ID: 1071611149

View in Genome Browser
Species Human (GRCh38)
Location 10:87032326-87032348
Sequence GGAGAAAAACGGCCAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071611149_1071611151 -8 Left 1071611149 10:87032326-87032348 CCTTTTGTTGGCCGTTTTTCTCC No data
Right 1071611151 10:87032341-87032363 TTTTCTCCCCCACCACAGTGTGG No data
1071611149_1071611158 12 Left 1071611149 10:87032326-87032348 CCTTTTGTTGGCCGTTTTTCTCC No data
Right 1071611158 10:87032361-87032383 TGGGAATTTAGCCACTTCAGAGG 0: 15
1: 33
2: 25
3: 29
4: 172
1071611149_1071611152 -7 Left 1071611149 10:87032326-87032348 CCTTTTGTTGGCCGTTTTTCTCC No data
Right 1071611152 10:87032342-87032364 TTTCTCCCCCACCACAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071611149 Original CRISPR GGAGAAAAACGGCCAACAAA AGG (reversed) Intergenic
No off target data available for this crispr