ID: 1071607765

View in Genome Browser
Species Human (GRCh38)
Location 10:87009305-87009327
Sequence TAAGTGGGCCAGTTTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071607759_1071607765 7 Left 1071607759 10:87009275-87009297 CCACTGCGTGGACTGTGAGACCC 0: 1
1: 8
2: 3
3: 7
4: 129
Right 1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG No data
1071607758_1071607765 8 Left 1071607758 10:87009274-87009296 CCCACTGCGTGGACTGTGAGACC 0: 1
1: 8
2: 3
3: 10
4: 105
Right 1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG No data
1071607756_1071607765 28 Left 1071607756 10:87009254-87009276 CCAAAACATGCGTGGGAACTCCC 0: 1
1: 8
2: 2
3: 2
4: 52
Right 1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071607765 Original CRISPR TAAGTGGGCCAGTTTGAACT TGG Intergenic
No off target data available for this crispr