450736 16:90171758-90171780 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1142456829 17:61933-61955 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1142799847 17:2338002-2338024 GCGCTGGGAGCCCAAGGCCGGGG + Intronic
1144850498 17:18241716-18241738 GTGAGGCGGGGCAGAGGCCGAGG + Intronic
1146172934 17:30646836-30646858 GCGCGGCGAGGCAGAGGCCATGG + Intergenic
1146331514 17:31931463-31931485 ATTTTGGGAGGCCGAGGCCGAGG - Intergenic
1146346391 17:32062826-32062848 GCGCGGCGAGGCAGAGGCCATGG + Intergenic
1147110462 17:38257425-38257447 GAGCGGCGAGGACGAGGGCGCGG + Intergenic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147264088 17:39224830-39224852 GGGACGCGAGGCCGCGGCCGGGG - Intronic
1147311604 17:39599122-39599144 GGGCTCCCAGGCCGAGGCTGGGG - Intergenic
1147661909 17:42121257-42121279 GGGCTGCGCAGCCGGGGCCGGGG + Exonic
1148419045 17:47531006-47531028 GAGCGGCGAGGACGAGGGCGCGG - Intronic
1149997489 17:61412566-61412588 GGGCTGTGAGGCCGCGGCCCGGG - Exonic
1151247305 17:72804776-72804798 GCTCTGGGAGGCCGAGGCAGCGG + Intronic
1151812492 17:76452820-76452842 GTGCTCCGAGGCCGGGGGCGCGG - Exonic
1151919010 17:77140366-77140388 GTGCTGCGCGGCCCAGGGCTCGG - Intronic
1152111854 17:78360988-78361010 GTGCTGCGCGGCCCAGGCCTTGG + Intergenic
1152362690 17:79839795-79839817 GTGCCGCGAGGGGGAGGCCCGGG - Intergenic
1153872476 18:9334205-9334227 GCGATGCGAGGCCGAGGCTCGGG - Intergenic
1156890470 18:42184772-42184794 GTACTGCGAGGCGGAGGCGGAGG - Intergenic
1157473731 18:48008422-48008444 CAGCTGCGAGGCGGGGGCCGGGG - Intergenic
1160507605 18:79436238-79436260 GGGGCGCGAGGACGAGGCCGTGG + Intronic
1160646746 19:197292-197314 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1160703097 19:517712-517734 GTGCTGGGAGGAGGAGGCCGAGG + Intronic
1160775425 19:853092-853114 GTGGGGGGAGGCCGGGGCCGGGG + Intronic
1161333752 19:3700213-3700235 GGGCTGCGGGGCCGGGGCGGGGG - Intronic
1161560263 19:4969162-4969184 GGGGTGCGACGCCGAGGGCGGGG + Exonic
1161684064 19:5694501-5694523 CAGCGGCGAGGCCGAGTCCGTGG - Exonic
1162486113 19:10961351-10961373 GTGTCGCGAGGCCGTGGCAGCGG + Intronic
1162664140 19:12195365-12195387 GGGCGCCGAGGCTGAGGCCGGGG - Intergenic
1162832969 19:13298650-13298672 GGGCGGCGAGGGCGAGGGCGAGG - Exonic
1162906003 19:13824485-13824507 GATTTGGGAGGCCGAGGCCGGGG + Intronic
1163128448 19:15257212-15257234 GTGATGCTAGGCCGCGGCCTGGG - Intronic
1163304888 19:16471835-16471857 GTGCGGCGAGGCTGAGGCGCTGG - Intronic
1166986127 19:46660884-46660906 GGGCGCCGAGGCCGAGGACGAGG - Exonic
1167648919 19:50719352-50719374 CAGCTGCGGGGCCGGGGCCGCGG - Intronic
1168654689 19:58118458-58118480 GTGCGACGAGGGCGGGGCCGGGG + Intergenic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
927842915 2:26456805-26456827 GTGGTGTGAGTCAGAGGCCGAGG + Intergenic
929107233 2:38377115-38377137 GGCCAGCGAGGCAGAGGCCGCGG - Intronic
929701917 2:44169359-44169381 GTGCTGCCGAGCCGCGGCCGGGG + Intronic
929789674 2:45013688-45013710 GTGCGGCGCGGGCGACGCCGCGG - Intergenic
932496682 2:72149026-72149048 GTGGTGAGAGGCCGGGCCCGCGG + Intergenic
932819241 2:74885532-74885554 TGGCTGCGAGGGCGAGGACGTGG + Exonic
933907952 2:86913999-86914021 GCCCGGCCAGGCCGAGGCCGAGG - Intronic
933908014 2:86914161-86914183 GTCCGGCCAGGCCGAGGCCGAGG - Intronic
933908128 2:86914475-86914497 GCCCGGCCAGGCCGAGGCCGAGG - Intronic
934011416 2:87824693-87824715 GAGAGGTGAGGCCGAGGCCGAGG + Intronic
934011441 2:87824767-87824789 GCCCGGCCAGGCCGAGGCCGAGG + Intronic
934011469 2:87824841-87824863 GCCCGGCCAGGCCGAGGCCGAGG + Intronic
934011557 2:87825395-87825417 GCCCGGCCAGGCCGAGGCCGAGG + Intronic
934011574 2:87825441-87825463 GCCCGGCCAGGCCGAGGCCGAGG + Intronic
935236926 2:101147066-101147088 GCTTTGAGAGGCCGAGGCCGAGG + Intronic
936262321 2:110972264-110972286 GTGCTCCAAGGCCTAGGCTGGGG + Intronic
936585753 2:113756450-113756472 GCTCTGTGAGTCCGAGGCCGCGG - Exonic
937440253 2:121909117-121909139 GTGCTGAGTGGCTGAGGCCCGGG + Intergenic
937773089 2:125745049-125745071 GTGCTACCAGGCAGAGGCTGGGG + Intergenic
939491431 2:142881996-142882018 GCACTGGGAGGCCGAGGCAGGGG - Intronic
941099514 2:161281177-161281199 CTGCTGCGAGGCTGCGCCCGAGG + Intergenic
941102170 2:161308427-161308449 GTGCTTCGCGGCGGAGGCCCGGG + Exonic
944615107 2:201451787-201451809 GGGCGGCGAGGCCGCGACCGGGG - Exonic
946020042 2:216634362-216634384 CTGCTGGGAGGCGGAGGCTGCGG + Intronic
946354589 2:219176949-219176971 GAGCTGCGAGGGCGAGGGCGAGG - Intronic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
948479114 2:238239486-238239508 GTGCTGCGGGGCCGGGCGCGCGG - Exonic
948995554 2:241576464-241576486 GTGCTGCGGTGCCGTGGCCAAGG + Intergenic
1168753205 20:298000-298022 GCCCGGCGAGGCCGAGGACGCGG + Exonic
1169171802 20:3471217-3471239 GGGCTGGGAGGCCGGGGCTGGGG + Exonic
1169171821 20:3471338-3471360 GCCCTGTGAGGCCGAGGCCGCGG + Exonic
1171464643 20:25319069-25319091 CTGCTGCGGGGCCAGGGCCGAGG - Intronic
1171475064 20:25402281-25402303 CTACTGGGAGGCCGAGGCAGTGG + Intergenic
1172197553 20:33102438-33102460 GAGATGGGAGGCTGAGGCCGGGG - Intronic
1172556873 20:35849800-35849822 GTGCTGCCAGGAGGAGGCAGGGG + Intronic
1172596565 20:36154619-36154641 GGGCTCCGAGGCCGGGGCGGGGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172702893 20:36863590-36863612 GCGCGGCGAGGCCGAGGGGGCGG - Exonic
1173569632 20:44067953-44067975 GTGCTGGGAGGCCGAGGCTAGGG - Intronic
1174873994 20:54208229-54208251 GGGACCCGAGGCCGAGGCCGAGG + Intronic
1175443780 20:59007210-59007232 CTGGGCCGAGGCCGAGGCCGGGG - Exonic
1175877793 20:62238643-62238665 GAGCTGCGGGGCCTGGGCCGCGG + Intronic
1176102264 20:63369940-63369962 GTGCTGGGAGGCAGAGCCTGAGG - Intronic
1176207206 20:63895476-63895498 CTGCTGCGACGCCGCGGCCTGGG + Intronic
1176278759 20:64288934-64288956 CCGCTGTGAGGCCAAGGCCGAGG - Intergenic
1176332022 21:5558087-5558109 GTGCTGCAAGGCCTATGCCAAGG - Intergenic
1176395735 21:6262864-6262886 GTGCTGCAAGGCCTATGCCAAGG + Intergenic
1176402070 21:6322865-6322887 GTGCTGCAAGGCCTATGCCAAGG - Intergenic
1176435087 21:6666239-6666261 GTGCTGCAAGGCCTATGCCAAGG + Intergenic
1176441422 21:6726240-6726262 GTGCTGCAAGGCCTATGCCAAGG - Intergenic
1176459349 21:6993309-6993331 GTGCTGCAAGGCCTATGCCAAGG + Intergenic
1176465684 21:7053309-7053331 GTGCTGCAAGGCCTATGCCAAGG - Intronic
1176489245 21:7435087-7435109 GTGCTGCAAGGCCTATGCCAAGG - Intergenic
1176861164 21:14012286-14012308 GTGCTGTGGGGCAGGGGCCGGGG + Intergenic
1178846783 21:36180634-36180656 ATACTGGGAGGCCGAGGCGGGGG + Intronic
1179457131 21:41507700-41507722 GTGCTCCCAGGCGGGGGCCGTGG + Intronic
1180216174 21:46324780-46324802 TTCCTGCGCGGCCGGGGCCGGGG + Intronic
1181271025 22:21658441-21658463 GTGCAGCCAGGCCGAGGGCTAGG + Intronic
1181967978 22:26669820-26669842 GTGCAGGGAGGCGGAGGCCCTGG + Intergenic
1183650842 22:39152492-39152514 GAGCTGCGGGGCCGCGGCTGCGG + Exonic
1183655273 22:39180778-39180800 GTGGAGCGAGGCCAAGGCCAAGG + Intergenic
1183675475 22:39296895-39296917 GTTCTGCCAGCCCCAGGCCGGGG + Intergenic
1183869328 22:40729339-40729361 CTTTTGGGAGGCCGAGGCCGAGG - Intergenic
1184222768 22:43111208-43111230 GGGCTGTGCGGCCGCGGCCGTGG - Intronic
1184332083 22:43833583-43833605 GAGCTGCCAGGCCGAGGGCCAGG + Intronic
949559429 3:5188112-5188134 GTGCTGGGCGGCCGGGGCCGCGG + Exonic
949925461 3:9037645-9037667 ATGCTGCGAGGCCCAGCCTGAGG - Intronic
951915875 3:27800188-27800210 GTTTTGGGAGGCCGAGGCAGTGG - Intergenic
956691119 3:71878368-71878390 GTGCTGCGGTGCTGATGCCGAGG + Intergenic
960864285 3:122184284-122184306 GAGCTCCGGGGCCGGGGCCGGGG + Intronic
961508221 3:127385626-127385648 CTCCTTCGAGGCCGAGGCCGAGG + Intergenic
961754842 3:129121645-129121667 GTGGGGCGGGGCCGAGGCCGAGG - Exonic
963827406 3:149970556-149970578 GGGCGGGGAGGCCGAGGCCCGGG - Intronic
966221787 3:177558602-177558624 ATGTTGGGAGGCCGAGGCAGGGG - Intergenic
966676116 3:182592327-182592349 GTGCTGCAAGCCCCAGGCTGTGG - Intergenic
968092809 3:195909102-195909124 GCGCGGCGAGGCCCGGGCCGGGG - Intronic
968370935 3:198222230-198222252 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
968764731 4:2462472-2462494 GTCCTGCGAGGGCGCCGCCGGGG - Exonic
971301462 4:25445702-25445724 GTGCTGTGAGAGCGAGGCCATGG - Intergenic
974716045 4:65669787-65669809 GCTCTGCGAGGCCGAAGCGGTGG - Exonic
