ID: 1071611787

View in Genome Browser
Species Human (GRCh38)
Location 10:87038554-87038576
Sequence TGCCCTGCAAGTACTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071611787_1071611790 -2 Left 1071611787 10:87038554-87038576 CCTGCTGCAGTACTTGCAGGGCA No data
Right 1071611790 10:87038575-87038597 CAGGGTGTACACATACATGCAGG No data
1071611787_1071611791 2 Left 1071611787 10:87038554-87038576 CCTGCTGCAGTACTTGCAGGGCA No data
Right 1071611791 10:87038579-87038601 GTGTACACATACATGCAGGCTGG No data
1071611787_1071611792 6 Left 1071611787 10:87038554-87038576 CCTGCTGCAGTACTTGCAGGGCA No data
Right 1071611792 10:87038583-87038605 ACACATACATGCAGGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071611787 Original CRISPR TGCCCTGCAAGTACTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr