ID: 1071611152

View in Genome Browser
Species Human (GRCh38)
Location 10:87032342-87032364
Sequence TTTCTCCCCCACCACAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071611149_1071611152 -7 Left 1071611149 10:87032326-87032348 CCTTTTGTTGGCCGTTTTTCTCC No data
Right 1071611152 10:87032342-87032364 TTTCTCCCCCACCACAGTGTGGG No data
1071611147_1071611152 21 Left 1071611147 10:87032298-87032320 CCTGTTTTTTTTTTCTTTTCTTT 0: 7
1: 121
2: 2523
3: 39719
4: 59781
Right 1071611152 10:87032342-87032364 TTTCTCCCCCACCACAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071611152 Original CRISPR TTTCTCCCCCACCACAGTGT GGG Intergenic
No off target data available for this crispr