975710608 4:77157337-77157359 GGGCTGTGAGGCCGAGGCGGCGG + Exonic
976629373 4:87220699-87220721 GAGCCGCGGGGGCGAGGCCGTGG - Intronic
978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG + Intronic
979259621 4:118634718-118634740 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
979328752 4:119405906-119405928 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
979785561 4:124712383-124712405 AAGCTGGGAGGCCGAGGCCGTGG - Intronic
981837730 4:149075366-149075388 GTGCTGGGAGGCCAAGGAGGTGG - Intergenic
983398497 4:167233922-167233944 CTGCTCCGAGGCGGGGGCCGCGG - Intronic
984638986 4:182143224-182143246 GTGATGCGGGGCGGAGGCCTAGG + Intergenic
985129123 4:186723963-186723985 GGACTGCGTGGCCGAGCCCGCGG - Intronic
985587057 5:745871-745893 GTGCTGAGAGCCCCAGGCCCAGG + Intronic
985589553 5:757486-757508 GTGGTGCCAGGACGAGGCTGAGG - Intronic
985601626 5:838054-838076 GTGCTGAGAGCCCCAGGCCCAGG + Intronic
985897062 5:2755083-2755105 TTCCTGCGAGGCCGAGCGCGAGG + Exonic
985941834 5:3142463-3142485 GTTCTGCGGGGCCGGGGCCCTGG + Intergenic
986056557 5:4143098-4143120 AGGCCGGGAGGCCGAGGCCGAGG - Intergenic
991994956 5:72377714-72377736 GTACTGGGAAGCCGAGGCTGTGG - Intergenic
992916807 5:81463453-81463475 GCTTTGCGAGGCCGAGGCGGGGG + Intronic
996208924 5:120780804-120780826 GCTCTGGGAGGCCGAGGCGGGGG + Intergenic
1001674323 5:173499643-173499665 GTGCTGCCAGGCCCAGTCCCCGG + Intergenic
1002498516 5:179632375-179632397 GTGCTGCCTGGCCGCGGCGGGGG - Intronic
1002730173 5:181327786-181327808 CTGCTGTGAGGCCGAGGCCGAGG - Intergenic
1002754360 6:146313-146335 CCGCTGTGAGGCCAAGGCCGAGG + Intergenic
1004660763 6:17707007-17707029 GTGCCGCGCGGCCGAGAGCGTGG - Intergenic
1005635020 6:27744937-27744959 GTTTTGGGAGGCCGAGGCAGGGG - Intergenic
1006642466 6:35496420-35496442 GCGCTGGGAGGCCGGGCCCGAGG + Intronic
1007816239 6:44527573-44527595 GTGAGGAGAGGCAGAGGCCGTGG + Intergenic
1017194451 6:151684805-151684827 GTGCTGGGGGGCCAAGGCTGCGG + Intronic
1018215066 6:161518606-161518628 GTGCTGCTAGGGGGAGGCCGTGG - Intronic
1019474387 7:1236864-1236886 GGGCTGGGAGGCCGAGGGCCGGG - Exonic
1019616778 7:1966806-1966828 GTGCTGGGAGGCGAGGGCCGCGG + Intronic
1019723442 7:2587284-2587306 GGGGTGCGAGGCAGAGGCCTGGG + Intronic
1019927976 7:4205879-4205901 GTTCTGCGGGGCCATGGCCGGGG - Exonic
1020080672 7:5284137-5284159 GTTCTGGGAGGCCGGGGCTGAGG + Intronic
1022909942 7:34891203-34891225 ATGTTGGGAGGCCGAGGCTGGGG - Intergenic
1024112445 7:46161106-46161128 GTGCTGCGAAGCCGAGGCCCTGG + Intergenic
1024579876 7:50793100-50793122 GCGCTGGGCGGCCGCGGCCGGGG - Intronic
1025673695 7:63628896-63628918 GTTCTGGGAGGCCGGGGCTGAGG + Intergenic
1029926974 7:104328650-104328672 GTGCTGCTGGGCTGAGGCGGAGG + Exonic
1032756989 7:134900541-134900563 GTGCTGCGAGGGCTAGGCCTGGG - Intronic
1033253223 7:139777885-139777907 GGGCGGAGCGGCCGAGGCCGAGG + Intronic
1035468417 7:159094460-159094482 CTGCTGGGAGGCCCAGGTCGTGG + Intronic
1035472526 7:159119521-159119543 GCGGTGCGAGGCAGAGGCCGAGG + Intronic
1035695099 8:1590093-1590115 GTCCTGGGAGGCAGAGGCCGAGG - Intronic
1036162474 8:6402509-6402531 ACTCTGGGAGGCCGAGGCCGGGG + Intergenic
1038540350 8:28385871-28385893 GGTCTGGGAGGCCGGGGCCGCGG - Intronic
1038544168 8:28412574-28412596 GTGCTGTGTGGCCCAGGCTGGGG + Intronic
1039136012 8:34323402-34323424 CTGCGACGAGGCCAAGGCCGTGG - Intergenic
1042614833 8:70636673-70636695 ATGCTGGGAGGCTGAGGCAGGGG + Intronic
1043851951 8:85225807-85225829 ATCTTGGGAGGCCGAGGCCGAGG + Intronic
1047081956 8:121472265-121472287 GCGCAGCCAGGCAGAGGCCGAGG + Intergenic
1047621097 8:126608720-126608742 GTGTTGAGAGGCTGAGGCCAGGG + Intergenic
1049194686 8:141308617-141308639 GTGCGGAGGGGCCGGGGCCGGGG - Intergenic
1049558722 8:143296837-143296859 TGGGCGCGAGGCCGAGGCCGGGG + Exonic
1052342377 9:27376769-27376791 GTGCTGCTAGGTTGAGGCCTGGG - Intronic
1054798565 9:69325186-69325208 GGGCTCCGAGGCCGAGGGGGAGG - Intronic
1056902558 9:90613410-90613432 GAGCAGCGAGGCGGAGGCCTTGG - Exonic
1057245531 9:93451678-93451700 CCGCTGCGAGGCCGAGGCCGAGG - Intronic
1057592367 9:96383604-96383626 CGGCGGCCAGGCCGAGGCCGAGG - Exonic
1060855816 9:126914629-126914651 GAGCTCGGAGGCCGAGGCCCGGG + Intergenic
1061138585 9:128750973-128750995 GTGCTGTGAGGCCCAGGCTGGGG + Intronic
1061297451 9:129684634-129684656 GTGCTGATTGGCCGAGGCCTGGG + Intronic
1061314871 9:129788713-129788735 CTGTTGGGAGGCCGAGGCGGGGG - Intergenic
1061804880 9:133132347-133132369 GGGGTGAGAGGCCGAGGCTGGGG - Intronic
1062100204 9:134724021-134724043 GTGGTGCGAGGCAGGGGCCGAGG - Intronic
1062562363 9:137147110-137147132 GTGATGGGAGTCCGTGGCCGTGG - Intronic
1062754584 9:138280300-138280322 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1203430076 Un_GL000195v1:82246-82268 GTGCTGCAAGGCCTATGCCAAGG + Intergenic
1203436449 Un_GL000195v1:142408-142430 GTGCTGCAAGGCCTATGCCAAGG - Intergenic
1203578490 Un_KI270745v1:24460-24482 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1189337013 X:40176344-40176366 GATCCGTGAGGCCGAGGCCGGGG - Intronic
1189445480 X:41076852-41076874 GTGCTGAGGGGCCGAGGCCGCGG + Intergenic
1190246871 X:48696673-48696695 GTGCTGCGAGTCGGGAGCCGCGG + Intronic
1197294747 X:124705132-124705154 GTGCTTCGAGGAAGAGGCCTGGG + Exonic
1197726506 X:129780543-129780565 CTCCTGAGAGGCCGTGGCCGGGG - Intronic
1198829123 X:140730117-140730139 GCACTGGGAGGCCGAGGCGGGGG - Intergenic
1200093873 X:153648220-153648242 GCGCGGGGAGGCCGAGGCCGAGG + Exonic
1200211794 X:154349910-154349932 GTGCTGGGTGGCCGAGGACAGGG - Intronic