ID: 1071604352

View in Genome Browser
Species Human (GRCh38)
Location 10:86974502-86974524
Sequence ATGAAGAAGAAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3527
Summary {0: 1, 1: 3, 2: 39, 3: 443, 4: 3041}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071604352_1071604356 -3 Left 1071604352 10:86974502-86974524 CCTTCCTCCCTCTTCTTCTTCAT 0: 1
1: 3
2: 39
3: 443
4: 3041
Right 1071604356 10:86974522-86974544 CATCCCCATTTTCAGTCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071604352 Original CRISPR ATGAAGAAGAAGAGGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr