ID: 1071611147

View in Genome Browser
Species Human (GRCh38)
Location 10:87032298-87032320
Sequence AAAGAAAAGAAAAAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102151
Summary {0: 7, 1: 121, 2: 2523, 3: 39719, 4: 59781}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071611147_1071611151 20 Left 1071611147 10:87032298-87032320 CCTGTTTTTTTTTTCTTTTCTTT 0: 7
1: 121
2: 2523
3: 39719
4: 59781
Right 1071611151 10:87032341-87032363 TTTTCTCCCCCACCACAGTGTGG No data
1071611147_1071611148 -7 Left 1071611147 10:87032298-87032320 CCTGTTTTTTTTTTCTTTTCTTT 0: 7
1: 121
2: 2523
3: 39719
4: 59781
Right 1071611148 10:87032314-87032336 TTTCTTTTTTTTCCTTTTGTTGG No data
1071611147_1071611152 21 Left 1071611147 10:87032298-87032320 CCTGTTTTTTTTTTCTTTTCTTT 0: 7
1: 121
2: 2523
3: 39719
4: 59781
Right 1071611152 10:87032342-87032364 TTTCTCCCCCACCACAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071611147 Original CRISPR AAAGAAAAGAAAAAAAAAAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr